Molecular evidence of toxoplasmosis in people living with HIV in Pakistan

Abstract

Background

Toxoplasma gondii is a zoonotically important parasite infecting almost all vertebrates. The parasite can easily infect humans through the fecal-oral route, particularly immunocompromised individuals, and children. Due to lack of epidemiological data regarding the occurrence of Toxoplasma gondii in people living with HIV in Pakistan, the present study was designed to estimate the prevalence of Toxoplasma gondii in people living with HIV.

Methods

Briefly, 384 blood samples were randomly collected from people living with HIV registered under Punjab AIDS Control Program. DNA of all samples was extracted and the 18S rRNA gene of T. gondii was amplified through polymerase chain reaction (PCR) by using genus-specific primers. The amplicons were spread on 1.5% agar rose gel and visualized under gel documentation system. Then the amplicons were purified from the gel and subjected to sequence and phylogenetic analysis.

Results

Overall prevalence of T. gondii was observed as 23.96%. The prevalence of T. gondii was significantly (p <0.05) higher in females and in middle age group (26–40 years). Similarly, the prevalence was significantly (p <0.05) higher in people with poor socioeconomic status, symptomatic patients, drugs users and people using unfiltered water for drinking. Furthermore, bodyweight (46–70 kg) and dry seasons also significantly (p <0.05) affected the prevalence of T. gondii.

Conclusions

Our findings illustrated a high infection rate of toxoplasmosis in people living with HIV which could be a significant cause of mortality. More studies need to be conducted for other opportunistic infections caused by parasites and other pathogens.

Keywords

HIV opportunistic parasites polymerase chain reaction phylogeny

Introduction

Toxoplasma (T.) gondii is a zoonotic intracellular parasite of almost all warm-blooded mammals.¹ Around one third of the world’s population is at risk of T. gondii infection. In humans, the parasite is usually transmitted by ingestion of oocysts through contaminated water, food and partially cooked meat.² T. gondii mainly infects children, old age people, pregnant women and immunocompromised individuals. In immunocompetent or healthy individuals, it causes asymptomatic but persistent chronic infection. However, T. gondii causes severe opportunistic infections in people living with HIV resulting in the physical and psychological disabilities.^3,4

Cerebral toxoplasmosis is most common disease in developed and developing countries in people living with HIV. In Europe and other tropical countries, 50% of people living with HIV were found positive for T. gondii infection. Similarly, one third of people living with HIV in USA, 75.4% in Nigeria, 28.5% in Tunisia, 74.5% in South Brazil, 63.7% in Paris and 12.5% people living with HIV in China were reported sero-positive for T. gondii infection. However, toxoplasmosis was recorded at the highest levels in France with an infection rate of 79%.⁵

The dietary habits of a population play a vital role in transmission of such infectious diseases. Infection usually occurs by ingestion of oocysts, which further converts to most active form i.e. the tachyzoite in intestinal epithelium.⁶ As the cell is full of tachyzoites, the cell usually bursts and releases free tachyzoites in the extracellular environment. Then, there is progression of infection due to continuous replication of tachyzoites in nucleated cells.⁷ If the tachyzoites are not controlled by the immune system, then the infection is transformed to generalized toxoplasmosis. Human infection caused by Toxoplasma is usually asymptomatic and occurs due to ingestion of tissue cysts by consuming raw meat.⁸

Vertical transmission is also very common in T. gondii, in which the rapidly growing tachyzoites are transferred from mother to fetus. It results in severe malformations in neonates.⁹ In the case of vertical transmission, heavy infection with tachyzoites has been observed in the inflamed lungs, liver, myocardium and brain which leads to lymphadenopathy. Later, the tachyzoites are converted to bradyzoites, which are enclosed in zoitocysts and showed asymptomatic infection. In the congenital form of toxoplasmosis, retinochoroiditis is frequently observed. The rate of symptomatic infections is quite low around 10–20%, but it is lethal in case of congenital infection. In recent decades, organ transplantation has also been observed as a transmission route for T. gondii.¹⁰

An early and accurate diagnosis of T. gondii infection is necessary for clinical management of people living with HIV. As the patients need therapy as early as possible to decrease the parasitic load, serological detection needs to be improved or replaced by more specific and sensitive detection methods such as the PCR (polymerase chain reaction). Unfortunately, the diagnosis of mixed infections particularly with opportunistic parasites like T. gondii in people living with HIV is not a common practice in Pakistan and no epidemiological record is available. Thus, the current study was planned to investigate the prevalence of T. gondii in people living with HIV in central Punjab, Pakistan via PCR.

Materials and methods

Sample size and sample collection

Samples were collected from people living with HIV, registered under Punjab AIDS Control Program (PACP), health department, Government of Punjab, Pakistan through a stratified random sampling method and proportional allocation method. The sample size was estimated by the Thrusfield formula.¹¹

According to the formula, 384 blood samples were to be collected in EDTA coated vacutainers by puncturing the cephalic vein of people living with HIV. Samples were preserved at 4°C for further analysis.

Development of questionnaire performa

A predesigned questionnaire was prepared containing closed ended questions to collect information regarding different associated risk factors including gender, age, socioeconomic status of people living with HIV, clinical status of symptoms, livelihood, source of drinking water, body weight and season of collection of samples.

Amplification of DNA and gel electrophoresis

The DNA from blood samples was extracted using Blood genomic DNA Extraction Mini kit by following instructions mentioned by the manufacturer (Favorgen Biotech Corp®). The obtained DNA was subjected to PCR for the amplification of 18S rRNA gene of T. gondii. For this purpose, newly designed primers (TF: ACATGCCTCTTCCCCTGGAA; TR: TTCACCAAGTGCACA) were prepared by downloading the multiple 18S rRNA sequences from NCBI which were subjected to multiple sequence alignment in ClustalX software. Primers were selected from conserved regions of these sequences and their characteristics were evaluated using primer blast at NCBI. The PCR was performed in 20 μl reaction mixture containing 10 μl of 2X master mixture, 1 μl of each respective primer, 5 μl of DNA sample and 3 μl distal water. The reaction conditions were as follow: initially, denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C for 40 s. Annealing was performed at 60°C for 30 s, extension at 72°C for 1 min; and the final extension at 72°C for 7 min. The amplified products were separated into 1.5% agar rose gel using gel electrophoresis. The bands were visualized by documentation system. The targeted bands on specific product length (511 bp) were isolated from gel using QIAquick® gel extraction kit (QIAGEN) and purified products were subjected to sequencing.

Phylogenetic analysis of sequence

The obtained sequences were searched in BLASTn at NCBI to find the similarity indices and to download related sequences.¹² The downloaded sequences and query sequences were added in FASTA file and multiple sequence alignment was performed using ClustalX software. Then, the aligned sequences’ file was opened in Bioedit software for computation of similarity indices and evolutionary divergence estimates between query sequences and subject sequences based on number of base pair differences. The sequences were edited in Bioedit software for construction of phylogenetic tree, including removal of extra sequences, gaps etc.¹³ The jModel Test was used for selection of best-fit model of nucleotide substitution for data.¹⁴ Neighbor-joining, maximum-parsimony and Bayesian inference methods was used in PAUP* v4b10 for construction of phylogenetic tree.¹⁵ The phylogenetic tree was constructed through Neighbor-joining method.

Statistical analysis

Prevalence of T. gondii and associated risk factors were statistically analyzed by using multiple logistic regression method.¹¹ Moreover, pairwise comparison of associated risk factors was performed through odds ratio by using SAS (1998) at 95% level of confidence.

Results

Molecular detection of T. gondii in people living with HIV showed overall prevalence of 23.96% (Table 1). Different risk factors likely to be associated with the prevalence of T. gondii were also evaluated. The prevalence of T. gondii was significantly (p <0.05) higher in females (47.11%; 57/121) as compared to that of males (13.61%; 26/191) and she-males (12.50%; 9/72). Based on age, the prevalence was significantly (p <0.05) higher in group being 26–40 years of age (32.24%; 69/214) as compared to age group 10–25 years (9.09%; 7/77) and age group >40 years (17.20%; 16/93). However, based on socioeconomic status, a significantly (p <0.05) higher prevalence was found in communities having poor socioeconomic status (42.54%; 57/134) followed by those of rich (11.11%; 8/72) and middle-class communities (15.17%; 27/178). Regarding symptomatic status of toxoplasmosis in people living with HIV, the symptomatic people had significantly (p <0.05) higher prevalence (45.77%; 65/171) as compared to those without symptoms of toxoplasmosis (11.16%; 27/213). Similarly, the prevalence was significantly (p <0.05) higher in people who inject drugs (46.48%; 66/142) as compared to civil community (7.27%; 12/158) and sex work (17.86%; 15/84). Moreover, on the basis of the source of drinking water the unfiltered water users (30.66%; 84/274) had significantly (p <0.05) higher prevalence as compared to those using filtered water (7.27%; 8/110). Based on body weight, a significantly (p <0.05) higher prevalence was found in the people living with HIV having body weight of 46–70 kg (32.65%; 64/196) as compared to those having 30–45 kg (11.46%; 11/96) and >70 kg (18.48%; 17/92). Similarly, among different seasons, a significantly (p <0.05) higher prevalence was observed in dry season that autumn season (44.09%; 41/93) followed by winter (21.43%; 12/56), spring (19.19%; 19/99) and summer season (14.71%; 20/136).

Table 1.

Risk factors associated with the prevalence of T. gondii in people living with HIV.

Determinants	Category	No. of samples	No. of +ve	Prevalence (%)	Confidence interval	Odd ratio	P-value
Gender	Male	191	26	13.61	0.48–2.48	1.1030	0.8128
	Shemale	72	9	12.50	—	—	—
	Female	121	57	47.11	2.84–13.65	6.2344	0.0001
Age	10–25	77	7	9.09	—	—	—
	26–40	214	69	32.24	1.83–9.55	4.1818	0.0007
	>40	93	16	17.20	0.80–5.34	2.0779	0.1294
Socioeconomic status	Poor	134	57	42.54	2.63–13.32	5.9221	0.0001
	Middle class	178	27	15.17	0.61–3.31	1.4305	0.4043
	Rich	72	8	11.11	—	—	—
Clinical status	Asymptomatic	213	27	11.16	—	—	—
Clinical status	Symptomatic	171	65	45.77	2.54–7.02	4.2243	0.0001
Livelihood	People living with sex work	84	15	17.86	1.17–5.95	2.6449	0.0188
	People who inject drugs	142	66	46.48	5.38–20.74	10.5658	0.0001
	People living with civil community	158	12	7.59	—	—	—
Drinking water	Filtered	110	8	7.27	—	—	—
Drinking water	Unfiltered	274	84	30.66	2.02–12.19	5.2941	0.0001
Weight	30–45	96	11	11.46	—	—	—
	46–70	196	64	32.65	1.86–7.50	3.7466	0.0002
	>70	92	17	18.48	0.77–3.97	1.7515	0.1801
Season	Spring	99	19	19.19	0.69–2.74	1.3775	0.3626
	Summer	136	20	14.71	—	—	—
	Autumn	93	41	44.09	2.44–8.55	4.5731	0.0001
	Winter	56	12	21.43	0.71–3.50	1.5818	0.2585
Overall	—	384	92	23.96	—	—	—

Sequence analysis and phylogeny of T. gondii

Overall, 92 samples were positive for T. gondii and out of these 92 samples, 30 samples were randomly selected for sequencing by using both forward and reverse primer. Out of these 30 sequences, 9 sequences were included in group 1 based on their 100% similarity with each other. Similarly, 6 sequences were included in group 2, 7 sequences were included in group 3, 8 sequences included in group 4. It was observed that sequences of Group-1 (OM510341) were 98.63% similar to sequences of T. gondii isolated from humans (KX008026.1) and animals (KX008005.1; KX008002.1; KM875436.1; KX008020.1). While sequences of Group-2 (OM510340) showed 99.41% similarity with T. gondii sequences isolated from human (KX008000.1) and the sequences of T. gondii isolated from animals (KX008012.1; KX008013.1; KX008014.1). However, the sequences of Group-3 (OM510428) were 98.22% similar with the sequences of T. gondii isolated from both human (KX008029.1) and animals (KX007999.1; KX008003.1). Similarly, Group-4 (OM510397) sequences had shown 99.02% similarity with sequence of T. gondii isolated from human blood samples (KX008000.1) and 98.83% similarity with sequences of T. gondii isolated from animals (KX008024.1; KX008021.1). Similarly, it was revealed that all groups of sequences differ from each other from 5–11 base pairs and the percent identity between all the sequences of four groups of T. gondii varied from 97.8% to 99.0% (Table 2(a) and (b)). However, for inquiry of diversity, the phylogenetic tree was constructed through the neighbor joining method. It was revealed that all the four groups of sequences subjected to phylogenetic tree construction were appeared in the same clade ascending to reference sequence (XR001974310.1), which was further ascending to sequences of T. gondii isolated from animal (KX008005.1; KX008019.1; KX008029.1) and human sequences (KX008026.1; KX008029.1) (Figure 1).

Table 2.

The estimation of evolutionary divergence and nucleotide percent identity between different groups of obtained sequences of T. gondii isolated from people living with HIV.

Sequences	Group-2	Group-3	Group-4	Group-1
Group-2	—
Group-3	5	—
Group-4	6	7	—
Group-1	9	11	10	—	a
Group-2	—
Group-3	99.0	—
Group-4	98.8	98.6	—
Group-1	98.2	97.8	98.0	—	b

Figure 1.

Neighbor joining tree showing phylogenetic relationship among the different groups of obtained sequences of T. gondii and closely related sequences.

Discussion

HIV in people is a worldwide problem, affecting 37.9 million people.¹⁶ It has been observed that around 3.1 million new cases are being reported every year. The disease is highly prevalent in Sub-Saharan countries.¹⁷ In Pakistan, there are approximately 160,000 people living with HIV according to UN.¹⁸ Due to the weaker immune system of these people, some opportunistic pathogens lead to severe morbidity and mortality in these patients. Opportunistic parasites such as T. gondii exert a great potential for mortality in people living with HIV.

In the present study, 23.96% (92/384) blood samples were positive for T. gondii through PCR. Previously, T. gondii has also been detected in people living with HIV in many countries with varied prevalence.^19,20 In a meta-analysis comprising 74 studies, it was found that 35.8% people living with HIV had coinfection with T. gondii. In another study, it has been reported that 36.7 million people living with HIV worldwide are exposed to T. gondii infection.²¹

Different factors associated with prevalence of these parasites were taken into consideration, including gender, age, socioeconomic status, clinical signs, livelihood of people living with HIV, drinking water and season. As far as gender was concerned, T. gondii was significantly more prevalent in female patients as compared to that in male patients. The results were in accordance with the previous studies conducted in north India and Telangana State of southern India.²² Anuradha and Preethi²³ stated that the prevalence of opportunistic parasites in people could be due to the presence of fertile age group (19–50 years) that makes the females more prone to T. gondii infection. In contrast to our study, no significant difference was found in the prevalence of T. gondii between males and females.²⁴

Age wise, the prevalence of T. gondii was significantly higher (p <0.05) in age group of 26–40 years. The results were in accordance with the findings of Jones et al.²⁴ Moreover, it was observed in a study that the higher prevalence with respect to age also depends on fertile window (19–50 year of age) of females. It was also explained that the sero-prevalence of T. gondii increased up to 45–80% with increase in age within the fertile window.²⁵ As far the socio-economic status of studied population was concerned, the prevalence T. gondii was significantly higher (p <0.05) among poor community as compared to middle class and rich communities. It is evident that different parameters of socioeconomic status including nutrition status, hygienic conditions and housing of the host directly affect the transmission of these parasites.^25–27

In present study, it was observed that the prevalence of T. gondii was significantly higher (p <0.05) among people living with HIV having symptoms of parasitic infections as compared to those having no symptoms. These symptoms include anemia, lymphadenopathy, splenomegaly and toxoplasmic encephalitis (TE). Previously, Osunkalu et al.²⁸ had reported the similar kind of results at Lagos university teaching hospital where the people living with HIV and TE showed higher rate of toxoplasmosis. In association with drinking water, the prevalence of T. gondii was significantly higher (p <0.05) among those people consuming unfiltered water as compared to those of consuming filtered water. In Pakistan, the main source of drinking water includes the municipal water supplies (unfiltered), which may be contaminated with sewerage water.²⁹ Petersen et al.³⁰ also reported the higher prevalence of T. gondii in the groups using untreated and unfiltered water.

Among body weight, the prevalence of T. gondii was significantly higher (p <0.05) in those having body weight of 46–70 kg. It was observed that most of the individuals with 46–70 kg weight fall in age group of 26–40 years. It has been described earlier that the age group of 26–40 years have higher prevalence of T. gondii, who have low immunity due to their fertile window.²⁵ Regarding different seasons, a significantly higher (p <0.05) prevalence of T. gondii was observed in dry seasons i.e., autumn followed by spring, summer and winter. It has already been established that the autumn season was more favorable for maturation and sporulation of T. gondii oocysts. In a previous study, four-times higher prevalence of T. gondii was observed in autumn as compared to that in other seasons.³¹

For molecular characterization, 30 positive samples were randomly selected for sequencing by using both forward and reverse primer. The obtained sequences of these 30 samples were divided into four groups on the basis of 100% nucleotide similarity. Sequence analysis revealed that these groups differ from each other in 5–11 base pairs and the percent identity between all the sequences of four groups of T. gondii varied from 97.8% to 99.0%. Moreover, all four groups of T. gondii sequences appeared in the same clade and were ascending to all other closely related sequences of T. gondii isolated from human (KX008026.1; KX008029.1) and animals (KX008005.1; KX008019.1; KX008029.1).

Conclusion

The current study provided a true estimate of toxoplasmosis in people living with HIV in Pakistan. Certain risk factors like livelihood, socioeconomic status and lack of awareness are the primary factors harboring the infection in people living with HIV. Based on our findings, this significant level of toxoplasma infection as a secondary infection could be a significant factor of mortality in people living with HIV in Pakistan.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was sponsored by Primary and Secondary Health Care Department/Punjab Aids Control Program (PACP), Government of Punjab under M.Phil./Ph.D. Scholarship scheme (Letter No. PACP/Lab-1/84; dated 10/07/2017).

Ethics approval

Blood samples were collected from the HIV treatment centers of PACP, where the people with HIV are registered for treatment. Therefore, no ethical statement was needed regarding the use of humans for experimental purposes.

Data availability

The identity and personal information of all the participants is kept confidential by the Punjab aids control Program (PACP) and is not publicly available. However, the datasets analyzed during the current study are available from the corresponding author on reasonable request.

ORCID iD

Muhammad Kasib Khan

References

Ogoina

Onyemelukwe

Musa

, et al. Seroprevalence of IgM and IgG antibodies to Toxoplasma infection in healthy and HIV-positive adults from Northern Nigeria. J Infect Dev Ctries 2013; 7: 398–403.

Pereira-Chioccola

Vidal

. Toxoplasma gondii infection and cerebral toxoplasmosis in HIV-infected patients. Future Microbiol 2009; 4: 1363–1379.

Fard

Khajeh

Khosravi

, et al. Fulminant and diffuse cerebral toxoplasmosis as the first manifestation of HIV infection: a case presentation and review of the literature. Am J Case Rep 2020; 21: e919624–e919626.

Chen

Peng

Mohsin

, et al. Construction and evaluation of the Toxoplasma gondii DNA vaccine targeting DEC-205. Pak Vet J 2022; 42: 256–260.

Basavaraju

. Toxoplasmosis in HIV infection: an overview. Trop Parasitol 2016; 6: 129.

Rafique

Nasir

Ashraf

, et al. Sero-Surveillance and risk factors analysis of caprine toxoplasmosis in Faisalabad Punjab, Pakistan. Pak Vet J 2022; 42: 102–106.

Yawoz

Jaafar

Alali

, et al. Seroprevalence of camels listeriosis, brucellosis and toxoplasmosis from Kirkuk Province, Iraq. Pak Vet J 2021; 41: 335–340.

Fernandes

Ribeiro

. Incidence and risk factors of Toxoplasma gondii in workers that occupationally handle animals: a systematic review. In: Occupational and environmental safety and health II. Berlin, Germany: Springer, 2020, pp. 341–349.

Weiss

Dubey

. Toxoplasmosis: a history of clinical observations. Int J Parasitol 2009; 39: 895–901.

10.

Bastien

. Molecular diagnosis of toxoplasmosis. Trans R Soc Trop Med Hyg 2002; 96: S205–S215.

11.

Thrusfield

. Veterinary epidemiology. New Jersey, USA: John Wiley and Sons, 2018.

12.

Altschul

Gish

Miller

, et al. Basic local alignment search tool. J Mol Biol 1990; 215: 403–410.

13.

Hall

Yamamoto

Satoh

. BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symposium Series 1999; 41: 95–98.

14.

Posada

. jModelTest: phylogenetic model averaging. Mol Biol Evol 2008; 25: 1253–1256.

15.

Ronquist

Huelsenbeck

. MrBayes 3: bayesian phylogenetic inference under mixed models. Bioinformatics 2003; 19: 1572–1574.

16.

Ali

Jamal

Ullah

, et al. APOBEC3G variant (rs6001417) CG and GG genotypes and their protective features against HIV_1 infection in Pakistan dwelled community. Adv Life Sci 2021; 8: 108–113.

17.

Asif

Nawaz

Bhutta

, et al. Viral outbreaks: a real threat to the world. Adv Life Sci 2020; 8: 8–19.

18.

Ali

Jamal

Ullah

, et al. Male predominant association with apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G variants (rs6001417, rs35228531, rs8177832) predict protection against HIV-1 infection. Adv Life Sci 2020; 7: 91–97.

19.

Villard

Filisetti

Roch-Deries

, et al. Comparison of enzyme-linked immunosorbent assay, immunoblotting, and PCR for diagnosis of toxoplasmic chorioretinitis. J Clin Microbiol 2003; 41: 3537–3541.

20.

Hafid

Flori

Raberin

, et al. Comparison of PCR, capture ELISA and immunoblotting for detection of Toxoplasma gondii in infected mice. J Med Microbiol 2001; 50: 1100–1104.

21.

Wang

Liu

, et al. Prevalence and burden of Toxoplasma gondii infection in HIV-infected people: a systematic review and meta-analysis. Lancet HIV 2017; 4: e177–e188.

22.

Mewara

Singh

Khurana

, et al. Seroprevalence of toxoplasmosis at a tertiary care centre in North India from 2004 to 2014. Indian J Med Microbiol 2019; 37: 351–357.

23.

Anuradha

Preethi

. Seroprevalence of toxoplasma IgG antibodies in HIV positive patients in and around Khammam, Telangana State. J Clin Diagnostic Res 2014; 8: DL01–DL02.

24.

Jones

Kruszon-Moran

Wilson

, et al. Toxoplasma gondii infection in the United States: seroprevalence and risk factors. Am J Epidemiol 2001; 154: 357–365.

25.

Mareze

Benitez

AdoN

Brandão

APD

, et al. Socioeconomic vulnerability associated to Toxoplasma gondii exposure in southern Brazil. PLoS One 2019; 14: e0212375.

26.

Singh

Munawwar

Rao

, et al. Serologic prevalence of Toxoplasma gondii in Indian women of child bearing age and effects of social and environmental factors. PLoS Negl Trop Dis 2014; 8: e2737.

27.

Alvarado-Esquivel

Torres-Castorena

Liesenfeld

, et al. High seroprevalence of Toxoplasma gondii infection in a subset of Mexican patients with work accidents and low socioeconomic status. Parasites Vectors 2012; 5: 1–6.

28.

Osunkalu

Akanmu

Ofomah

, et al. Seroprevalence of Toxoplasma gondii IgG antibody in HIV-infected patients at the Lagos University teaching hospital. HIV/AIDS (Auckl) 2011; 3: 101–105.

29.

Abbas

Khan

Abbas

, et al. Molecular epidemiology of Cryptosporidium parvum and Giardia lamblia in different water bodies, soil and vegetables in Pakistan. Health Secur 2022; 20: 1–13.

30.

Petersen

Kijlstra

Stanford

. Epidemiology of ocular toxoplasmosis. Ocul Immunol Inflamm 2012; 20: 68–75.

31.

Sakban

A’aiz

. Investigate the Toxoplasma gondii infection in the consumed beef in Al-Diwaniyah province. Iraqi J Vet Sci 2020; 34: 95–99.