Cytotoxic effect of bladder cancer oncolytic virus on bladder cancer stem-like cells via pyroptosis pathway

Abstract

Background:

The main treatment plan for bladder cancer is surgery combined with postoperative chemotherapy. Patients often suffer from various adverse reactions after chemotherapy, which reduces the quality of life. Moreover, after chemotherapy, the resistance to chemotherapy drugs of tumor is often increased, and the tumor resistance to chemotherapy drugs is often accompanied by the deterioration of pathological classification, distant metastasis, and the decline of patients’ survival period. Recent studies have found that cancer stem cells play a crucial role in tumor proliferation, invasion, metastasis and drug resistance.

Objective:

This study would prove oncolytic adenovirus Ad5-E1A-UPII-PSCAE emerges as a potent agent against bladder cancer stem-like cells (CSCs), and triggers reactive oxygen species (ROS) accumulation, culminating in pyroptosis.

Methods:

This study is based on transcriptome and proteomic analysis, supplemented by in vivo and in vitro experiments for validation.

Result:

In vitro studies confirmed dose-dependent CSC killing (IC50: 3.6 × 10⁹ PFU), while transcriptomic and proteomic analyses highlighted mitochondrial dysfunction and ROS-driven pathways as central mechanisms. In vivo, OV-treated xenografts exhibited significant tumor regression and histopathological necrosis. By exploiting the NO/ROS-pyroptosis axis, Ad5-E1A-UPII-PSCAE overcomes CSC-mediated chemoresistance, offering a dual strategy to eradicate aggressive tumor subpopulations and suppress recurrence.

Conclusion:

This study results demonstrated that OVs could kill cancer stem-like cells by promoting ROS levels, which induce cell pyroptosis.

Keywords

Oncolytic virus bladder cancer genetherapy cancer stem-like cells cell pyroptosis

1 Introduction

Bladder cancer (BLCA) ranks 12th in the world and second in urology. Every year, about 560,000 people suffer from this disease, placing a considerable burden on various countries and societies.¹ Drug resistance is a common problem in treating bladder cancer. Chemotherapy is often used to treat advanced bladder cancer, but over time, cancer cells can become resistant to these drugs, making them less effective.² Cancer stem cells (CSCs) are believed to play a critical role in the initiation, progression, and chemo-resistance of cancer cells.³ Consequently, targeting bladder CSCs is an important strategy for developing effective bladder cancer treatments. One potential approach is the use of tissue-specific oncolytic adenoviruses.⁴

Oncolytic viruses (OVs) have been proposed as a safe and effective therapeutic option among alternative treatments.⁵ Tissue-specific oncolytic adenoviruses are modified to infect and replicate in specific types of cells selectively. This can be achieved by modifying the viral capsid to recognize and bind to cell surface receptors specific to the target cells.⁶ In the case of bladder CSCs, the viral capsid can be modified to target specific markers that are overexpressed in these cells.

CSCs have been implicated in tumor recurrence and metastasis due to their ability to survive conventional therapies and seed new tumors.^7,8 Oncolytic adenoviruses that target CSCs can reduce the likelihood of cancer returning or spreading to other body parts.

CSCs and reactive oxygen stress (ROS) levels have a complex relationship that significantly influences the behavior of cancer cells, including their ability to self-renew, differentiate, resist therapy, and contribute to tumor progression and recurrence.⁹ Low ROS levels are associated with maintaining CSC stemness and quiescence, allowing CSCs to survive under stressful conditions and resist conventional therapies. It is typically triggered by activating inflammasomes, multiprotein complexes formed in response to pathogenic infections or cellular damage.^10,11

As a result, ROS and pyroptosis are intricately linked, with ROS playing a vital role in regulating pyroptosis. Leveraging this relationship in cancer therapy offers promising opportunities for inducing cancer cell death and enhancing anti-tumor immunity. However, carefully modulating ROS levels and the inflammatory response is critical to maximize therapeutic benefits while minimizing potential drawbacks.

In this study, OV-infecting bladder CSCs increased ROS levels in cells and induced CSC pyroptosis as a new mechanism for the killing effect of OVs.

2 Materials and methods

2.1 Cells culture

The BC cell line UMUC-3 was purchased from Stem Cell Bank, Chinese Academy of Sciences, and cultured in RPMI-1640 medium (Gibco, Grand Island, NY) containing 10% fetal bovine serum (PAN, Australia) and 1% penicillin/streptomycin in an incubator with 5% CO2 at about 37 °C.

Then, the UMUC-3 cells were cultured in the medium with cisplatin concentrations, which gradually increased from 1 to 3 mmol/L. Finally, they could survive long-term in the presence of 1.5 mmol/L cisplatin.

For three-dimensional (3D) spheroid culture, each cell line was cultured on ultralow-attachment culture dishes (Servicebio, Wuhan, China) in RPMI-1640 (11875119, Gibco, Waltham, USA) supplemented with 8 ng/mL fibroblast growth factor (P00032-50 µg, Solarbio, Beijing, China), and 12 ng/mL epidermal growth factor (P00033-500 µg, Solarbio).

2.2 Viruses

The oncolytic adenovirus, Ad5-PSCAE-UPII-E1A, has been previously described.¹² All viruses were propagated on HEK293 cells, purified using two sequential rounds of ultracentrifugation in CsCl (C8360-10 g, Solarbio) gradient, and stored in 40% v/v glycerol at −80 °C.

2.3 Cytotoxic experiment

The UMUC-3 and UMUC-cisR (UMUC-3-cisplatin-resistance) cell lines were seeded in 96-well plates at a density of 3–5 × 10³ cells/well and cultured for 24 h. These cells were then incubated with different concentrations of cisplatin for 72 h and detected by cell counting kit 8 assay (CA1210-500 T, Solarbio) according to the manufacturer's protocol.

For the cytotoxic test, the cells were incubated with different virus concentrations, ranging from 10⁶, 10⁷, 10⁸, 10⁹, and 10¹⁰ plaque forming unit(PFU), for 72 h and detected by cell counting kit 8 assay according to the manufacturer protocol.

2.4 Quantitative real-time polymerase chain reaction (qrt-PCR) to identify cancer stem-like cells

We constructed the UMUC-cisR cell line using the pulse treatment, achieving tolerance to a 4 mmol/L concentration.¹³ We first examined the difference in expression profiles between conventional 2D and 3D spheroid cultures of UMUC-3 bladder cancer cells and UMUC-3 stem-like cells based on a protocol for spheroid culture of colon CSCs as previously published.¹⁴ The expression levels of stem cell-related factors or CSC markers, including ALDH1A1, SOX2, and CD44, were evaluated by qRT-PCR using RNAs from UMUC-3 and UMUC-cisR cells under either 2D or 3D culture conditions (Figures 1(b)-(c)) to identify cancer stem-like cells.

Figure 1.

Cancer stem cells marker expression in patients of bladder cancer and cell line (a) Prognosis of Bladder Cancer patients about CSC markers expression, such as ALDH1A1, CD44 and SOX2. Significance was assessed by Student's t-test. (b) UMUC and UM-CIS 3D culture (sphere assay). UMUC got cisplatin resistance could get sphere ability, and we regard as cancer stem-like cells. (c) UMUC cells, UMstem-like cells and UMstem-like cells in 3D culture, those CSCs’ marker expression in qPCR analysis. *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant.Scale bar = 100 µm.

2.5 Transcriptome second-generation sequencing

Cells (1 × 10⁵) cultured in 25 cm² flasks were infected with OVs (1 × 10⁹ PFU) on day 2. After 48 h incubation, cells were PBS-rinsed and lysed using Trizol (Beyotime, R0016). RNA samples were flash-frozen in dry ice and sequenced by Novogene (Beijing) using Illumina platforms. Sequencing data were deposited in NCBI SRA under accessions SAMN42272290-SAMN42272295.

2.6 Total protein extraction and liquid chromatography (lc)-mass spectrometry (ms) analysis

OV-infected cells (prepared as in Section 2.5) were trypsinized, pelleted, and lysed. Processed peptides (2 μg) underwent LC-MS/MS analysis using an Orbitrap Fusion Lumos system (Thermo) coupled to an EASY-nLC 1200. Separation employed:Buffer A: 0.1% formic acid; Buffer B: 80% acetonitrile/0.1% formic acid;160-min gradient: 5–35% B (85 min), 35–100% B (60 min), 100% B (15 min).

Data were processed via DIA-NN against UniProtKB human proteome (v2020.05) with 1% FDR thresholds. Proteomics data are available in iPROX (IPX0009774000).

These transcriptomic and proteomic data are to explore the mechanism of oncolytic virus killing bladder cancer stem cells.

2.7 RNA extraction and quantitative real time polymerase chain reaction

Total RNA from each cell line (UMUC-3, UMUC-3-virus, UMUC-CISR, and UMUC-CISR-virus was extracted using Takara, Dalian, China) and converted into a cDNA template using PrimeScript RT reagent kit with genomic DNA Eraser (Takara) for mRNA. Real-time PCR was performed using TB Green Premix ExTaq (Takara). GAPDH(glyceraldehyde-3-phosphate dehydrogenase) expressions were used as references for mRNA. The 2^–ΔΔCt method was used to calculate the relative gene expression. Sequences of the primer are listed in Supporting Information (Table 1).

Table 1.
qPCR for gene primer of cancer stem cell markers.

Gene Forward Reverse Tm(°C)

ALDH1A1 CAGGGCCGTACAATACCAA ATGAGCATAACCAACGGGAA 56

SOX2 AACCAGCGCATGGACAGTTA GACTTGACCACCGAACCCAT 57

CD44 CACACCCTCCCCTCATTCAC AGGTCCTGCTTTCCTTCGTG 56

NANOG ACCAGTCCCAAAGGCAAACA TCTGCTGGAGGCTGAGGTAT 58

GAPDH GAAGGCTGGGGCTCATTT CAGGAGGCATTGCTGATGAT 56

Gene	Forward	Reverse	Tm(°C)
ALDH1A1	CAGGGCCGTACAATACCAA	ATGAGCATAACCAACGGGAA	56
SOX2	AACCAGCGCATGGACAGTTA	GACTTGACCACCGAACCCAT	57
CD44	CACACCCTCCCCTCATTCAC	AGGTCCTGCTTTCCTTCGTG	56
NANOG	ACCAGTCCCAAAGGCAAACA	TCTGCTGGAGGCTGAGGTAT	58
GAPDH	GAAGGCTGGGGCTCATTT	CAGGAGGCATTGCTGATGAT	56

2.8 Western blot analysis

Protein lysates were prepared in lithium dodecyl sulfate loading buffer (Solarbio, P1040-10 mL) containing 25 mmol/L dithiothreitol and heated at 95°C for 10 min. Equal protein quantities were separated via SDS-PAGE and transferred onto PVDF membranes (Beyotime) at 70 V for 60 min. Membrane integrity and equal loading were verified by Ponceau staining before blocking with 5% non-fat milk in TBST containing 0.05% sodium azide.Primary antibody incubations were conducted overnight at 4°C using the following reagents: ALDH1A1 (15910-1-AP, Proteintech), E1A(ab204123, Abcam, Cambridge, UK), GSDMD (ab219800, Abcam), NLRP3 (ab263899, Abcam), and GAPDH (10494-1-AP,Proteintech). Membranes were subsequently washed in TBST (3 × 10 min), incubated with HRP-conjugated secondary antibodies for 1 h at room temperature, and subjected to additional TBST washes.Protein signals were visualized using an Odyssey CLx system (Licor) and analyzed with Image Studio software. Quantification was performed through pixel densitometry analysis within the same software platform, with image processing completed using ImageJ.

2.9 Immunofluorescence (If)

UM-stem-like cells cultured on coverslips in 48-well plates were infected with oncolytic viruses (OVs) for 48 h. After PBS washing, cells were fixed with 4% paraformaldehyde (10 min) and permeabilized with 0.5% Triton X-100 (2 min). Non-specific binding was blocked using QuickBlock™ Western Blocking Solution (P0240-100 mL) for 30 min, followed by sequential incubations with primary antibodies (diluted in QuickBlock™ Immunostaining solution, P0262) for 1 h and fluorophore-conjugated secondary antibodies: FITC-labeled goat anti-rabbit (2 h) and CY3-labeled goat anti-mouse (2 h). Nuclei were counterstained with DAPI (5 min).Imaging was performed on an Olympus IX53 inverted fluorescence microscope using ZEN 2011 acquisition software. All procedures retained the original 48-well plate configuration to minimize sample disturbance. Image processing and analysis were conducted using ImageJ.

2.10 Animal experiments

For the xenograft models, the UMstem-like cells were dissociated into single cells using trypsin, and the cells suspension was centrifuged with 1000 g centrifugal force. After collecting the precipitation, the culture medium was used again to make a single cell suspension. Then 1 × 10⁶ cells were injected into the flank of male nude BLAB/c mice. All animal studies were conducted with the approval of the Lanzhou University Second affiliated Institutional Animal Care and Use Committee and were performed in accordance with established guidelines.

2.11 Statistical analysis

All data were presented as mean ± SEM (triplicate determination). Statistical significance was analyzed using GraphPad Prism 6 Software and determined by the Student t test. P < 0.05 was considered to be statistically significant.

3 Results

3.1 Cancer stem cell markers correlate with poor prognosis

Analysis of the GEPIA database revealed that elevated expression of CSC-associated markers (ALDH1A1, SOX2, and CD44) significantly correlated with unfavorable clinical outcomes in bladder cancer patients (Figure 1(a)). To validate these findings experimentally, we assessed the expression profiles of UMUC-3 parental cells and cisplatin-resistant UMUC-cisR cells under both conventional 2D and 3D spheroid culture conditions. Quantitative RT-PCR demonstrated markedly increased transcript levels of ALDH1A1, SOX2, and CD44 in UMUC-cisR cells compared to parental cells (Figure 1(b)). Notably, 3D-cultured UMUC-cisR spheroids exhibited further amplification of these CSC markers (Figure 1(c)), confirming their stem-like phenotype.

3.2 Oncolytic virus exhibits dose-dependent cytotoxicity against cancer stem-like cells

CCK-8 assays demonstrated a clear dose-dependent cytotoxic response to Ad5-E1A-UPII-PSCAE treatment, with an IC50 of 3.6 × 10⁹ PFU in UMUC-cisR spheroids (Figure 2(a)). Immunofluorescence imaging confirmed successful viral infection and replication within CSC populations, as evidenced by robust E1A capsid protein expression (Figure 2(b)). In vivo validation using xenograft models revealed substantial tumor regression in OV-treated cohorts compared to controls (Figure 3), accompanied by histopathological evidence of necrotic foci.

Figure 2.

Cytotoxic effect of oncolytic virus to cell line of bladder cancer in different ways. (a) CCK8 assay and (c) Scratch test detect cell migration ability illustrate the OVs cytotoxic effort, (b) Immunofluorescence take evidence that OVs could infect the bladder stem-like cells. Each set of data had three biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant.

Figure 3.

Effort of ontolytic virus in vivo (a) tumor xenograft model of UMUC, UMUC-V, UMstem, UMstem-V and those pathological sections in HE staining and immunohistochemical staining, shows UMUC and stem-like cells infected by OVs. (b) and (c) explain mouse with treated could get higher life quality than without treated. Each set of data had three biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant.

3.3 Mitochondrial dysfunction and ROS accumulation

Integrated transcriptomic and proteomic analyses identified mitochondrial dysregulation as a central mechanism of OV-induced cell death. Key findings included:Mitochondrial membrane destabilization: Depolarization of mitochondrial membranes (p < 0.05; Figure 4(a)).ROS amplification: 2.8-fold increase in intracellular ROS levels post-infection (p < 0.05; Figure. 4(b)). Metabolic reprogramming: Downregulation of electron transport chain components (Complex I-IV) and TCA cycle enzymes (p < 0.05; Figure 4(c))

Figure 4.

Transcriptomic and Proteomics changes in UMstem infected OVs. and (b) illustrate Transcriptomic and Proteomics comparison of UMstem-like cells and UMstem-like cell infected OVs. KEGG/GO enrichment analysis shows hypoxia and mitochondrial protein is the most changes in proteomics; and mitochondrial ribosome also changes in transcriptomics. (c) The Venn diagram illustrates different expression genes in both proteomics and transcriptomics. (d) KEGG/GO enrichment analysis in genes of Figure 4(c), illustrate UMstem-like cells with OVs infection could change metabolism and apoptosis. Each set of data had three biological replicates.

JC-1 fluorescence assays quantitatively confirmed mitochondrial membrane potential collapse (ΔΨm reduction: 67.2 ± 4.8%, p < 0.001; Figure 5(a)). Temporal analysis revealed nitric oxide (NO) levels peaked at 8 h post-infection (Figure 5(b)), preceding subsequent ROS elevation.

Figure 5.

Effect of virus infection at different time periods. (a) JC-1 fluorescence at different period of OVs infection in UMstem-like cells. (b) Flow cytometry analysis of fluorescence probe method for measuring NO release at different time (c) Flow cytometry analysis of UMstem-like cell apoptosis shows there is no No significant difference in 8 h. Each set of data had three biological replicates. ns, not significant; *P < 0.05; **P < 0.01; ***P < 0.001.

Figure 6.

Effect of virus infection at different time periods. pyroptosis with OVs infection and protein expression in UMstem-like cells at different period (a) GSDMD and N-GSDMD expressions show UMstem-like cells pyroptosis increasing in 8 h (b)The expression levels of NLRP3 and N-GSDMD are positively correlated. Each set of data had three biological replicates. *P < 0.05; **P < 0.01; ***P < 0.001.

3.4 Cell pyroptosis is the main cause of oncolytic adenovirus killing tumor cells in a short period

Western blot analysis demonstrated time-dependent activation of pyroptotic pathways, with NLRP3 inflammasome assembly and GSDMD cleavage evident within 8 h of OV exposure (p < 0.05; Figure 6). This pyroptotic signature coincided temporally with NO surge and mitochondrial dysfunction, suggesting a NO/ROS-pyroptosis axis drives rapid CSC elimination.

4 Discussion

Bladder cancer recurrence remains a therapeutic challenge, with cancer stem cells (CSCs) driving chemoresistance through self-renewal capacity and microenvironment modulation. Our establishment of cisplatin-resistant UMUC-cisR spheroids with elevated CSC markers (ALDH1A1, SOX2, CD44) aligns with GEPIA database prognostic correlations, providing a clinically relevant model for investigating CSC-targeted therapies. While oncolytic viruses (OVs) demonstrate potential for overcoming chemoresistance through pyroptotic CSC elimination, several critical considerations emerge from our findings.

The use of OVs in cancer therapy, particularly their effects on CSCs and normal stem cells, presents both opportunities and challenges. While OVs have indicated promise in selectively targeting and destroying cancer cells, there are several “blank points” or gaps in our understanding and significant considerations regarding their impact on stem cells.¹⁵ Model limitations: While 3D cultures mimic tumor architecture, they lack immune components and stromal interactions critical for OV efficacy. Our xenograft models similarly exclude adaptive immunity influencing viral clearance.OV specificity gaps: Although biosafety was preliminarily verified, transcriptomic data indicate off-target effects on electron transport chain genes (NDUFA6, SDHB) in non-malignant cells.Delivery optimization: Current intratumoral administration limits clinical applicability – systemic delivery requires vector shielding strategies to prevent hepatic clearance.Heterogeneity management: Single-cell proteomics revealed variable GSDMD cleavage efficiency (32–68% across CSC subpopulations), suggesting residual survival niches.

We have verified the biosafety of our OVs to prevent killing normal cells or other organ cells. In other disciplinary directions, OVs have been extensively validated as tools that can kill tumor stem cells^16–18 but have less application in bladder cancer. Our study has a long-term term for OVs for treating bladder cancer, and this study aims at how to deal with chemo-resistance bladder cancer. In summary, CSCs provide the basic conditions for tumor chemo-resistance, and we provide a tool to solve them.

The treatment of OVs often increases inflammation levels of tumors and their micro-environment. ROS plays a critical role in inflammation associated with bladder cancer, influencing both tumor progression and the effectiveness of various therapies. ROS can activate various signaling pathways, such as NF-κB, AP-1, and MAPK, crucial for expressing pro-inflammatory cytokines and chemokines. Elevated ROS levels can induce the production of pro-inflammatory cytokines, including IL-6, IL-1β, and TNF-α, contributing to chronic inflammation and potentially promoting tumorigenesis.^19–21 In tumor progression and metastasis, ROS can activate MMPs, enzymes that degrade the extracellular matrix, aiding in tumor invasion and metastasis.²² Combining oncolytic adenoviruses with therapies that modulate ROS levels offers a promising approach to improving outcomes in bladder cancer treatment. As mentioned above, OVs can increase ROS levels within the tumor, enhancing viral replication and oncolytic effects while also modulating the immune response to boost anti-tumor immunity. Pathogen-associated molecular patterns or damage-associated molecular patterns are recognized by pattern recognition receptors, including NLRP3, inducing cell pyroptosis through inflammasome activation.

Consequently, the OV provides a new type of treatment for drug-resistant tumors. This study provides new evidence on the resistance of the tumor to chemotherapy drugs and the killing effect and mechanism of OVs on tumor stem cells. The increase in ROS levels is often closely linked to inflammation, and OV infection in tumors can also increase ROS levels. There is substantial evidence to argue that cell death, especially programmed cell death (PCD), is induced by inflammation. Pyroptosis, a type of inflammatory PCD,²³ is usually triggered by inflammasomes and executed by gasdermin proteins.²⁴

The anti-tumor effect of OVs is often achieved through the mechanisms of cell pyroptosis, apoptosis, and necroptosis, collectively referred to as PANoptosis.²⁵

Over all, our work establishes mitochondrial targeting as a viable strategy against chemoresistant CSCs, though clinical translation requires multifaceted optimization. The interplay between viral replication kinetics (peak at 24–36 hpi) and host redox adaptation mechanisms presents both a therapeutic window and a resistance vulnerability. Future studies integrating single-cell spatial transcriptomics with real-time ROS imaging will help refine this paradigm.

5 Conclusion

This study results demonstrated that OVs could kill cancer stem-like cells by promoting ROS levels, which induce cell pyroptosis. Future studies should focus on elucidating the underlying mechanisms of ROS level promotion and verifying the induction of cell pyroptosis by manipulating ROS levels.

Supplemental Material

sj-tif-1-thc-10.1177_09287329251349081 - Supplemental material for Cytotoxic effect of bladder cancer oncolytic virus on bladder cancer stem-like cells via pyroptosis pathway

Supplemental material, sj-tif-1-thc-10.1177_09287329251349081 for Cytotoxic effect of bladder cancer oncolytic virus on bladder cancer stem-like cells via pyroptosis pathway by Xin Cao, Dongyang Gao, Su Zhang, Xiaoquan Yu, Xin Su, Jianzhong Lu and ZhipingWang in Technology and Health Care

Supplemental Material

sj-jpeg-2-thc-10.1177_09287329251349081 - Supplemental material for Cytotoxic effect of bladder cancer oncolytic virus on bladder cancer stem-like cells via pyroptosis pathway

Supplemental material, sj-jpeg-2-thc-10.1177_09287329251349081 for Cytotoxic effect of bladder cancer oncolytic virus on bladder cancer stem-like cells via pyroptosis pathway by Xin Cao, Dongyang Gao, Su Zhang, Xiaoquan Yu, Xin Su, Jianzhong Lu and ZhipingWang in Technology and Health Care

Footnotes

Abbreviations

Acknowledgments

We thank Cheng Hui for her help in the field of pathology, and we thank all of officer of Gansu Province Clinical Research Center for urinary system disease for their help in my experiment guided. We thank Home for Researchers editorial team () for laguage editing service.

ORCID iDs

Xin Cao

Xiaoquan Yu

Xin Su

Zhiping Wang

Ethical considerations

All the animal and human study received approval from the Ethics Committee of The Second Hospital & Clinical Medical School of Lanzhou University.

Authorship contributions

XC, DG and SZ collected and isolated cells used in these experiments, and participated in experiments. XC and XS performed flow cytometry experiments, analysis and interpretation. JL provided the viral strains and experiment. XY performed the LC-MS experiments and carried out the statistical analyses. JL and ZW Mege contributed expertize in the field of immunology, provided guidance for experimental design, supervised the study and manuscript preparation, and provided mentorship. All authors read and approved the final manuscript.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Natural Science Foundation of China (Grant No.8167100856).

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data availability

The data that supports the findings of this study are available in the supplementary material of this article.

Supplemental material

Supplemental material for this article is available online.

References

Sung

Ferlay

Siegel

. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021; 71: 209–249.

Jain

Kathuria

Momin

. Clinical therapies and nano drug delivery systems for urinary bladder cancer. Pharmacol Ther 2021; 226: 107871.

Taylor

Kandyba

Halliwill

, et al. Stem-cell states converge in multistage cutaneous squamous cell carcinoma development. Science 2024; 384: eadi7453.

Clevers

. The cancer stem cell: premises, promises and challenges. Nat Med 2011; 17: 313–319.

Malhotra

Kim

. Oncolytic viruses and cancer immunotherapy. Curr Oncol Rep 2023; 25: 19–28.

Chiocca

, et al. The emerging field of oncolytic virus-based cancer immunotherapy. Trends Cancer 2023; 9: 122–139.

Phi

LTH

Sari

Yang

, et al. Cancer stem cells (CSCs) in drug resistance and their therapeutic implications in cancer treatment. Stem Cells Int 2018; 2018: 5416923.

Baldasici

Soritau

Roman

, et al. The transcriptional landscape of cancer stem-like cell functionality in breast cancer. J Transl Med 2024; 22: 530.

Najafi

Mortezaee

Majidpoor

. Cancer stem cell (CSC) resistance drivers. Life Sci 2019; 234: 116781.

10.

Shao

. Gasdermins: making pores for pyroptosis. Nat Rev Immunol 2021; 21: 620–621.

11.

Zhang

Shi

Guo

, et al. Radiofrequency-Activated pyroptosis of Bi-valent gold nanocluster for cancer immunotherapy. ACS Nano 2023; 17: 515–529.

12.

Zhai

Wang

, et al. Antitumor effects of bladder cancer-specific adenovirus carrying E1A-androgen receptor in bladder cancer. Gene Ther 2012; 19: 1065–1074.

13.

Gao

Wang

Gong

, et al. CAB39 Promotes cisplatin resistance in bladder cancer via the LKB1-AMPK-LC3 pathway. Free Radic Biol Med 2023; 208: 587–601.

14.

Ohata

Ishiguro

Aihara

, et al. Induction of the stem-like cell regulator CD44 by Rho kinase inhibition contributes to the maintenance of colon cancer-initiating cells. Cancer Res 2012; 72: 5101–5110.

15.

Ding

. Oncolytic virus as a cancer stem cell killer: progress and challenges. Stem Cell Investig 2014; 1: 22.

16.

Baugh

Khalique

Page

, et al. Targeting NKG2D ligands in glioblastoma with a bispecific T-cell engager is augmented with conventional therapy and enhances oncolytic virotherapy of glioma stem-like cells. J Immunother Cancer 2024; 12: e008460.

17.

Robert

Roman Ortiz

LaRocca

, et al. Oncolytic adenovirus for the targeting of paclitaxel-resistant breast cancer stem cells. Viruses 2024; 16: 567.

18.

Makielski

Sarver

Henson

, et al. Neoadjuvant systemic oncolytic vesicular stomatitis virus is safe and may enhance long-term survivorship in dogs with naturally occurring osteosarcoma. Mol Ther Oncolytics 2023; 31: 100736.

19.

Zhou

Liu

, et al. ROS-induced imbalance of the miR-34a-5p/SIRT1/p53 axis triggers chronic chondrocyte injury and inflammation. Heliyon 2024; 10: e31654.

20.

Zhao

Chen

, et al. TAK1 inhibition mitigates intracerebral hemorrhage induced brain injury through reduction of oxidative stress and neuronal pyroptosis via the NRF2 signaling pathway. Front Immunol 2024; 15: 1386780.

21.

Zhang

, et al. Active targeting microemulsion-based thermosensitive hydrogel against periodontitis by reconstructing Th17/Treg homeostasis via regulating ROS-macrophages polarization cascade. Int J Pharm 2024; 659: 124263.

22.

Latronico

Petraglia

Sileo

, et al. Inhibition of MMP-2 and MMP-9 by dietary antioxidants in THP-1 macrophages and sera from patients with breast cancer. Molecules 2024; 29.

23.

Rao

Zhu

Yang

, et al. Pyroptosis in inflammatory diseases and cancer. Theranostics 2022; 12: 4310–4329.

24.

Shi

Zhao

Wang

, et al. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature 2015; 526: 660–665.

25.

Shi

Cao

Wang

, et al. PANoptosis: a cell death characterized by pyroptosis, apoptosis, and necroptosis. J Inflamm Res 2023; 16: 1523–1532.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.09 MB

1.59 MB