Effects of donor age on human adipose-derived adherent stromal cells under oxidative stress conditions

Donors and adipose tissue harvesting

Human adipose tissue samples for isolation of SVFs were obtained from donors recruited at International St. Mary’s Hospital of Catholic Kwandong University. All patients provided verbal informed consent to participate. The study protocol was approved by the ethics review committee of the Institutional Review Board, College of Medicine, Catholic Kwandong University. Liposuction was performed from the abdominal wall by gentle manual techniques under general anesthesia and sterile conditions. In all cases, the fat was harvested from the abdominal wall by gentle manual techniques.

Isolation of SVFs and culture of ADASs

SVFs were isolated from human adipose tissue samples by an enzymatic digestion method using the SmartX kit (DongKoo Bio & Pharma Co., Seoul, South Korea) following the manufacturer’s instructions. Briefly, adipose tissue was centrifuged at 1,700 × g for 5 min to remove water, tumescent solution, and oil. Next, 50 ml of fat tissue was digested with 0.075% collagenase type I at 37°C for 30 min under gentle agitation. After the digested tissue was filtered through a 75-μm strainer to remove residual tissue, the cell suspension was centrifuged and washed three times with phosphate-buffered saline (PBS) (HyClone, Logan, UT, USA). Total and live cell counts were performed using the NucleoCounter® NC-200™ automated cell counter (ChemoMetec, Allerød, Denmark). The SVFs were cultured in 10% fetal bovine serum (HyClone)–supplemented Dulbecco’s Modified Eagle’s Media (HyClone) and 1% penicillin/streptomycin at a density of 5 × 10⁴ cells/cm² in a 100-mm dish in a humidified atmosphere with 5% CO₂ at 37°C. After plating on culture dishes, non-adherent cells were discarded by changing the culture medium and ADASs passaged three times.

HUVEC culture

HUVECs (Lonza, Walkersville, MD, USA) were cultured in Clonetics Endothelial Growth Basal Medium 2 (Lonza) supplemented with Clonetics Endothelial Growth Medium 2 SingleQuots (Lonza) using dishes and plates coated with 0.1% gelatin (BD, Sparks, MD, USA) in a humidified atmosphere of 5% CO₂ and 95% air at 37°C.

Cell viability assay

Cell viability was measured using Ez-Cytox (Daeillab Service, Seoul, Korea). HUVECs were seeded 24 h prior to H₂O₂ treatment at a density of 5 × 10⁴ cells/cm² onto a 96-well plate. After 24 h, H₂O₂ (0, 10, 20, 30, 40, or 50 μM) was applied to the HUVECs for 2, 4, or 6 h. After the addition of 10 μL of Ez-Cytox into each well, cell viability was evaluated by measuring the optical density at 450 nm.

Reactive oxygen species detection assay

Reactive oxygen species (ROS) production in H₂O₂-treated HUVECs was assessed according to the levels of bright green-colored 2′,7′-dichlorofluorescein (DCF) produced by the oxidation of DCF diacetate (DCF-DA) dye. The HUVECs were plated 24 h prior to H₂O₂ treatment at a density of 5 × 10⁴ cells/cm² in a 6-well plate and washed twice with PBS after 24 h. ROS generation was induced in HUVECs after 2, 4, or 6 h of treatment with 0 to 50 μM H₂O₂, followed by incubation with 50 μM DCF-DA (Sigma-Aldrich, St. Louis, MO, USA) for 30 min in the dark at 37°C. The green fluorescence was detected by flow cytometry using a BD Accuri™ C6 Cytometer (BD Biosciences, Piscataway, NJ, USA).

Co-culture of ADASs and HUVECs

HUVECs at passage 5 were plated 24 h prior to H₂O₂ treatment at a density of 5 × 10⁴ cells/cm² in a 6-well plate and then treated with or without 40 μM H₂O₂ for 4 h. After 4 h, the cells were co-cultured with individual ADASs at passage 3 using trans-well inserts with a 0.4-μm porous translucent polyethylene terephthalate membrane (Falcon; Corning Life Sciences, Pittston, PA, USA) at a cell density identical to that of the HUVECs. Following co-culture for 24 or 48 h after the incubation period, the cells in the lower well were then harvested for further analysis. The experimental groups were designed as follows: Group 1 (negative control), HUVECs (monoculture); Group 2 (H₂O₂), HUVECs (monoculture) + H₂O₂; Groups 3, 4, and 5 (40s group), HUVECs and ADASs (40s group #1, #2 or #3, co-culture) + H₂O₂; and Groups 6, 7, and 8 (60s group), HUVECs and ADASs (60s group #1, #2, or #3, co-culture) + H₂O₂.

Flow cytometry

For the flow cytometric analysis, cells were collected using Accutase Cell Detachment Solution (Thermo Fisher Scientific, Waltham, MA, USA). The cells (5 × 10⁵ cells/50 μL) were incubated for 1 h with antibodies to CD31, CD34, CD45, CD90, CD105, CD106, or isotype control (Santa Cruz Biotechnology, Santa Cruz, CA, USA) on ice and then washed three times with PBS containing 2.5% fetal bovine serum and 0.1% sodium azide (Sigma-Aldrich; washing solution). The cells were further incubated for 1 h with fluorescein isothiocyanate-conjugated anti-mouse IgG or anti-rabbit IgG (Santa Cruz Biotechnology) on ice in the dark. The cells were then washed three times and analyzed via flow cytometry using a BD Accuri™ C6 Cytometer (BD Biosciences).

Immunoblot analysis

The immunoblot analysis was performed according to the normalized methods of our previous studies. ¹⁹ Primary polyclonal antibody (Santa Cruz Biotechnology) and secondary antibodies (horseradish peroxidase-conjugated anti-goat IgG, anti-mouse IgG or anti-rabbit IgG; Santa Cruz Biotechnology) were used for detection of proteins of interest. The results were visualized using an enhanced chemiluminescence (ECL, Western Blotting Detection kit, GE Healthcare, Sweden) system, and the band intensities were quantified using ImageJ software.

RNA isolation, reverse-transcription polymerase chain reaction (PCR), and quantitative real-time PCR (qPCR)

Total RNA was isolated from HUVECs using TRIzol Reagent Solution (Life Technologies, Frederick, MD, USA) according to the manufacturer’s instructions. Oligo dT-primed cDNA was synthesized from total RNA using the Maxime RT PreMix kit (iNtRON Biotechnology, Seongnam, Korea). The level of each gene transcript was quantitatively determined by qPCR using a StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA, USA) with the SYBR Green Dye system [SYBR Premix Ex Taq (Tli RNase H Plus) and ROX reference dye (Takara Bio Inc., Foster City, CA, USA)]. The transcript level of each gene was normalized to the GAPDH transcript levels. Primers were designed using Primer3 and BLAST, and the primer set sequences are listed in Table 1.

OPEN IN VIEWER

Table 2.

Donor characteristics

Group	Number	Age (years)	Sex	Body mass index (kg/m2)	Type of treatment
40s group	#1	45	Female	30.12	Depilation
	#2	47	Male	26.86	Rejuvenation
	#3	42	Male	27.32	Rejuvenation
60s group	#1	62	Male	25.46	Rejuvenation
	#2	62	Female	24.24	Arthritis
	#3	61	Female	32.00	Arthritis
Donor for characterization	#1	55	Male	25.78	Arthritis

Network analysis

For the gene/protein network analyses, targets identified in this study were analyzed using GeneMANIA (http://www.genemania.org) and the Database for Annotation, Visualization, and Integrated Discovery (DAVID).^20,21 DAVID provides a comprehensive set of functional annotation tools to interpret the biological relevance of such a large list of genes/proteins, whereas the GeneMANIA interface generates a list of genes with functional similarity based on the available genomics and proteomics information in the database. The GeneMANIA algorithm contains two integral parts: 1) a linear regression-based algorithm for calculating a single, composite functional association network from multiple networks derived from different proteomic or genomic data sources and 2) the prediction of gene function.

Statistical analysis

All data were compared via one-way analysis of variance using the Statistical Package for the Social Sciences (SPSS, version 14.0K; SPSS Inc., Chicago, IL, USA). Data are expressed as mean ± standard error of the mean. Group means were considered significantly different at p<0.05, as determined by the protected least significant difference test when analysis of variance indicated an overall significant treatment effect (p<0.05).

Characterization of human ADASs by passage

The 7 donors in this study were divided into 3 groups: >40 years of age (40s group, n=3), >60 years of age (60s group, n=3), and the characterization sample (n=1). The basic characteristics of the donors are shown in Table 2. To investigate the donor age-associated differences in ADASs isolated from human adipose tissue, ADASs were obtained from each of 3 donors in the 40s and 60s groups, characterized from 1 donor. ADASs isolated from human adipose tissue of donors in the 40s and 60s groups were cultured until the number of cells had sufficiently increased (by passage 3) for co-culturing with HUVECs. Therefore, the surface marker expression of ADASs according to the passage number was first investigated using flow cytometry. No differences were observed in the first three passages of ADASs during characterization of ADASs in the subculture steps (Figure 1 and Table 1). Based on the results obtained during the characterization of the passages, the ADASs used in the current study expressed CD45, CD90, CD105, and CD106 but not CD31 or CD34 at passage 3 (Figure 1).

OPEN IN VIEWER

Table 1.

Sequences of primers used for quantitative real-time polymerase chain reaction

Genes		Primer sequence (5′-3′)
IL6	F	TCAATATTAGAGTCTCAACCCCCA
	R	GTTCATAGCTGGGCTCCTGG
IL8	F	CCACCGGAGCACTCCATAAG
	R	GTGAGATGGTTCCTTCCGGT
IFNG	F	TGAATGTCCAACGCAAAGCA
	R	CTGGGATGCTCTTCGACCTC
TNF	F	CACCACTTCGAAACCTGGGA
	R	TGTAGGCCCCAGTGAGTTCT
FGF1	F	GGGGTTGCTTAGAGCTGTGT
	R	GGAGCCAAGAATGTCAGCCT
FGF2	F	TCCACCTATAATTGGTCAAAGTGGT
	R	CATCAGTTACCAGCTCCCCC
VEGFA	F	CTGTCTAATGCCCTGGAGCC
	R	ACGCGAGTCTGTGTTTTTGC
PDGFA	F	GGGAACGCACCGAGGAAG
	R	GGAGGAGAAACAGGGAGTGC
PDGFB	F	GCTGAAAGGGTGGCAACTTC
	R	GGGAATGAAAAATGGGCGCT
ANG	F	TCCCGTTGAAGGGAAACTGC
	R	CCAGCACGAAGACCAACAAC
Internal control
GAPDH	F	GAAAGCCTGCCGGTGACTAA
	R	AGGAAAAGCATCACCCGGAG

OPEN IN VIEWER

Figure 1.

Surface marker expression on ADASs according to passage number as determined by flow cytometry. This figure shows the ADAS characterization results. The donor characteristics are summarized in Table 1. ADASs, adipose-derived adherent stromal cells; P, passage.

Determination of the concentration and treatment time of H₂O₂ in HUVECs

Analysis of the treatment duration and titration of H₂O₂ in HUVECs is necessary to evaluate the differential responses of HUVECs to isolated ADASs from donors of different ages under oxidative stress conditions. Accordingly, cell viability and ROS generation of HUVECs were measured using Ez-Cytox and DCF-DA with different concentrations of H₂O₂ (0–50 μM) and treatment times (0, 2, 4, or 6 h). Figure 2(a) shows the percentage of viable cells, and Figure 2(b) presents the number of ROS-generating HUVECs under oxidative stress conditions. HUVECs were most strongly affected by ROS generation when treated with 40 μM H₂O₂ for 4 h (Figure 2(b)), although the cell viability was 87% at this concentration and treatment time (Figure 2(a)). Therefore, HUVECs were treated with 40 μM of H₂O₂ for 4 h in further studies.

OPEN IN VIEWER

Figure 2.

Cell viability and reactive oxygen species generation of human umbilical vein endothelial cells for various concentrations and times of H₂O₂ treatment. (a) Cell viability and (b) Reactive oxygen species generation were measured using Ez-Cytox and 2′,7′-dichlorofluorescein diacetate, respectively. Data are representative of three independent experiments. Significant differences between the untreated (0 μM) and H₂O₂-treated (10, 20, 30, 40, or 50 μM) groups were determined via analysis of variance. *p<0.05, **p<0.01.

Differential regulation of proteins related to anti-oxidant activity, apoptosis, inflammation, adhesion, and calcium regulation in HUVECs by ADASs

HUVECs pretreated with H₂O₂ were cultivated with ADASs isolated from human adipose tissue from both donor age groups (40s and 60s groups) for 48 h. The expression levels of proteins related to anti-oxidant activity, apoptosis, inflammation, adhesion, and calcium regulation in HUVECs were compared between the 40s and 60s groups using western blot analysis. The expression of anti-oxidant proteins [peroxiredoxin (PRX) and thioredoxin (TRX)] in HUVECs was down-regulated by H₂O₂ but showed an upward trend in HUVECs co-cultured with ADASs (40s and 60s groups) (Figure 3). In contrast, the expression of HUVEC protein associated with apoptosis (p53) was increased by H₂O₂ but decreased in HUVECs co-cultured with ADASs despite variations among individuals (Figure 3). Moreover, proteins that are important for inflammation (phosphorylated p38), adhesion (intercellular adhesion molecule-1), and calcium regulation (Ca²⁺/calmodulin-dependent protein kinase II and calreticulin) exhibited a tendency to increase in H₂O₂-treated HUVECs and were more highly expressed in HUVECs co-cultured with ADASs than in H₂O₂-treated HUVECs (Figure 3). However, p38 was largely unchanged in all groups (Figure 3). Interestingly, little differences were observed in protein expression related to anti-oxidant activity, apoptosis, inflammation, adhesion, and calcium regulation between the 40s and 60s donors (Figure 3).

OPEN IN VIEWER

Figure 3.

Differential regulation of proteins related to anti-oxidant activity, apoptosis, inflammation, adhesion, and calcium regulation in human umbilical vein endothelial cells in response to adipose-derived adherent stromal cells and H₂O₂ treatment. (a) Differential regulation as determined via an immunoblot analysis. (b) Band intensity was measured as area density and analyzed by the ImageJ program. Relative intensity levels indicate protein levels normalized to β-actin levels. Data are representative of three independent experiments. Significant differences between the H₂O₂ treatment conditions in the negative control group and 40s and 60s groups were determined via analysis of variance. *p<0.05, **p<0.01.

Gene expression related to inflammation and angiogenesis in HUVECs co-cultured with ADASs

H₂O₂-treated HUVECs were co-cultured with ADASs for 24 h, and the gene expression levels of pro-inflammatory cytokines [interleukin-6 (IL6), IL8, interferon gamma (IFNG), and tumor necrosis factor (TNF)] and angiogenic factors [fibroblast growth factor-1 (FGF1), FGF2, vascular endothelial growth factor A (VEGFA), platelet-derived growth factor subunit A (PDGFA), PDGFB, and angiopoietin (ANG)] were determined by qPCR. Consequently, IL8, IFNG, and TNF, but not IL6, were remarkably increased in H₂O₂-treated HUVECs but significantly decreased in HUVECs co-cultured with ADASs (Figure 4(a)). In addition, the expression of all monitored angiogenesis-related genes (ANG, FGF1, FGF2, PDGFA, PDGFB, and VEGFA) was dramatically increased by ADASs (Figure 4(b)). Little differences were observed between the 40s and 60s donors (Figure 4).

OPEN IN VIEWER

Figure 4.

Gene expression related to (a) inflammation and (b) angiogenesis in human umbilical vein endothelial cells co-cultured with adipose-derived adherent stromal cells was determined via quantitative real-time polymerase chain reaction. Data are representative of three independent experiments. The transcript level of each gene was normalized to the GAPDH transcript levels. Significant differences between the H₂O₂ treatment conditions in the negative control group and 40s and 60s groups were determined by analysis of variance. *p<0.05, **p<0.01.

Functional classification of differentially expressed proteins/genes by various bioinformatics resources

To determine the gene interactions for proteins/genes that were differentially altered in H₂O₂-treated HUVECs, 15 proteins/genes associated with anti-oxidation, apoptosis, inflammation, angiogenic factors, or calcium regulation were analyzed using GeneMANIA to determine the interactions of these proteins/genes [Figure 5(a)]. The 14 query genes (inside circle) and their interacting genes are presented in Figure 5(a). Function-based interactions with identified partners were predicted with genes associated with positive regulation of cell motility, cell migration, and the cellular components required for movement. Furthermore, identification of enriched functional gene groups using DAVID showed that the most strongly affected functional genes in ADASs were found in the Kyoto Encyclopedia of Genes and Genomes pathway [Table 3 and Figure 5(b)]. Six of these genes (CXCL8, IFNG, PDGFA, PDGFB, TNF, and VEGFA) were localized to cytokine–cytokine receptor interaction and may play important roles in the development of new therapeutic strategies for various diseases using SVF transplantation. OPEN IN VIEWER

OPEN IN VIEWER

Table 3.

Target functional gene groups as identified by Functional Annotation Clustering

Category	Term	Count	p-value	Benjamini	FDR
KEGG_PATHWAY	Cytokine–cytokine receptor interaction	6	8.6 × 10−6	3.6 × 10−4	9.2 × 10−3
KEGG_PATHWAY	Rheumatoid arthritis	5	4.9 × 10−6	4.0 × 10−4	5.2 × 10−3
KEGG_PATHWAY	Malaria	4	3.9 × 10−5	1.1 × 10−3	4.2 × 10−2
KEGG_PATHWAY	Pathways in cancer	6	1.2 × 10−4	2.4 × 10−3	1.2 × 10−1
KEGG_PATHWAY	Melanoma	4	1.2 × 10−4	2.0 × 10−3	1.3 × 10−1
KEGG_PATHWAY	Rap1 signaling pathway	5	1.5 × 10−4	2.1 × 10−3	1.6 × 10−1
KEGG_PATHWAY	Ras signaling pathway	5	2.0 × 10−4	2.4 × 10−3	2.1 × 10−1
KEGG_PATHWAY	MAPK signaling pathway	5	3.2 × 10−4	3.3 × 10−3	3.4 × 10−1
KEGG_PATHWAY	HTLV-1 infection	5	3.2 × 10−4	3.0 × 10−3	3.5 × 10−1
KEGG_PATHWAY	Chagas disease (American trypanosomiasis)	4	3.7 × 10−4	3.1 × 10−3	3.9 × 10−1
KEGG_PATHWAY	African trypanosomiasis	3	9.7 × 10−4	7.3 × 10−3	1.0
KEGG_PATHWAY	PI3K-Akt signaling pathway	5	1.0 × 10−3	7.0 × 10−3	1.1
KEGG_PATHWAY	Influenza A	4	1.7 × 10−3	1.1 × 10−2	1.8
KEGG_PATHWAY	Regulation of actin cytoskeleton	4	2.9 × 10−3	1.7 × 10−2	3.0
KEGG_PATHWAY	Antigen processing and presentation	3	5.1 × 10−3	2.8 × 10−2	5.3
KEGG_PATHWAY	NF-kappa B signaling pathway	3	6.6 × 10−3	3.4 × 10−2	6.8
KEGG_PATHWAY	Amoebiasis	3	9.7 × 10−3	4.6 × 10−2	9.9
KEGG_PATHWAY	Natural killer cell-mediated cytotoxicity	3	1.3 × 10−2	5.7 × 10−2	13.0
KEGG_PATHWAY	Proteoglycans in cancer	3	3.2 × 10−2	1.3 × 10−1	30.0
KEGG_PATHWAY	Focal adhesion	3	3.4 × 10−2	1.3 × 10−1	31.0
KEGG_PATHWAY	Graft-versus-host disease	2	4.7 × 10−2	1.7 × 10−1	40.0
KEGG_PATHWAY	Allograft rejection	2	5.2 × 10−2	1.8 × 10−1	44.0

Benjamini, Benjamini–Hochberg critical value; FDR, false discovery rate; KEGG, Kyoto Encyclopedia of Genes and Genomes; MAPK, mitogen-activated protein kinase; HTLV-1, human T-lymphotropic virus 1; PI3K, phosphoinositide 3-kinase; Akt, protein kinase B; NF-kappa B, nuclear factor kappa B