A real-time PCR method for quantifying mixed cashmere and wool based on hair mitochondrial DNA

Abstract

Cashmere, a kind of luxury fiber obtained from cashmere goat, is characterized by its fineness, lightness, and softness. Products made of cashmere are much more expensive than those of sheep wool, so adulteration and false declaration occur quite often in the industrial chain. We here describe a method for quantifying cashmere and wool mixture based on mitochondrial DNA extracted from natural or processed animal hair. Two sets of TaqMan polymerase chain reaction (PCR) primers and probes that can react specifically to goat and sheep mitochondrial 12 S ribosomal (rRNA) genes were designed. The two systems exert almost the same amplification rate. Cashmere collected from different producing areas of China, and cashmere from individual goats of different age were employed to verify the method, and no significant difference was found between different cashmere samples, which proved that the copy number of mitochondrion has little impact on quantifying results. Thus, the method can be applied to quantify each component in a cashmere/wool mixture. The method will also be of great value in inspection of the quality of cashmere products on the world markets.

Keywords

TaqMan-PCR cashmere wool mitochondrial DNA quantification

Cashmere, characterized by its fineness, lightness and softness, is the downy hair collected from cashmere goats (Capra hircus) in spring, with each one producing roughly 100–200 g fine down hair. Cashmere, famous for its high performance and rareness, is more expensive than wool with an identical diameter. The price gap between the two fibers is quite significant, and can be 30-fold or even more.¹ False declaration and adulteration with cheap sheep wool (Ovis aries) is quite common due to the financial gains.

Currently, cashmere and wool are mainly identified by high power optical or electron microscopic examination according to the morphology of the scales of individual fibers.² The method is subject to the expertise of the examiner, and is also limited by commercial processing of the fibers. Bleaching, dyeing, and finishing treatments will destroy the distinctive structure of scales, thus complicate the analysis.¹ Scanning electron microscopy (SEM) is the only established method for identification of fibers according to an international standard. However, it is expensive and time-consuming.¹

Quantitative analysis of cashmere/wool mixture remains difficult by traditional analysis methods due to the two following reasons: on the one hand, some interested parties adulterate cashmere with fine descaled wool or stretched wool for financial gains; on the other hand, an undesirable increase in fiber diameter appears after the wide spread of some new breeds of cashmere goats in pursuit of high cashmere yield,³ together with an increase in the height of cuticle scale edge, which blurs the differentiation.³

A large global market exists for the fine and high quality fibers; therefore, it is imperative for us to establish a reliable, objective method to quantify cashmere and wool mixtures. This will also be of value in both quality control and in the reduction of false declarations. DNA, a species-specific genetic material that exists in each cell and exhibits a relatively strong capacity to resist physical and chemical treatments, seems to be an ideal target for species identification. As goats and sheep belong to different genuses, some DNA analytical methods have been developed to solve the problem, such as DNA hybridization analysis,^4,5 PCR-RFLP (restriction fragment length polymorphism) analysis,² and species-specific PCR.¹ These methods, however, are limited to qualitative distinguishing of fibers and are unsuitable for the quantification of each component.

Real-time PCR is characterized by its sensitivity, which can be employed to measure the rate of amplification throughout the cycles. Value of cycle threshold (Ct), is used to detect the amplification, which is inversely proportional to original DNA quantity. Real-time PCR can be used to quantify amount of DNA in unknown samples.⁶ A real-time PCR based quantification method has been developed to detect the content of cashmere in a cashmere/wool mixture by Ji et al.⁷ Ji’s work reports the first DNA-based quantitative assay for quantifying cashmere and wool mixtures, setting a good example for application of real-time PCR to resolve quantifying problem. The quantifying method targets mitochondrion DNA extracted from animal hair; however, there still remains a question: the amount of copies of mitochondrion tends to vary significantly between different breeds and even between some tissues of an individual, so whether it is relatively stable in animal hair remains unknown.

In the current study, a similar quantifying method was developed. Advantages include the fact that the two TaqMan PCR systems share almost identical amplification rates, which will definitely improve the accuracy of the quantification method. In addition, as copy numbers of mitochondrion might vary significantly among different breeds and different individuals, cashmere samples collected from different regions and individuals of different age were employed to confirm its feasibility. Cashmere and wool mixture dyed with reactive dyes and acid dyes, which are commonly used in the animal fiber dying industry, were quantified to test its practicability. Three pieces of commercial fabrics were randomly picked to test the content of cashmere; the results were within 10% of those obtained by microscopic examination.

Material and methods

Reference material and samples

For use as standard reference materials, cashmere was collected from Inner Mongolia and fine wool with similar diameter was bought from Shanghai First Top Textile Co. Ltd. Wools produced in six foreign countries were from our laboratory stock, imported from those countries. As in general no reference fiber mixtures are commercially available, the fiber blends were prepared by gravimetrically mixing two different reference materials (cashmere/wool) in the ratios 1 : 9, 2 : 8, 3 : 7, 4 : 6, 5 : 5, 6 : 4, 7 : 3, 8 : 2, and 9 : 1. These reference mixtures were analyzed by microscopic examination, and subsequently used as calibration material to determine the standard curve of the real-time PCR quantifying system developed.

DNA extraction

The fibers (0.4 g each unit) were processed by drilling and grinding in liquid nitrogen with a SPEX freezer mill 6870 (SPEX Sample Prep LLC, NJ, USA) into tiny particles. The drilling and grinding was carried out in the following steps: pre-cool 5 min, followed by 2 cycles of run 1 min with rate of 10 cps, cool 1 min. DNA was extracted with the help of a commercially available “Tissue and Hair Extraction Kit (for use with DNA IQ ™)” (Promega, Madison, USA) following the protocol of “DNA purification from hair follicles and hair shafts” in the handbook TB307 (Promega, Madison, USA). 10 mg of mixed animal hair was weighed and put into a 2 mL microcentrifuge tube. 200 µL dithiothreitol (DTT) and 140 µL proteinase K buffer were added and incubated at 56℃ at least 4 h with constantly shaking (1000 rpm.). Buffer and sample mixture were then transferred to a 1.5 mL microcentrifuge tube, and 680 µL lysis buffer was added at room temperature for 2 min. Supernatant was collected after centrifuge. DNA was purified by adding 14 µL resin. After several cycles of washing and drying of the resin, DNA was eluted in 100 µL of elution buffer.

Primer and probe design

Species-specific primers and TaqMan probes for the detection of goat and sheep were designed. The DNA sequences of Capra hircus and Ovis aries mitochondrion were obtained from the National Center for Biotechnology Information (NCBI) web site (accession nos. GU068049, GU229281.1, GU229279.1, GU009278.1, NC_005044.1, NC_001941.1, AY858379.1, EF490451.1, EF490452.1, EF490453.1, EF490454.1, EF490455.1, EF490456.1, HM236178.1, HM236181.1). TaqMan probes and primers were designed using the Primer Express software V3.0 (Applied Biosystems, Foster City, CA). A 67 bp fragment of the mitochondrial 12srRNA gene was selected as target site for the specific detection of goat. A 97 bp fragment of the mitochondrial 12srRNA gene was selected as target site for the specific detection of sheep. Additionally, common forward and reverse primers and probe for goat and sheep were designed to amplify a conserved region of 61 bp of 12SrRNA gene as a control of amplificability and false negativity on PCR results. The details are shown in Table 1. Primers and probes, labled 5′-carboxyfluorescein (FAM) and 3′-minor groove binder (MGB) were synthesized by Invitrogen, China.

Table 1.

Oligonucleotide sequences for TaqMan reactions

Target gene	Oligonucleotide sequences (5′ - 3′)	Concentration (μM)	Size
Goat 12 S rRNA	CCCGTCACCCTCCTCAAGT	0.4	67 bp
	CCTCTCATGTAGTTGATGCGTGTT	0.4
	FAM-AATACAATGCACTCAAGC-MGB	0.25
Sheep 12 S rRNA	CGTCACCCTCCTCAAGTAAATATGA	0.4	97 bp
	TTCCAGTATGCTTACCTTGTTACGA	0.4
	FAM-ACCTATTTACATATATCAACCACAC -MGB	0.25
Common 12 S rRNA	GCCAGAGTACTACCGGCAACA	0.3	61 bp
	GGCTCCTCTAGAAGGGTATAAAGCA	0.3
	FAM- CGAAACTCAAAGGACTTGG -MGB	0.2

Quantitative PCR-detection

The TaqMan PCR reactions were performed in a final volume of 20 μl, 0.4 μM of each primer and 0.25 μM TaqMan probe, including 10 µL of TaqMan master mix (Applied Biosystems, Foster City, CA) and 4 µL DNA. The amplifications were performed on ABI 7500 (Applied Biosystems, Foster City, CA) and thermal cycling protocol was as follows: 95℃ 5 min followed by 40 cycles of 95℃ for 15 s and a temperature 60℃ for 45 s. The Ct values of the target gene were obtained using 7500 SDS software 1.3.2 (Applied Biosystems, Foster City, CA). The same program was used to amplify the endogenous control PCR fragments.

PCR primers specificity test and PCR amplification rate

The specificity of goat and sheep specific testing systems was confirmed by amplification of DNA extracted from fiber of cashmere, wool, and dd-H₂O as negative control. PCR efficiency of both goat and sheep 12 S rRNAs were examined by making standard curves using serial dilutions.

Results

Specificity of the TaqMan probe system

In this research, two TaqMan probe systems were designed specifically to goat and sheep, respectively, and the amplification condition was optimized through experiments. TaqMan primer/probe combination on goat and sheep mitochondrial DNAs were tested. As shown in Figures 1 and 2, the goat Taqman primer/probe reacts with goat DNA, and a little cross-reaction with sheep DNA, while the sheep TaqMan primer/probe combination reacts only with sheep DNA. When comparing the Ct value of each primer/probe to its corresponding mitochondrial DNA with that of the other species, the difference is more than 10 cycles, indicating the cross-reaction of a primer/probe with different DNAs is far less than 1%.

Figure 1.

Goat-specific TaqMan PCR applied to extracted fiber DNA from goat and sheep sources.

Figure 2.

Sheep-specific TaqMan PCR applied to extracted fiber DNA from goat and sheep sources.

Sensitivity and linearity of TaqMan probe system

To determine the sensitivity and linearity of the real-time PCR system, 10-fold serial dilutions of the mitochondrial DNA obtained from cashmere and wool were prepared, and Ct values were determined. As shown in Figures 3 and 4, fluorescence signals of 1:10,000 dilutions of both systems were detected. It has been observed that the two standard curves obtained by plotting the Ct values corresponding to logarithmic DNA concentrations show a linear correlation (coefficient of correlation >0.99). In addition, the slopes of the two calibration curves for goat and sheep are −3.474 and −3.499, respectively, which can be converted to the corresponding PCR amplification efficiency of 94% and 93%, respectively, which are quite close to the theoretical efficiency of 100% (Figures 3 and 4).

Figure 3.

Threshold cycle of goat TaqMan PCR vs. goat DNA concentration. Goat genomic DNA was diluted in a 10-fold series and the slope of the line is a measure of the efficiency of the goat TaqMan PCR.

Figure 4.

Threshold cycle of sheep TaqMan PCR vs. sheep DNA concentration. Sheep genomic DNA was diluted in a 10-fold series and the slope of the line is a measure of the efficiency of the sheep TaqMan PCR.

Quantifying standard curve

According to the mathematical principles of fluorescence quantification, when the amplification rates of the two systems are quite similar, which can be viewed as a constant, there is a theoretical linear relationship between the logarithmic ratio of cashmere/wool and the difference between goat and sheep Ct in a mixture,⁷ as is shown in Figure 5. Three separate experiments for each sample were done in triplicate, and average Ct values were used to fit the curve. Due to the linear relationship, any unknown sample of mixed cashmere and wool can be measured for its goat and sheep TaqMan Ct; then the content of each component can be estimated through referring to the standard curve.

Figure 5.

Logarithmic ratio of cashmere/wool vs. difference between goat Ct and sheep Ct.

Method verification

Specific content of cashmere

Mixed samples of 1%, 10%, 50%, 90%, and 99% of cashmere, the same source of standard references, with 10 independent samples for each level, were prepared to verify the accuracy of the current method. Ct values of each sample were collected and contents of cashmere were calculated. The results are shown in Table 2.

Table 2.

Testing results of three groups of parallel experiments

Input	1	2	3	4	5	6	7	8	9	10	average	SD
1%	0.7	1.5	0.9	1.3	0.8	1.3	1.8	1.6	1.1	1.0	1.2	0.4
10%	9.1	8.1	9.1	9.2	9.1	10.3	10.6	10.7	10.6	12.5	9.9	1.2
50%	45.3	49.7	45.9	47.0	45.1	48.0	49.1	48.2	51.2	51.9	48.1	2.4
90%	92.5	89.2	89.1	89.2	89.6	90.1	91.2	90.9	90.6	93.7	90.6	1.5
99%	97.6	97.9	98.1	99.2	98.3	98.7	99.0	98.3	99.2	99.1	98.5	0.6

Cashmere collected from different regions

The number of copies of the mitochondrion tends to vary significantly between individuals depending on the type of cell and the kind of species.⁸ Whether the amount of mitochondrion is stable in a certain species of animal hair is the key to our quantifying method. China is the largest cashmere producer, accounting for 50% of the world market.³ Scoured cashmere collected from China’s major producing areas, Xinjiang, Shanxi, Liaoning, and suburban Beijing, were employed to verify our method (Table 3). No significant difference was found. The result indicates that the method is effective in quantifying cashmere from different breeds in different regions.

Table 3.

Testing results of cashmere collected from different regions

1	2	3	4	5	6
Region	Northwest China Xinjiang autonomous region			Central China	Northeast China	Central East China
Region	Hetian	Hami	Akesu	Shanxi	Liaoning	Beijing
90% (input)	88.1	87.0	91.3	90.5	89.8	90.6

Cashmere collected from individuals of different age

Cashmere was collected from six individual goats of different ages in the suburbs of Urumqi, Xinjiang autonomous region in northwest China. The cashmere of the six individual goats was scoured independently, and average diameters were estimated by measuring 100 pieces of fiber of each sample. The testing results are shown in Table 4. No significant difference was found among the six samples, indicating that relative content of mitochondrion is stable regardless of age.

Table 4.

Testing results of cashmere collected from different individuals

1	2	3	4	5	6
Gender	male	female	male	female	female	female
Age (years)	1	2	2	3	4	6
Average diameter (µm)	14.70	14.77	13.91	14.18	13.36	14.44
SD	3.92	2.85	2.81	2.53	2.23	3.28
90% (input)	84.8	89.6	85.6	86.8	91.1	86.6

Wool collected from different countries

Wools imported from Australia, Malaysia, Argentina, New Zealand, Uruguay, and Turkey were employed to demonstrate whether the amount of mitochondrion is stable in different breeds of sheep. 90% of cashmere (the same source of standard cashmere) and 10% of wool (w/w) were processed by drilling and grinding together, and DNA was extracted to detect the content of cashmere. It was proved indirectly (Table 5) that the amount of mitochondrion is relatively stable in wool.

Table 5.

Testing results of wool imported from different countries

1	2	3	4	5	6
Country	Australia	Malaysia	Argentina	New Zealand	Uruguay	Turkey
90% (input)	88.1	87.0	91.3	90.5	89.8	90.6

Dyed samples

Cashmere and wool mixtures dyed with reactive dyes, acid dyes, and metal complex dyes (see Figure 6) were employed to confirm the method. Results are shown in Table 6. The goat and sheep PCR systems were used to measure the effective mtDNA extracted from 10 mg of dyed sample, with 10 mg of untreated sample as control. The content of cashmere determined by real-time PCR systems can be traced back to that of the original input.

Figure 6.

Appearance of dyed samples.

Table 6.

Testing results of dyed samples

Control	1	2	3	4	5
Dye	Without dyeing	Lanacron Red S-G	Irgalan Orange RL	Lanasol Blue CE	Lanacron R-Brown SR Lanacron Yellow S2G Lanacron Grey SB	Lanasol Black CE
50% (input)	50.0	46.2	54.5	48.6	44.3	48.3
Ct goat Ct sheep	21.00 23.42	23.24 25.03	21.20 23.87	23.63 25.93	22.03 24.05	25.14 27.42
Qgoat/(Qgoat + Qsheep)	0.84	0.78	0.86	0.83	0.80	0.83
90% (input)	90.0	84.1	87.4	86.5	89.0	90.6
Ct goat Ct sheep	20.53 26.30	23.12 28.17	21.98 27.46	23.42 28.78	23.00 28.71	24.23 30.24
Qgoat/(Qgoat + Qsheep)	0.98	0.97	0.98	0.98	0.98	0.98

In order to show whether it is reliable to determine the content of cashmere and sheep wool in dyed mixtures, taking as a basis a standard curve generated with unprocessed material, a relative quantification (goat DNA/(goat DNA + sheep DNA)) was performed as an example. The common detection system was employed to generate a standard curve with DNA extracted from cashmere (Figure 7). DNA was diluted 2, 4, 10, 100, or 1000 times, and the concentration was regarded as 100, 50, 25, 10, 1, and 0.1, respectively. With this standard curve, the quantity of wool DNA can be converted into equivalent cashmere DNA. Thus, goat Ct and sheep Ct can be converted to corresponding DNA quantities. Goat DNA/(goat DNA + sheep DNA) was calculated, from which we can see that for a certain mixture, goat DNA/(goat DNA + sheep DNA) was almost a constant.

Figure 7.

Standard curve generated by consensus system, with DNA extracted from cashmere.

Application example

Three commercially available woven products that claimed to have cashmere contents of 30%, 50%, and 100% were tested using our DNA analysis method. Two separate experiments for each sample were done, each with three duplicates. The three samples were also sent to Shanghai Institute of Fiber Inspection for microscopic examination, and the cashmere contents were found to be 25.2%, 49.0%, and 97.1%, respectively. It seemed that the calculated contents are quite close to the results obtained by microscopic examinations, as shown in Table 7. Additional detailed data are given in the online supplementary material.

Table 7.

Cashmere contents estimated by real-time PCR method

Sample appearance	Sample No.	Ct value		Delta Ct	Cashmere %
Sample appearance	Sample No.	goat	sheep	Delta Ct	Cashmere %
	1–1	25.01	25.11	−0.10	19.4
	1–2	25.12	25.23	−0.11	19.4
	2–1	24.26	26.36	−2.10	45.6
	2–2	24.12	26.14	−2.02	44.4
	3–1	23.48	36.14	−12.66	99.8
	3–2	23.24	36.19	−12.95	99.9

Discussion

Compared with the previous quantifying method, the current studies addressed the key question: whether mitochondrial DNA is suitable for quantification of cashmere and wool mixtures. Cashmere samples from different regions of different breeds, and from individuals of different ages, were collected to verify the method. Wools collected from six countries were also employed to verify the method. No significant difference was found in the calculated results, which proves that it is amenable to practical application. Ten independent samples of 1%, 10%, 50%, 90%, and 99% cashmere were tested. The results showed slight difference as content uniformity could not always be guaranteed during sampling; 50% cashmere samples presented the most obvious standard difference.

More demands should be met when using the TaqMan real-time PCR quantitative method. Firstly, content uniformity should be guaranteed. Secondly, the DNA quantifying method requires thorough lysis of mixed cashmere and wool, as the DNA quantity is a determinant of its accuracy. Thirdly, through lots of experiments, we found that the testing results can be trusted only for those mixed fibers dyed with the same dyes, or more exactly, experienced the processing steps. From Table. 6, we can conclude that dyeing process might destroy the chain structure of DNA, as Ct values were higher than fibers without treatment. Different dyes require different dyeing condition, which resulting varied extent of destruction of DNA. Hence, blended fibers with different colors are usually hard to quantify.

Pigments contained in natural animal fiber, and dyes absorbed by animal fibers, often act as a PCR inhibitors, which made the method invalid.⁹ According to our research, animal fiber containing pigments can be tested with the method, with the help of magnetic bead separation. The research conducted by Kerkhoff et al. demonstrated that the DNA analysis method targeting mitochondrial DNA, washing, and bleaching have little impact on its application,¹ while some dyes have negative impact on its application, especially when dyes of fibers damaged the DNA or hindered DNA extractability. According to our daily detection, some dyes will prevent the animal fiber from breaking down. With the same treatment, fibers with different dyes exert different lysis extent. So prolonging the lysis treatment appropriately might be helpful. The traditional CTAB–chloroform–isopropanol extraction method could not remove water-soluble eumelanins, which will act as inhibitor in the following real-time PCR. A further purification step is needed to make it suitable for DNA analysis.¹ One obvious advantage of CTAB–chloroform–isopropanol extraction is that larger samples (about 50 mg) can be subjected to lysis in the same microcentrifuge tube.

The lysis process could be sped up by adding DTT. Generally speaking, the CTAB–chloroform–isopropanol extraction method requires a degree of technical proficiency and relatively high standard experiment instruments, and thus its application is restricted. With the development of commercially available DNA extraction kits, most of the inhibitors can be effectively removed, which makes DNA analysis possible and simple. In terms of some fabric that experienced complex dying and finishing, in which DNA structure was destroyed, the method might not work. Cashmere and wool mixtures dyed with reactive dyes, acid dyes, and metal complex dyes, were employed to verify the method. The dyeing process was carried out by Daidoh Limited Group. Fortunately, the randomly picked dyes did not hinder our detection. Ct values collected were higher than the control sample without dyeing treatment, which indicates that dyeing might destroy the structure of DNA to various degrees. In addition, three commercial fabrics were also tested using our method. DNA of all these samples were extracted with a Promega kit, and fluorescence signals were successfully detected. The calculated results conform to microscopic examination. The DNA analysis method is reliable and objective, and the whole process can be completed in one day. Another obvious advantage is that the current method can achieve mass testing.

Conclusion

We have developed a TaqMan PCR DNA analysis method for quantifying cashmere and wool mixtures based on mitochondrion DNA. It is demonstrated that it is also an effective method for the commercially interesting inspection of wool adulteration of cashmere. Cashmere samples from different regions, and from individuals of different ages, were collected to validate the feasibility of the method. Cashmere and wool mixtures dyed with acid dyes, reactive dyes, and metal complex dyes were employed to prove that it is a suitable assay to quantify cashmere and wool. The current research dispels doubts as to whether it is reliable to quantify animal hair mixtures based on hair mitochondrion DNA, which is not limited by its morphology, is more durable, and easier to obtain. Features of the method include that facts that it is objective, fast, and can be used for mass-testing. Results indicate that the method can be readily used to examine and to authenticate cashmere products on the market.

Footnotes

Acknowledgements

The presented data are part of the project under the title “Research on qualitative and accurate quantitative analysis method of natural animal fiber based on biotechnology”. We would like to express our appreciation to Daidoh Limited Group for their generous help in dyeing of cashmere and wool samples.

Funding

This work was supported by the General Administration of Quality Supervision, Inspection, and Quarantine of the People’s Republic of China (grant number 2011IK103).

References

Kerkhoff

Cescutti

Kruse

. Development of a DNA-analytical method for the identification of animal hair fibers in textiles. Text Res J 2009; 79: 69–75.

Subramanian

Karthik

Vijayaraaghavan

. Single nucleotide polymorphism for animal fibre identification. J Biotechnol 2005; 116: 153–158.

Jin

. The breeding situation and the developing trend of Liaoning cashmere goat. Chin J Anim Sci 2005; 41(3): 54–56.

Hamlyn

Nelson

McCarthy

. Wool-fibre identification by means of novel species-specific DNA probes. J Text Inst 1992; 83(1): 97–103.

Nelson

Hamlyn

Holden

. A species-specific DNA probe for goat fiber identification. Text Res J 1992; 62: 590–595.

Wozney

Wilson

. Real-time PCR detection and quantification of elephantid DNA: species identification for highly processed samples associated with the ivory trade. Forensic Sci Int 2012; 219: 106–112.

Bai

. A method for quantifying mixed goat cashmere and sheep wool. Forensic Sci Int 2011; 208: 139–142.

Robin

Wong

. Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells. J Cell Physiol 1988; 136: 507–513.

Takayanagi

Asamura

Tsukada

. Investigation of DNA extraction from hair shafts. Int Congr Ser 2003; 1239: 759–764.