Urethral inflammatory response to ureaplasma is significantly lower than to Mycoplasma genitalium and Chlamydia trachomatis

Abstract

A non-syndromic approach to treatment of people with non-gonococcal urethritis (NGU) requires identification of pathogens and understanding of the role of those pathogens in causing disease. The most commonly detected and isolated micro-organisms in the male urethral tract are bacteria belonging to the family of Mycoplasmataceae, in particular Ureaplasma urealyticum and Ureaplasma parvum. To better understand the role of these Ureaplasma species in NGU, we have performed a prospective analysis of male patients voluntarily attending a drop in STI clinic in Oslo. Of 362 male patients who were tested for NGU using microscopy of urethral smears, we found the following sexually transmissible micro-organisms: 16% Chlamydia trachomatis, 5% Mycoplasma genitalium, 14% U. urealyticum, 14% U. parvum and 5% Mycoplasma hominis. We found a high concordance in detecting in turn U. urealyticum and U. parvum using 16s rRNA gene and ureD gene as targets for nucleic acid amplification testing (NAAT). Whilst there was a strong association between microscopic signs of NGU and C. trachomatis infection, association of M. genitalium and U. urealyticum infections in turn were found only in patients with severe NGU (>30 polymorphonuclear leucocytes, PMNL/high powered fields, HPF). U. parvum was found to colonise a high percentage of patients with no or mild signs of NGU (0–9 PMNL/HPF). We conclude that urethral inflammatory response to ureaplasmas is less severe than to C. trachomatis and M. genitalium in most patients and that testing and treatment of ureaplasma-positive patients should only be considered when other STIs have been ruled out.

Keywords

urethritis polymorphonuclear cells urethral smears

Introduction

Inflammation of the urethra in men, termed urethritis, is the most common reason for men attending clinics for sexually transmitted infections (STI) or sexual health clinics. Whilst there has been a tradition of treating male urethritis with antibiotics empirically, national and international guidelines have been developed to find the cause of urethritis prior to treatment, in order to reduce selection of resistant strains and to prevent horizontal spread of antibiotic resistance from non-pathogenic to pathogenic species.

In the Organisation for Economic Co-operation and Development (OECD) countries, the most common identified cause of urethritis is Chlamydia trachomatis followed by Neisseria gonorrhoeae and together they can account for up to 40% of urethritis cases. In countries that perform routine tests for more sexually transmissible micro-organisms, Mycoplasma genitalium infection can account for up to 35% of non-chlamydial non-gonococcal urethritis (NCNGU) cases.¹ Essentially, even in best resourced clinics, over 50% of urethritis cases are treated empirically.

The most common cultivable micro-organisms that colonise the genitourinary tract are the ureaplasmas. Originally termed T-strain mycoplasmas, Ureaplasma species are considered a part of normal genital flora as they are found in 40–80% of most populations studied.^2–4 Nevertheless, several studies have indicated that ureaplasmas could be a cause of NGNCU in men.^5–9

Phylogenetic-based classification of the 14 known Ureaplasma serotypes into biovar 1, which includes Ureaplasma parvum, and biovar 2, which includes Ureaplasma urealyticum,¹⁰ led to an upsurge of interest in finding the pathogenic role of Ureaplasma species in genitourinary tract of men and women,^4,11,12 Results from a meta analysis of seven studies show that U. urealyticum but not U. parvum is associated with NGNCU.¹³ However, comparative whole genome analysis of clinical and cultured strains shows the presence of hybrid genomes with extensive DNA transfer between biovars and that virulence factors are likely to be more important than antigenicity in determining pathogenicity.¹⁴

Ureaplasmas are unique in human Mollicute species because of their ability to metabolise urea and not arginine or glucose. The essential urease activity-associated genes¹⁵ have therefore become a target for rapid identification and differentiation of Ureaplasma species by nucleic acid amplification testing.^16–19 Recently, Cox et al.²⁰ report specific primers and probes for the UreD gene for differential detection of U. urealyticum and U. parvum by NAAT . Using the UreD assay, they report detecting higher prevalence of U. parvum in microcopy-confirmed NGNCU cases.²⁰

We have previously developed Taqman™ primers and probes to 16s rDNA sequences of U. urealyticum and U. parvum based on sequencing of clinical strains. In this article, we report a high concordance when detecting U. urealyticum and U. parvum using NAAT for ureD gene and 16s rDNA gene. We use a set of prospectively collected genitourinary samples that have been microscopically examined for severity of urethritis, to determine the pathogenic consequence of Ureaplasma species infection of male genitourinary tract.

Method

Study population

The design was a cross-sectional study investigating NGU as the outcome in symptomatic and asymptomatic heterosexual men with and without sexually transmitted bacterial infections. The protocol was approved by the regional committee for Medical Research Ethics, reference 2010/2229.²¹

Male patients voluntarily attending the largest STI drop in clinic in Oslo (www.olafia.no) between October 2010 and April 2011 were given the study protocol and asked to take part in the study and to sign a consent form.

All included patients, regardless of symptoms, were examined by the physician in charge and a urethral smear was taken. A blunt metal spatula was gently inserted 0.5–1 cm into the urethra, the fluid obtained was evenly smeared on a glass slide and stained with methylene-blue and immediately examined by the physician in charge. The average results of polymorphonuclear leucocytes (PMNL) count by microscopy in at least five high powered fields (HPF) were recorded and categorised as follows: 0–4, normal; 5–9 PMNL/HPF, mild urethritis; 10–30 PMNL/HPF, moderate urethritis; and >30 PMNL/HPF, severe urethritis. Patients were categorised as symptomatic if they reported urethral discharge, itching/sting or dysuria. If NGU was diagnosed, the patient was treated with antibiotics according to the national guidelines.²² The microscopy of smears was further standardised by blinding the smears and having one senior experienced clinician (HM) score all the samples for average PMNL/HPF again. In cases of one-step discrepancy with original findings, for example 0–4 primary microscopy reading and 5–9 secondary microscopy reading, the second microscopy reading was used and in cases of two-step discrepancy, the result in between was used.

As part of routine practice, first void urine (FVU) was sent to the service laboratory (www.furst.no) for NAAT for C. trachomatis and M. genitalium as described²³ and the results of the tests were immediately reported to the STI clinic. The samples were not tested for N. gonorrhoeae because of the low prevalence in this population, unless intracellular diplococci were observed during microscopy, in which case the patients were excluded. Patients were also excluded from the study if they had reported using antibiotics for the last four weeks, if they had recurrent urethritis, if they had reported having sex with men, and those below 16 years of age (n = 49).

Urine samples from the study subjects were frozen in aliquots in deep well 96 well plates. After completion of collection of all study subjects, DNA was extracted from urine using Magna Pure LC Total Nucleic Acid Isolation Kit-High Performance (Roche, Indianapolis, IN, USA) on the Magna Pure LC platform. NAAT for Trichomonas vaginalis and M. hominis was peformed using TaqMan™ protocol described in Schirm et al.²⁴ An in-house real-time PCR assay, consisting of a forward primer (GGGAGGCAGCAGTAGGGAATAT), a reverse primer (ACAAGGTACCGTCAGTCTGCAAT) and a black hole quencher-1 TaqMan™ probe (6FAM-TTTCCTATTGCAAATGTTCTTCCCTTATAACAGCACTT), was developed to 16s rDNA sequences for M. hominis using alignment of sequences from clinical samples (Moghaddam A., unpublished data) as well as publically available sequences. NAAT for ureaplasmas was performed using oligonucleotides and TaqMan™ probes described below. Identical TaqMan™ amplification and detection conditions were used for M. genitalium, ureaplasmas, T. vaginalis and M. hominis using a 7900 or 7500 Appliedbiosystems Real Time PCR System (Applied Biosystems, Foster City, California, USA) along with volumes and internal controls as described in Reinton et al.²⁵

NAAT for U. urealyticum and U. parvum 16s rDNA gene

Oligonucleotide primers and TaqMan™ probes for detection of U. urealyticum and U. parvum were designed by adapting the assay published by Yoshida et al.²⁶ We used the amplification primers published by Yoshida et al.²⁶ to amplify 16s rRNA sequences of Ureaplasma and Mycoplasma from urine samples of patients with urethritis from our earlier study.²⁷ The amplicons were sequenced to ensure conservation of sequences that can be used to differentiate U. urealyticum from U. parvum. Oligonucleotide forward (CACACCGTAAAGATCATCATTAAAT) and reverse (CAATTCCGTTTGAGTTTCATTCTTG) primers were then designed for specific amplification of Ureaplasma genus and TaqMan™ Minor Grove binder (MGB) probes were designed for duplex detection of U. urealyticum (6FAM-CCGACTCGTTCGAGC) and U. parvum (VIC-CGACCCATTCAGGCC). The primers and probes were further validated for specificity by comparison with a urease gene assay described in Jensen et al.²⁸ (data not shown). Further validation of the 16s rDNA NAAT assay for Ureaplasma species is described in this article.

Statistics

The statistics package for social sciences (SPSS, version 22, IBM Corp, NK, USA), was used to assess characteristics of study participants, prevalence of microorganisms and clinical measurements. Odds ratio (OR) with 95% confidence intervals (CI) were used for measurement of association using Chi square analysis.

Results

In this cohort of 362 prospectively analysed male patients with a median age of 29 (range 16–66) attending a drop in STI clinic, we found a prevalence of 16% C. trachomatis, 5% M. genitalium, 4.8% M. hominis, 14% Ureaplasma urealyticum and 14% Ureaplasma parvum (Table 1). T. vaginalis was not detected in any of the samples. There was no significant difference in median age of patients with or without an STI. Thirty-six of the patients had more than one bacterial infection as follows: C. trachomatis and M. genitalium: 3; C. trachomatis and U. urealyticum: 11; C. trachomatis and U. parvum: 1; C. trachomatis and M .hominis: 3; M. genitalium and U. urealyticum: 1; M. genitalium and U. parvum: 1; U. urealyticum and U. parvum: 2; U. urealyticum and M. hominis: 10; U. parvum and M. hominis: 4.

Table 1.

Number of patients analysed for symptoms of NGU, microscopic signs of inflammation and STIs.

	n (percentage tested)	Median age (range)
Number of patients
Total	362 (100%)	29 (16–66)
Symptoms
Positive	223 (62%)	29 (16–64)
Negative	139 (38%)	28 (20–66)
Microscopy
1–4 PMNL/HPF	139 (38%)	28 (20–66)
5–9 PMNL/HPF	48 (13%)	30 (20–56)
10–30 PMNL/HPF	69 (19%)	29 (16–64)
>30 PMNL/HPF	106 (29%)	29 (19–53)
C. trachomatis
Positive	59 (16%)	28 (19–56)
Negative	300 (84%)	29 (16–66)
Not determined	3	–
M. genitalium
Positive	19 (5%)	30 (22–56)
Negative	342 (95%)	29 (16–66)
Not determined	1	–
U. urealyticum
Positive	50 (14%)	28.5 (19–64)
Negative	312 (86%)	29 (16–66)
Not determined	0	–
U. parvum
Positive	49 (14%)	27 (16–66)
Negative	313 (86%)	29 (19–64)
Not determined	0	–
M. hominis
Positive	17 (4.8%)	24 (19–44)
Negative	339 (95.2%)	29 (16–66)
Not determined	6	–

Of the 362 patients, 223 (62%) had reported symptoms of urethritis with either urethral discharge, dysuria or urethral itching (Table 1). Of these 223, 148 (66%) had microsocopic signs of urethritis with ≥ 5 PMNL/HPF, marginally higher than in 75 out of 139 (54%) of patients with no symptoms of urethritis (OD = 1.7, 95% CI = 1.1–2.6).

A total of 360 urine samples (two failed UreD assays because of technical reasons) that were tested for U. urealyticum and U. parvum using the primers and probes for 16S rRNA gene reported in this article were also tested for U. urealyticum and U. parvum UreD gene as described.²⁰ Only three samples gave discordant results for U. urealyticum and eight for U. parvum (Table 2). Because of this high concordance, all consequent data for ureaplasmas are given with analysis from 16S rRNA primers and probes.

Table 2.

Condordance of samples tested for U. urealyticum and U. parvum using Ureaplasma 16s and UreaseD qPCR assay.

	U. urealyticum UreaseD assay
	POS	NEG
U. urealyticum 16S assay
POS	46	1^a
NEG	2^b	311
^aCq = 37.7. ^bCq = 38.2, 39.2.
	U. parvum UreaseD assay
	POS	NEG
U. parvum 16S assay
POS	41	4^a
NEG	4^b	311

Cq = 33.5, 37.7, 37.5, 34.1.

Cq = 30.7, 38.5, 37.1, 35.7.

Detection of C. trachomatis (OR=3.2, CI=1.6–6.4) and M. genitalium (OR=12.2, CI=1.6–92) but not U. urealyticm (OR = 1.0, CI=0.6–1.9) was associated with symptoms of urethritis. This remained true if 36 samples with co-infection described above were excluded from the analysis (Figure 1). U. parvum was more prevalent in patients without symptoms (18.8% vs. 10.3%, OR=0.5, CI=0.27–0.92) indicating a possible protective effect of U. parvum colonisation against NGU. This difference did not remain significant if patients with U. parvum infection and a second co-infection with STI were removed from the analysis (Figure 1).

Figure 1.

Prevalence of single STI in patients with and without clinical symptoms of NGU. Asterisks show values with p < 0.05. *OR = 4.0 (CI = 1.7–9.4), **OR = 9.9 (CI = 1.3–76.8).

In this cohort of male patients, 38% had <5 PMNL/HPF, 13% had mild urethritis, 19% had moderate urethritis and 29% had severe urethritis (Table 1). Within 105 of the patients with no microscopic signs of urethral inflammation (<5 PMNL/HPF) that were tested for C. trachomatis, one patient (0.95%) was found to be infected with C. trachomatis and none were found to be infected with M. genitalium. On the other hand, U. urealyticum and U. parvum were detected in 9.5% and 12.5% of patients in this group, respectively (Figure 2).

Figure 2.

Prevalence of single STI in patients with and without microscopic signs of NGU in urethral smears. Asterisks show values with p < 0.05. *OR = 3.18 (1.3–8.0), **OR = 28.6 (CI = 3.5–234.5), ***OR = 94.55 (CI = 12.4–720.3), ****OR = 29.3 (CI = 3.7–234.8), *****OR = 3.5 (CI = 1.5–8.4).

In patients with severe urethritis, a significantly higher percentage of C. trachomatis (47%, OR=92, CI=12–698), M. genitalium (21%, OR=58, CI=3-1024) and U. urealyticum (26%, OR=2.7, CI=1.1–6.3), but not U. parvum (17%, OR=1.2, CI=0.5–3.5) was found. This difference remains significant if 36 patients with more than one STI, as described above, are excluded from the analysis (Figure 2). C. trachomatis was also statistically more prevalent in patients with mild or moderate urethritis compared to patients without microscopic signs of inflammation (Figure 2).

Discussion

Determining NGU by counting the number of PMNLs in urethral smears has been invaluable in establishing syndromic diagnosis in asymptomatic and symptomatic males²⁹ as well as establishing a link to causes of male urethritis as in the case for C. trachomatis,^30,31 M. genitalium^27,32 and T. vaginalis.^31,33 Microscopy of urethral smear also enables differentiation between gonococcal urethritis and NGU.³⁴

Recently, a similar strategy was used to show that in symptomatic males with NGU confirmed by detecting ≥ 5 PMNL/HPF in urethral smears, a higher prevalence of U. parvum but not U. urealyticum could be detected.²⁰ In this study, we attempt to use the same strategy to determine the role of ureaplasma infection and colonisation in causing mild to severe urethritis. However, it should be noted that counting PMNL is quantification of the host’s immune response to an infection or disease. Although there is a strong association between microscopic signs of inflammation and clinical symptoms, such as dysuria, discharge and itching, there are a large number of patients who report symptoms where no PMNL are found under the microscope and in many patients with microscopic signs of urethritis, no symptoms are reported. In our patient population, 66% of patients who had reported symptoms of urethritis had ≥ 5 PMNL/HPF in urethral smears, whilst 54% of patients without symptoms of urethritis had ≥ 5 PMNL/HPF in urethral smears (OR = 1.7, CI=1.1–2.6, data not shown). This association is somewhat lower than expected and as reporting of symptoms by patients remains difficult to standardise, microscopy remains one of few tools in standardisation and quantification of urethritis.

The quality of the smears, the accuracy of microscopic examination of the smears and the validity of the tests used for detection of bacteria, in this case DNA extraction from urine followed by NAAT, can be evaluated by looking at known causative agents of urethritis. In the patient population that we have studied, there is a linear association between prevalence of C. trachomatis infection and stratification of patients according to severity of urethritis. Whilst only one patient out of 105 was found to be in the patient group with low or no infiltrating PMNL in the urethral smears, C. trachomatis could be detected in 47% of patients with severe urethritis. Consistent with our previous findings and that reported in Scandinavia in general, M. genitalium is detected 2–3 times less frequently than C. trachomatis (for review of prevalence studies see Daley et al. ³⁵). Moreover, microscopic signs of inflammation could be found in all cases where M. genitalium was detected, a finding similar to that reported by Cox et al.²⁰

U. urealyticum and U. parvum infection of the urethra clearly induce a different immune response in the host’s lower genital tract compared to C. trachomatis and M. genitalium. In approximately 40% of patients with either U. urealyticum or U. parvum, an immune response in the form of PMNLs in the lower genital tract is simply not detected. Between 38 and 50% of patients with ureaplasma infection are symptom free. Subsequently, we do not find a linear increase in prevalence of U. urealyticum and patients with either clinical symptoms or those evaluated to have microscopic signs of inflammation, except for patients with severe urethritis. We detected a higher prevalence of U. parvum in patients with moderate signs of inflammation (5–9 PMN/HPF) compared to those without signs of inflammation(0–4 PMNL/HPF) or compared to patients with severe signs of inflammation (>30 PMNL/HPF). Higher prevalence of U. parvum was not found in patients with clinical symptoms of urethritis consistent with U. parvum being a colonising bacterium that is sexually transmitted.

If one theorises that U. parvum may cause a weak immune response prior to establishing itself as part of the (non-pathogenic) flora of the urethra, then one would predict patients with U. parvum, in absence of other STIs, and with a weak immune reaction (5–9 PMNL/HPF), to be younger. We found this not to be the case and there were no trends in age in people with ureaplasma infection and microscopic signs of urethritis (data not shown), implying that there is likely to be interactions of host immune system and bacterial toxicity gene(s), which determines the inflammatory response.

As in all cross-sectional studies, one weakness of this study is that there may be unknown confounders that mask the effect of ureaplasma infection of the male genitourinary tract. A second weakness, specific to this study, in determining the role of ureaplasmas in male urethritis is the NAAT used for detection of Ureaplasma species. We have used two genomic targets, first, 16S rDNA sequences based on sequencing the 16s rDNA gene in a population from the same geographic location as the study group. Second, we used the UreD gene of ureaplasmas based on primers and TaqMan™ Probe reported in an early finding, with reported correlation of finding U. parvum and microscopically confirmed urethritis.²⁰ Our motivation for testing both sets of primers and probes was to combine results of the two tests for increased accuracy in detecting and differentiating the two Ureaplasma biovars. However, because of the high concordance between results from both NAAT targets (>95%), results of association with UreD target or pooled findings were not presented.

Clearly, the toxicity gene(s) in ureaplasmas is yet to be characterised in clinical samples and as Paralanov et al.¹⁴ concluded, the toxicity gene(s) is likely not to be exclusive to an Ureaplasma biovar. In our opinion, testing and treating patients for U. urealyticum should be limited to those where other common agents of urethritis, such as N. gonorrhoeae, C. trachomatis, M. genitalium, T. vaginalis and HSV have been excluded.

In conclusion, we find a high concordance between detecting U. urealyticum and U. parvum using the 16s rRNA gene of ureaplasmas (this study) and Ureaplasma ureD gene²⁰ as NAAT targets. Both Ureaplasma biovars could be detected in the first void urine of a large proportion of men without clinical symptoms or microscopic signs of urethral inflammation. A modestly higher proportion of U. urealyticum but not U. parvum could be detected in men with extensive signs of NGU, consistent with the meta-analysis of earlier studies.¹³ The concordance of these NAAT targets implies that they are good markers of Ureaplasma biovars. However, lack of clear association of prevalence of each biovar with severity of immune response, as measured by microscopic counting of PMNL, implies that they are not the optimal markers of pathogenicity of ureaplasmas in the male urethra. These data support the notion that U. urealyticum and U. parvum are commensal organisms of the male urethra and have low virulence. Our data do not support routine screening of men with NGU for ureaplasma infection unless all other common causes have been ruled out.

Footnotes

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The authors received no financial support for the research, authorship, and/or publication of this article.

References

Taylor-Robinson

Jensen

. Mycoplasma genitalium: from chrysalis to multicolored butterfly. Clin Microbiol Rev 2011; 24: 498–514.

Povlsen

Bjørnelius

Lidbrink

. Relationship of Ureaplasma urealyticum biovar 2 to nongonococcal urethritis. Eur J Clin Microbiol Infect Dis 2002; 21: 97–101.

Ondondo

Whittington

WLH

Astete

. Differential association of ureaplasma species with non-gonococcal urethritis in heterosexual men. Sex Transm Infect 2010; 86: 271–275.

Wetmore

Manhart

Lowens

. Ureaplasma urealyticum is associated with nongonococcal urethritis among men with fewer lifetime sexual partners: a case-control study. J Infect Dis 2011; 204: 1274–1282.

Waites

Katz

Schelonka

. Mycoplasmas and ureaplasmas as neonatal pathogens. Clin Microbiol Rev 2005; 18: 757–789.

Horner

Thomas

Gilroy

. Role of Mycoplasma genitalium and Ureaplasma urealyticum in acute and chronic nongonococcal urethritis. Clin Infect Dis 2001; 32: 995–1003.

Deguchi

Yoshida

Miyazawa

. Association of Ureaplasma urealyticum (biovar 2) with nongonococcal urethritis. Sex Transm Dis 2004; 31: 192–195.

Povlsen

Bjørnelius

Lidbrink

. Relationship of Ureaplasma urealyticum biovar 2 to nongonococcal urethritis. Eur J Clin Microbiol Infect Dis 2002; 21: 97–101.

Yokoi

Maeda

Kubota

. The role of Mycoplasma genitalium and Ureaplasma urealyticum biovar 2 in postgonococcal urethritis. Clin Infect Dis 2007; 45: 866–871.

10.

Robertson

Stemke

Davis

. Proposal of Ureaplasma parvum sp. nov. and emended description of Ureaplasma urealyticum (Shepard et al. 1974) Robertson et al. 2001. Int J Syst Evol Microbiol 2002; 52: 587–597.

11.

Frølund

Lidbrink

Wikström

. Urethritis-associated pathogens in urine from men with non-gonococcal urethritis: a case-control study. Acta Derm Venereol 2016; 96: 689–694.

12.

Couldwell

Gidding

Freedman

. Ureaplasma urealyticum is significantly associated with non-gonococcal urethritis in heterosexual Sydney men. Int J STD AIDS 2010; 21: 337–341.

13.

Zhang

Wang

. Are Ureaplasma spp. a cause of nongonococcal urethritis? A systematic review and meta-analysis. PLoS One 2014; 9: e113771–e113771.

14.

Paralanov

Duffy

. Comparative genome analysis of 19 Ureaplasma urealyticum and Ureaplasma parvum strains. BMC Microbiol 2012; 12: 88–88.

15.

Neyrolles

Ferris

Behbahani

. Organization of Ureaplasma urealyticum urease gene cluster and expression in a suppressor strain of Escherichia coli. J Bacteriol 1996; 178: 647–655.

16.

Frølund

Björnelius

Lidbrink

. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum. PLoS One 2014; 9: e102743–e102743.

17.

Mallard

Schopfer

Bodmer

. Development of real-time PCR for the differential detection and quantification of Ureaplasma urealyticum and Ureaplasma parvum. J Microbiol Meth 2005; 60: 13–19.

18.

Kong

James

. Phylogenetic analysis of Ureaplasma urealyticum – support for the establishment of a new species, Ureaplasma parvum. Int J Syst Bacteriol 1999; 49: 1879–1889.

19.

Kong

James

. Species identification and subtyping of Ureaplasma parvum and Ureaplasma urealyticum using PCR-based assays. J Clin Microbiol 2000; 38: 1175–1179.

20.

Cox

McKenna

Watt

. Ureaplasma parvum and Mycoplasma genitalium are found to be significantly associated with microscopy-confirmed urethritis in a routine genitourinary medicine setting. Int J STD AIDS. 2015. Epub ahead of print 16 September. DOI: 10.1177/0956462415597620.

21.

Moi H. Mikrobiologiske årsaker til non-gonorroisk uretritt/cervicitt. Regionale komiteer for medisinsk og helsefaglig forskningsetikk. 2010.

22.

Nasjonal faglig retningslinje for bruk av antibiotika i sykehus – Uretritt og cervicitt, http://sites.helsedirektoratet.no/sites/antibiotikabruk-i-sykehus/terapikapitler/genitale-infeksjoner/uretritt-og-cervicitt/Sider/default.aspx (accessed 18 June 2016).

23.

Reinton

Moi

Olsen

. Anatomic distribution of Neisseria gonorrhoeae, Chlamydia trachomatis and Mycoplasma genitalium infections in men who have sex with men. Sex Health 2013; 10: 199–203.

24.

Schirm

Bos

PAJ

Roozeboom-Roelfsema

. Trichomonas vaginalis detection using real-time TaqMan PCR. J Microbiol Meth 2007; 68: 243–247.

25.

Reinton

Manley

Tjade

. Respiratory tract infections during the 2011 Mycoplasma pneumoniae epidemic. Eur J Clin Microbiol Infect Dis 2013; 32: 835–840.

26.

Yoshida

Maeda

S-I

Deguchi

. Rapid detection of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum, and Ureaplasma urealyticum organisms in genitourinary samples by PCR-microtiter plate hybridization assay. J Clin Microbiol 2003; 41: 1850–1855.

27.

Moi

Reinton

Moghaddam

. Mycoplasma genitalium is associated with symptomatic and asymptomatic non-gonococcal urethritis in men. Sex Transm Infect 2009; 85: 15–18.

28.

Jensen

Kleveland

Moghaddam

. Chlamydia trachomatis, Mycoplasma genitalium and Ureaplasma urealyticum among students in northern Norway. J Eur Acad Dermatol Venereol 2013; 27: e91–e96.

29.

Swartz

Kraus

Herrmann

. Diagnosis and etiology of nongonococcal urethritis. J Infect Dis 1978; 138: 445–454.

30.

Terho

. Chlamydia trachomatis in gonococcal and postgonococcal urethritis. Br J Vener Dis 1978; 54: 326–329.

31.

Schwebke

Hook

. High rates of Trichomonas vaginalis among men attending a sexually transmitted diseases clinic: implications for screening and urethritis management. J Infect Dis 2003; 188: 465–468.

32.

Björnelius

Lidbrink

Jensen

. Mycoplasma genitalium in non-gonococcal urethritis – a study in Swedish male STD patients. Int J STD AIDS 2000; 11: 292–296.

33.

Krieger

Verdon

Siegel

. Natural history of urogenital trichomoniasis in men. J Urol 1993; 149: 1455–1458.

34.

Taylor

DiCarlo

Martin

. Comparison of methylene blue/gentian violet stain to Gram’s stain for the rapid diagnosis of gonococcal urethritis in men. Sex Transm Dis 2011; 38: 995–996.

35.

Daley

Russell

Tabrizi

. Mycoplasma genitalium: a review. Int J STD AIDS 2014; 25: 475–487.