The role of insulin-like growth factor 1 and its receptor in the formation and development of colorectal carcinoma

Abstract

Objective

To investigate the role of insulin-like growth factor (IGF)-1 and its receptor (IGF1R) in the formation and development of colorectal carcinoma.

Methods

Colorectal tissue and matching serum samples were collected from patients with adenomatous polyps or carcinoma and healthy control subjects. IGF1R mRNA levels were determined via quantitative real-time reverse transcription–polymerase chain reaction. Serum IGF1 was quantified using enzyme-linked immunosorbent assay.

Results

Serum IGF1 concentrations and mucosal IGF1R mRNA levels were significantly higher in patients with adenomatous polyps (n = 24) or carcinoma (n = 13) compared with healthy control subjects (n = 13). There was a significant positive correlation between serum IGF1 and mucosal IGF1R mRNA in patients with adenomatous polyps.

Conclusions

High circulating IGF1 concentrations and mucosal IGF1R expression may play important roles in both the formation and development of colorectal carcinoma. IGF1 and its receptor may be activated before carcinogenesis, and may promote the growth and malignant transformation of adenomatous polyps. IGF1 and IGF1R may be useful biomarkers for evaluating the stage and risk of carcinogenesis.

Keywords

Insulin-like growth factor 1 insulin-like growth factor receptor colorectal polyps colorectal carcinoma quantitative real-time RT–PCR enzyme-linked immunosorbent assay

Introduction

The neoplastic initiation of colorectal cancer primarily begins with the formation of adenomatous polyps that can be detected by endoscopy.¹ The morphological transition from normal colorectal mucosa to adenomatous polyps, early cancer and eventually to advanced cancer is widely accepted as the neoplastic progression of colorectal cancer. This process is facilitated by abnormal cell proliferation, differentiation and apoptosis.^2,3 In addition, multiple growth factors are believed to be involved in neoplastic progression.^4–8 Investigating changes in growth factors and their receptors may reveal the mechanisms of neoplastic initiation and identify new molecular targets for anticancer strategies.

The insulin-like growth factor type 1 receptor (IGF1R) signalling pathway is activated by IGF1.⁹ Growth hormone stimulates the production of IGF1 as an endocrine hormone, in addition to stimulation in a paracrine/autocrine manner;^10,11 IGF1 then activates the transmembrane IGFR and its downstream signalling pathway.^12,13 The IGF1/IGF1R system is highly conserved and is crucial in cell proliferation, differentiation and tissue development.^14–17 These functions have raised interest in the role of the IGF pathway in carcinogenesis, which is closely related to abnormal cell proliferation, differentiation, apoptosis and transformation.^18,19 Studies have linked IGF1 to human tumours, including colorectal cancer.²⁰ IGF1 also has been shown to induce the transcription of vascular endothelial growth factor, resulting in colorectal cancer development, angiogenesis and metastasis.²¹ In addition, IGF1R was shown to be overexpressed in human colorectal tumours compared with normal colorectal tissue, resulting in enhanced tumour cell proliferation, malignant transformation and inhibition of apoptosis.^22,23 An overactive abnormal IGF1R β-subunit induced oncogenic transformation of IGF-1R knockout mouse fibroblasts in vitro, indicating that activated IGF1R may have an important role in the neoplastic process.^24,25

The effect of IGF1 and IGF1R on precancerous lesions (such as adenomatous polyps) has not been widely investigated: research has generally been limited to comparison with cancerous lesions. There are different pathological types of colorectal polyps, each with varying biological behaviour, morphological characteristics and malignant potential.^26–28 Adenomatous polyps, which possess a highly disordered structure and cell atypia (moderate to severe dysplasia), are more likely to develop into cancer than hyperplastic and inflammatory polyps.^29,30 Excessive cell proliferation caused by upregulation of IGF1/IGF1R greatly increases the probability of tumourigenesis,²⁴ and the IGF1 pathway may therefore have an important role, not only in malignant tumours but also in tumour initiation in precancerous lesions such as colorectal adenomatous polyps.

The aim of the present study was to determine whether serum IGF1 concentrations (quantified by enzyme linked immunosorbent assay [ELISA]) and/or IGF1R mRNA expression (quantified via quantitative real-time reverse transcription–polymerase chain reaction [RT–PCR]) in colorectal tissue are related to the occurrence of colorectal adenomatous polyps or carcinoma. We also investigated whether IGF1 and its receptor could be used as biomarkers to evaluate the risk of colorectal carcinogenesis.

Patients and methods

Study population

The study recruited patients undergoing surgical resection of colorectal adenocarcinoma or colonoscopy with polypectomy at the Sun Yat-sen University Cancer Centre, Guangzhou, China, between November 2009 and November 2010. The control group was recruited from individuals with symptoms including rectal bleeding, bloody stools, abdominal pain, constipation and diarrhoea who were attending the outpatient Clinic of Sun Yat-sen University Cancer Centre; these people subsequently had negative colonoscopy findings. Subjects with colitis, acromegaly, dwarfism, diabetes, cachexia, severe organ failure or other malignancies were excluded.

Blood (5 ml) was collected from each participant, then centrifuged at 1500 g at 15℃ for 10 min. All study participants provided colorectal tissue (adenocarcinoma, polyp or normal tissue, as applicable), which was pathologically examined and confirmed. Tissue and serum samples were stored at −80℃ until use.

The study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of Sun Yat-sen University Cancer Centre. Participants were informed of the investigational nature of the study and provided their written informed consent.

IGF1R quantitative real-time RT–PCR

Tissue samples were frozen at −80℃ in RNAlater® (Qiagen, Valencia, CA, USA) immediately after collection. For RNA extraction, 20–50 mg of tissue was ground and incubated with 1 ml cell lysis buffer (Trizol®; Gibco, Gaithersburg, MD, USA) for 5 min and total RNA was isolated using the acid-guanidinium isothiocyanate phenol chloroform extraction method.³¹ RNA concentration and purity were determined by ultraviolet spectrophotometry, and RNA was stored at −80℃ for future analysis.

Total RNA (4 µl) was incubated for 60 min at 37℃ in a 20 µl reaction volume comprising RT buffer (50 mM Tris‐HCl [pH 8.0], 50 mM potassium chloride, 4 mM magnesium chloride, 10 mM dithiothreitol), 0.25 mM dNTPs, 4 pmol random primers, and 200 U MMLV reverse transcriptase. The reaction was stopped by incubation at 95℃ for 3 min; samples were then placed on ice.

Quantitative real‐time PCR was performed with a SYBR®green‐based ABI 7500 Real‐Time PCR system (Life Technologies, Grand Island, NY, USA). Primer sequences were: IGF1R forward 5′‐GCCAAGCTAAACCGGCTAAA‐3′ and reverse 5′‐TATCCTGTTTTGGCCTGGACATA-3′; and ACTB (β-actin) forward 5′-GCATGGGTCAGAAGGATTCCT-3′ and reverse 5′-TCGTCCCAGTTGGTGACGAT-3′. PCR was carried out in a 50-µl reaction volume comprising PCR buffer (10 mM Tris-HCl [pH 8.0], 50 mM potassium chloride, 2 mM magnesium chloride), 200 µM dNTPs, 0.2 pmol/µl each primer, and 0.06 U/µl Taq DNA polymerase. The cycling programme involved preliminary denaturation at 95℃ for 3 min, followed by 36 cycles of denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s and elongation at 72℃ for 45 s, followed by a final elongation step at 72℃ for 7 min. The threshold cycle (C_T) was used to determine the concentration of the target gene, with ACTB used as an internal control, and the ratio of IGF1R to ACTB representing the transcription level of IGF1R.

IGF1 ELISA

Serum IGF1 was quantified using a human IGF1 Quantikine® ELISA kit (R&D Systems, Minneapolis, MN, USA), according to the manufacturer’s instructions. Optical density at 450 nm was determined using a microplate reader, with wavelength correction of 540 nm. All samples, standards and controls were assayed in duplicate, and IGF1 was quantified by reference to a standard curve.

Statistical analyses

Data were presented as mean ± SD. Between-group differences in age and sex were analysed using one-way analysis of variance (ANOVA) and χ²-test, and one-way ANOVA with posthoc Bonferroni t-test was used for between-group comparisons of IGF1 and IGF1R levels. Spearman’s rank correlation analysis was used to determine the relationship between IGF1R mRNA levels and IGF1 concentration in patients with adenomatous polyps. All statistical analyses were performed with SPSS® software, version 17.0 (SPSS Inc., Chicago, IL, USA), and a P-value <0.05 was considered to be statistically significant.

Results

The study collected colorectal tissue samples from 24 patients undergoing colonoscopy and polypectomy (17 males/seven females; mean age 58.0 ± 13.9; age range 17–76 years), 13 patients undergoing surgical resection of colorectal adenocarcinoma (nine males/four females; mean age 49.7 ± 19. 8; age range 35–83 years) and 13 healthy control subjects (six males/seven females; mean age 57.0 ± 13.7; age range 22–82 years). There were no statistically significant between-group differences in age or sex distribution.

Table 1 shows the tissue levels of IGF1R mRNA and serum IGF1 concentrations in the three study groups. Levels of IGF1R mRNA were significantly higher in adenomatous polyps and adenocarcinoma tissue compared with normal mucosa (P < 0.01 for both comparisons; Table 1). In addition, serum IGF1 concentrations were significantly higher in patients with adenomatous polyps or adenocarcinoma compared with healthy controls (P < 0.01 for both comparisons; Table 1). There were no significant differences between the adenomatous polyp group and adenocarcinoma group in IGF1R mRNA or IGF1 levels.

Table 1.

Serum insulin-like growth factor (IGF)-1 concentrations and IGF receptor 1 (IGF1R) mRNA levels in colorectal tissue samples from patients with colorectal adenomatous polyps or adenocarcinoma and healthy control subjects.

Parameter	Adenomatous polyp group n = 24	Adenocarcinoma group n = 13	Control group n = 13
IGF1R mRNA^a	2.63 ± 1.73**	3.23 ± 1.55**	0.43 ± 0.25
IGF1, ng/ml	200.96 ± 55.92**	218.77 ± 28.93**	98.37 ± 24.99

Data presented as mean ± SD.

Ratio of IGF1R to ACTB (β-actin) mRNA.

P < 0.01 versus control group; one-way analysis of variance with posthoc Bonferroni t-test.

Spearman’s rank correlation analysis revealed a significant correlation between serum IGF1 concentration and IGF1R mRNA tissue levels in patients with adenomatous polyps (r_s = 0.552, P < 0.01).

Discussion

Insulin-like growth factor 1 is known to be more important for the proliferation and growth of malignant cells in vitro than that of normal tissues,^32,33 and circulating IGF1 levels are known to be increased in patients with cancer.²⁰ Serum IGF1 concentrations were significantly higher in patients with colorectal adenomatous polyps or adenocarcinoma than in healthy control subjects, in the present study. This suggests that high serum IGF1 concentrations may be important not only in malignant growth but also for benign precancerous growth. Cellular mutations accumulate with age and lead to apoptosis.^34–36 IGF1 can protect malignant cells from apoptosis,²⁴ and continually high circulating IGF1 may allow malignant transformation of mutant epithelial cells.

An immunostaining study revealed that IGF1R levels were significantly higher in precancerous adenomatous polyps compared with normal mucosa, but remained low in inflammatory polyps.³⁷ These data are in accordance with the findings of the present study, where IGF1R mRNA was found at a higher level in both colorectal adenomatous polyps and adenocarcinoma compared with normal tissue. The IGF1R signalling pathway may therefore be involved in the proliferation of abnormal colorectal epithelia as early as the precancerous adenomatous polyp stage. The present finding, that IGF1R is expressed at a high level in the adenoma stage, indicates that the abnormal epithelia in adenomatous polyps may develop the capability to utilize IGF1 from the surrounding environment more efficiently than normal colorectal epithelia. Since overexpression of IGF1R is found in colorectal adenocarcinoma,^22,27 the high level of IGF1R in adenomatous polyps suggests that both benign adenoma and malignant carcinoma cells utilize the same strategy to maintain rapid proliferation. Overexpression of IGF1R may be a molecular event associated with the precancerous transition of colorectal epithelial cells.

Pretreatment of A549 nonsmall cell lung cancer and Saos-2/B-10 osteoblastic osteosarcoma cell lines with IGF1 downregulated total and membrane surface-bound IGF1R and largely reduced the acute IGF1 response of cells in vitro.³⁸ Findings of the present study suggest a different pattern for the feedback loop between IGF1R and its ligands in vivo, since high levels of both IGF1 and IGF1R were present in colorectal adenoma and carcinoma tissues. The present data suggest that both circulating IGF1 and IGF1R expression in adenoma and carcinoma tissues play important roles in the proliferation of abnormal precancerous and malignant cells. The significant correlation between serum IGF1 concentration and IGF1R mRNA levels in patients with adenomatous polyps in the present study suggests the existence of a positive feedback loop. The regulation of IGF1 and its receptor therefore requires further investigation.

An inhibitor of the tyrosine kinase activity of IGF1R, NVP-AEW541 has been shown to inhibit proliferation of colorectal carcinoma cell lines and primary cell cultures by inducing apoptosis and cell-cycle arrest, and may represent a promising anticancer treatment for colorectal carcinoma.³⁹ The present findings suggest that high circulating IGF1 concentrations and IGF1R overexpression may play important roles in the development of both adenomatous polyps and colorectal carcinoma. Inhibition of IGF1R, reducing serum IGF1 concentrations or blocking IGF1/IGF1R binding may all be potential chemopreventive measures for colorectal cancer.

Because colorectal adenomatous polyps commonly develop into colorectal cancer, screening programs that rely on colonoscopies to detect and remove polyps have been shown to be effective in reducing the morbidity and mortality of colon cancer.⁴⁰ Colonoscopies are not widely accepted, however, due to poor compliance and heightened risk of complications.⁴¹ Serum IGF1 concentrations and mucosal IGF1R mRNA levels may be useful biomarkers for evaluating the stage and risk of carcinogenesis during neoplastic initiation and colorectal cancer progression.

In conclusion, the present study found high serum IGF1 concentrations and IGF1R mRNA levels in adenomatous polyps and adenocarcinoma tissue compared with normal mucosa, suggesting that IGF1 and IGF1R are activated before carcinogenesis, and may play important roles in malignant transformation. Serum IGF1 concentrations and mucosal IGF1R mRNA levels may be useful in indicating the risk of adenomatous polyp formation or colorectal cancer progression. Further studies regarding regulation of the IGF1/IGF1R axis and IGF1R expression are required to elucidate the role of this signalling pathway in the initiation and progression of colorectal cancer.

Footnotes

Acknowledgements

We thank Dr Dong-Ping Rao (Department of Epidemiology, State Key Laboratory of Oncology in Southern China, Guangzhou, China) for assistance with statistical analyses.

Declaration of conflicting interest

The authors declare that there are no conflicts of interest.

Funding

This study was supported by Science and Technology Planning Project of Guangdong Province 2009B030801158, 2012B031800097, 2012B031800282.

References

Gupta

. Colorectal polyps: the scope and management of the problem. Am J Med Sci 2008; 336: 407–417.

Jass

Young

Leggett

. Evolution of colorectal cancer: change of pace and change of direction. J Gastroenterol Hepatol 2002; 17: 17–26.

Ahlquist

. Molecular detection of colorectal neoplasia. Gastroenterology 2010; 138: 2127–2139.

Kucera

Cerna

Narsanska

. Growth factors and breast tumors, comparison of selected growth factors with traditional tumor markers. Anticancer Res 2011; 31: 4653–4656.

McCarty

Awad

Loeb

. WT1 protein directly regulates expression of vascular endothelial growth factor and is a mediator of tumor response to hypoxia. J Biol Chem 2011; 286: 43634–43643.

Kasprzak

Adamek

. The insulin-like growth factor (IGF) signaling axis and hepatitis C virus-associated carcinogenesis (review). Int J Oncol 2012; 41: 1919–1931.

Rapisarda

Melillo

. Role of the VEGF/VEGFR axis in cancer biology and therapy. Adv Cancer Res 2012; 114: 237–267.

Ozkan

. Plasma and tissue insulin-like growth factor-I receptor (IGF-IR) as a prognostic marker for prostate cancer and anti-IGF-IR agents as novel therapeutic strategy for refractory cases: a review. Mol Cell Endocrinol 2011; 344: 1–24.

Dupont

Pierre

Froment

. The insulin-like growth factor axis in cell cycle progression. Horm Metab Res 2003; 35: 740–750.

10.

Woelfle

Billiard

Rotwein

. Acute control of insulin-like growth factor-I gene transcription by growth hormone through Stat5b. J Biol Chem 2003; 278: 22696–22702.

11.

Chesik

Glazenburg

Wilczak

. Insulin-like growth factor binding protein-1-6 expression in activated microglia. Neuroreport 2004; 15: 1033–1037.

12.

Duan

. The chemotactic and mitogenic responses of vascular smooth muscle cells to insulin-like growth factor-I require the activation of ERK1/2. Mol Cell Endocrinol 2003; 206: 75–83.

13.

Kim

van Golen

Feldman

. Insulin-like growth factor-I signaling in human neuroblastoma cells. Oncogene 2004; 23: 130–141.

14.

Ikeo

Yamauchi

Shigematsu

. Differential effects of growth hormone and insulin-like growth factor I on human endothelial cell migration. Am J Physiol Cell Physiol 2001; 280: C1255–1261.

15.

Qiang

Kopantzev

Rudikoff

. Insulinlike growth factor-I signaling in multiple myeloma: downstream elements, functional correlates, and pathway cross-talk. Blood 2002; 99: 4138–4146.

16.

Del Valle

Enam

Lassak

. Insulin-like growth factor I receptor activity in human medulloblastomas. Clin Cancer Res 2002; 8: 1822–1830.

17.

Saikali

Setya

Singh

. Role of IGF-1/IGF-1R in regulation of invasion in DU145 prostate cancer cells. Cancer Cell Int 2008; 8: 10–10.

18.

Ibrahim

Yee

. Insulin-like growth factor-I and cancer risk. Growth Horm IGF Res 2004; 14: 261–269.

19.

Hartog

Wesseling

Boezen

. The insulin-like growth factor 1 receptor in cancer: old focus, new future. Eur J Cancer 2007; 43: 1895–1904.

20.

Yakar

Zhao

. Circulating insulin-like growth factor-I levels regulate colon cancer growth and metastasis. Cancer Res 2002; 62: 1030–1035.

21.

Fukuda

Hirota

Fan

. Insulin-like growth factor 1 induces hypoxia-inducible factor 1-mediated vascular endothelial growth factor expression, which is dependent on MAP kinase and phosphatidylinositol 3-kinase signaling in colon cancer cells. J Biol Chem 2002; 277: 38205–38211.

22.

Weber

Fottner

Liu

. Overexpression of the insulin-like growth factor I receptor in human colon carcinomas. Cancer 2002; 95: 2086–2095.

23.

Ouban

Muraca

Yeatman

. Expression and distribution of insulin-like growth factor-1 receptor in human carcinomas. Hum Pathol 2003; 34: 803–808.

24.

Remacle-Bonnet

Garrouste

Heller

. Insulin-like growth factor-I protects colon cancer cells from death factor-induced apoptosis by potentiating tumor necrosis factor alpha-induced mitogen-activated protein kinase and nuclear factor kappaB signaling pathways. Cancer Res 2000; 60: 2007–2017.

25.

Natalishvili

Axelson

Girnita

. Aberrant intracellular IGF-1R beta-subunit makes receptor knockout cells (IGF1R-/-) susceptible to oncogenic transformation. Exp Cell Res 2009; 315: 1458–1467.

26.

Vrieling

Voskuil

Bosma

. Expression of insulin-like growth factor system components in colorectal tissue and its relation with serum IGF levels. Growth Horm IGF Res 2009; 19: 126–135.

27.

Hakam

Yeatman

. Expression of insulin-like growth factor-1 receptor in human colorectal cancer. Hum Pathol 1999; 30: 1128–1133.

28.

Nosho

Yamamoto

Taniguchi

. Interplay of insulin-like growth factor-II, insulin-like growth factor-I, insulin-like growth factor-I receptor, COX-2, and matrix metalloproteinase-7, play key roles in the early stage of colorectal carcinogenesis. Clin Cancer Res 2004; 10: 7950–7957.

29.

Chao

Thun

Connell

. Meat consumption and risk of colorectal cancer. JAMA 2005; 293: 172–182.

30.

Cooper

. Pathologic issues in the treatment of endoscopically removed malignant colorectal polyps. J Natl Compr Canc Netw 2007; 5: 991–996.

31.

Chomczynski

Sacchi

. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162: 156–159.

32.

Khatib

Siegfried

Prat

. Inhibition of proprotein convertases is associated with loss of growth and tumorigenicity of HT-29 human colon carcinoma cells: importance of insulin-like growth factor-1 (IGF-1) receptor processing in IGF-1-mediated functions. J Biol Chem 2001; 276: 30686–30693.

33.

Jenkins

Khalaf

Ogunkolade

. Differential expression of IGF-binding protein-3 in normal and malignant colon and its influence on apoptosis. Endocr Relat Cancer 2005; 12: 891–901.

34.

Best

. Nuclear DNA damage as a direct cause of aging. Rejuvenation Res 2009; 12: 199–208.

35.

Maslov

Vijg

. Genome instability, cancer and aging. Biochim Biophys Acta 2009; 1790: 963–969.

36.

Rupnarain

Dlamini

Naicker

. Colon cancer: genomics and apoptotic events. Biol Chem 2004; 385: 449–464.

37.

Shan

Zhang

. Expression of IGF-1R in colorectal polyps and its role in colorectal carcinogenesis. Technol Cancer Res Treat 2011; 10: 381–389.

38.

Bostedt

Schmid

Ghirlanda-Keller

. Insulin-like growth factor (IGF) I down-regulates type 1 IGF receptor (IGF 1R) and reduces the IGF I response in A549 non-small-cell lung cancer and Saos-2/B-10 osteoblastic osteosarcoma cells. Exp Cell Res 2001; 271: 368–377.

39.

Hopfner

Sutter

Huether

. Tyrosine kinase of insulin-like growth factor receptor as target for novel treatment and prevention strategies of colorectal cancer. World J Gastroenterol 2006; 12: 5635–5643.

40.

Cooper

Doug Kou

. Underuse of colorectal cancer screening in a cohort of Medicare beneficiaries. Cancer 2008; 112: 293–299.

41.

Baxter

Rabeneck

. New findings about the risks and limitations of colonoscopy used in the early detection of colorectal cancer. Healthc Q 2009; 12: 24–25.