Expression and methylation analysis of p15 and p16 in mouse bone marrow cells exposed to 1,4-benzoquinone

Abstract

Benzene is an important industrial chemical. It is also an environmental pollutant recognized as a human carcinogen. Both prenatal and adult exposures to benzene are associated with the development of leukemia. To understand the mechanism of benzene-induced epigenetic variations, we investigated the expression and methylation patterns of CpG (phosphodiester bond between cytosine and guanine) islands in p15 and p16 promoter regions in 1,4-benzoquinone (1,4-BQ)-treated primary cultivated C57BL/6J mouse bone marrow cells in vitro. The cell toxicity of 1,4-BQ was evaluated by cell viability test, real-time PCR was used to measure the mRNA expression levels, and bisulfite sequencing PCR (BSP) was used to look into the methylation patterns. The cell viability test indicates that 1,4-BQ exhibited a dose-dependent toxicity to mouse bone marrow cells. After a 24-h exposure to 1,4-BQ at final concentrations of 0, 0.1, 1, and 10 μmol/L, the mRNA expression of p15 and p16 decreased with the increase in 1,4-BQ concentration. The BSP results gathered from the exposure and the control groups were the same. In summary, despite the observation that short-term exposure to 1,4-BQ primary cultivated mouse bone marrow cells decreased the p15 and p16 transcripts, with no influence by their gene promoter methylation.

Keywords

benzene p15 p16 mRNA expression methylation

Introduction

Benzene is a ubiquitous toxicant, which can be used as industrial solvents, diluents, substrate for the synthesis of various chemicals,^1,2 found in cigarette smoke, gasoline vapors, and automobile emissions.^3,4 Therefore, the hazard from exposure to benzene is a major public health concern.⁵ Benzene is metabolized primarily to reactive metabolites such as catechol and hydroquinone in the liver, then undergo subsequent metabolism in the bone marrow by myeloperoxidases and produce a series of metabolites.⁶ Benzoquinione is one of the major active metabolites of benzene’s hematotoxicity and genotoxicity.⁷ Benzene has been classified as a human carcinogen by the International Agency for Research on Cancer.^8,9 A number of experimental and epidemiological evidence indicate that chronic occupational exposure to benzene is associated with aplastic anemia and acute myelogenous leukemia.^10,11 Benzene can induce oxidative and DNA damage, such as chromosome aberration and sister chromosome exchange in peripheral blood and bone marrow cells,¹² and induce the mutation of several tumor-associated genes and micronuclei.¹³ In recent years, some meaningful studies have been found on benzene-induced epigenetic modification effects.^14,15 However, the exact mechanisms of benzene-induced epigenetic modification remain unknown.

The p15 and p16 genes are both located in chromosome 4 and belong to the INK4 kinase family. They are cyclic-dependent kinase inhibitors which negatively regulate the cell cycle, especially the G1 to S phase transition in cell control.^16,17 Both are hypermethylated in murine myeloid leukemia.¹⁸ The p15 gene can function in extracellular growth inhibitory signals,¹⁹ whereas p16 can act as an effector in the intracellular growth pathway and inhibit the activity of cyclin D-CDK4/6 complex.²⁰

Bollati et al.²¹ reported that dysregulation and hypermethylation in p15 and genome-wide hypomethylation were associated with very low benzene exposures (∼22 ppm) in healthy subjects. Xing et al.²² found that decrease of p15 and p16 genes expression were accompanied by alterations in DNA methylation in patients with benzene poising. The influence of other air pollutants, however, cannot be neglected, since study groups are exposed to mixed air pollutants in these studies.

In order to well understand the benzene-induced epigenetic modification effects, in the present study we used analytically pure 1,4-benzoquinone (1,4-BQ), which can remove the effects of other pollutants, treat primary-cultivated C57BL/6J mouse bone marrow cells, and investigate the mRNA expression levels and the CpG (phosphodiester bond between cytosine and guanine) islands methylation status in p15 and p16 promoter regions.

Materials and methods

Chemicals and reagents

Sigma (Germany) was the source of 1,4-BQ (≥99% pure). Dulbecco Modified Eagle Medium (DMEM) was obtained from Solarbio Science and Technology Company (China), Hot-start Taq polymerase, Universal methylation mouse DNA standard and control primers, and EZ DNA Methylation-Gold Kit™ were purchased from Zymo Research Corporation (USA). The other chemicals were commercially available products, unless otherwise specified.

Animals

Upon approval of the study plan by The Institutional Animal Care and Use Committee of Wenzhou Medical College, a total of 20 C57Bl/6J mice, equal numbers of males and females, 6–8 weeks old, were provided by the Experimental Animal Center of Wenzhou Medical College (China). Animals were acclimated to the environment for 3 days prior to use.

Separation and culture of mouse bone marrow cell

After killing the mice the femur and the tibia were subsequently separated and disinfected with 75% alcohol. The cartilage was cutoff under bacteria-free condition, exposing the marrow cavity. The bone marrow cells were dashed out using a germ-free injector with DMEM. The cells were then routinely cultured in DMEM with 10% heat-inactivated fetal bovine serum and incubated at 37°C under 5% CO₂ in a humidified atmosphere.

Cell viability test

The density of the bone marrow cells increased to 80–90% in the logarithmic phase. The cells were inoculated in 96-well plates, with 5000 cells per well, and were cultured for 48 h in a CO₂ incubator. The cells were treated with 1,4-BQ in terminal concentrations of 0, 0.1, 1, 5, 10, 20, and 40 μmol/L for 24 h. Treatment with each concentration was repeated three times. Subsequently, 10 μl of Cell Counting Kit-8 (CCK-8) solution was added to every well. The cells continued to be cultured for 48 h in the CO₂ incubator, optical density (OD) value was measured at 450 nm. All assays were performed in triplicates and the survival rate of cells was calculated using the following formula: ₄₅₀₄₅₀ LC₅₀ was calculated using the probit procedure (probability unit regression) in SPSS16.0.

Cell treatment

The density of the bone marrow cells increased to 80–90% after being cultured for 2 weeks. According to the results of the cell viability test, the cells were only treated with 1,4-BQ in final concentrations of 0, 0.1, 1, and 10 μmol/L for 24 h. The cells were harvested for the expression level and methylation pattern studies of p15 and p16.

RNA isolation and real-time PCR

The total RNA was prepared from cultured cells using the RNA prep pure Cell kit (TIANGEN, China), according to the manufacturer’s instructions. cDNA synthesis was performed in a 20 μl reaction system of reverse transcription which includes 300 ng RNA (TaKaRa, Japan). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control to normalize the expression levels. The primer sequences of p15, p16, and GAPDH are shown in Table 1. cDNA, 60 ng, was used for real-time PCR in a volume of 20 μl. Every concentration was run three times. The program was as follows: predenaturing at 98°C for 30 sec, 40 cycles of denaturation at 95°C for 5 sec, and annealing at 60°C for 30 sec. The analyses were conducted using three independent experiments.

Table 1.

Primers sets used for real-time PCR analysis

Gene	Forward (5′–3′)	Reverse (5′–3′)	Product size
p15	CCCTGCCACCCTTACCAGA	CAGATACCTCGCAATGTCACG	169 bp
p16	TCTTTGTGTACCGCTGGGAAC	GCATCGCTAGAAGTGAAGCTAAGAA	154 bp
GAPDH	AAATGGTGAAGGTCGGTGTGAAC	CAACAATCTCCACTTTGCCACTG	90 bp

GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

Prediction of CpG islands and design of methylation-specific primers for p15 and p16

The original sequence of p15 (gene ID: 12579) and p16 (gene ID: 12578) were researched in GenBank, using Promoter 2.0 Prediction Server (http://www.cbs.dtu.dk/services/Promoter) to predict the promoter regions of p15 and p16. ‘MethPrimer’ (http://www.urogene.org/methprimer/index1.html), an online program for designing primers for methylation-specific PCR (MSP) and bisulfite sequencing PCR (BSP), was applied to predict the CpG islands and design methylation-specific primers for p15 and p16.^23,24 Using the ‘MethPrimer’ default algorithm, the CpG islands were identified as >200 bp regions with G and C contents >50% and observed/expected CpG rates of >0.6. The primers were synthesized by Shenggong Biotechnologies Company (China).

DNA isolation and bisulfite modification

Genomic DNA was extracted in accordance with the instructions of the DNA isolation kit (TIANGE, China). Digestion of 500 ng purified gene DNA was performed by SmaI in 30°C water bath for 5 h. Subsequently, 400 ng of the digested DNA was bisulfite modificated using the EZ DNA Methylation-Gold Kit™ (Zymo Research, USA). According to the manufacturer’s instructions, the major processes were performed as follows: denaturation of 400 ng digested DNA at 98°C for 10 min and sulfidation at 64°C for 2.5 h with a CT conversion reagent; sample was centrifuged and washed, then incubated with 200 μl M-desulfonation buffer at room temperature for 20 min. The buffer was washed away and 15 μl M-elution buffer was used for the eluted bisulfite modification DNA. Two hundred and fifty nanograms, of universal methylation mouse DNA standard (Zymo Research, USA) was used as the control for the treatment effect of the same bisulfite modification.

Bisulfite sequencing PCR

The sequence of the methylation-specific primers for p15 and p16 are shown in Table 2. Bisulfite-modified DNA (170 ng), 1 μl of individual methylation-specific primers (10 nM), 5 μl of 2× PCR buffer, and 5 μl of deoxyribonucleotide (dNTPs; 1.25 mM) were added with double-distilled water to fill a volume of 50 μl. Utilizing the hot-start PCR with touch-down RCR, the PCR reaction was performed under the following conditions: 97°C initial denaturation for 7 min, addition of 0.5 U of hot-start Taq polymerase (Zymo Research, USA); 97°C for 7 min; subsequently 10 cycles of 95°C for 1 min, 55°C, for 1 min, and 72°C for 1 min; 55°C was used instead of 53, 50, and 48°C, respectively, every 10 cycles, and finally 10 min at 72°C, for a total of 40 cycles. The BSP products were loaded to 2% agarose gels, stained with ethidium bromide and visualized under ultraviolet (UV) illumination. BSP products were extracted from agarose gel, purified, and sequenced (Shenggong Biotechnologies Company).

Table 2.

Sequence of methylation-specific primers for p15 and p16

Gene	Forward (5′–3′)	Reverse (5′–3′)	Product size
p15(F)^a	GGTTTGAGTTAAATAAAGATTTTTGTTT	CTCCCCTCTAAAAACCCAATAAC	375 bp
p15(S)^b	GTTATTGGGTTTTTAGAGGGGAG	CACCAAAAAACTACCCAAATAATAC	331 bp
p16	TGGTAATTGAAATGTTATTTTTTTT	AAAAAACCCACTAATCACAC	285 bp

^a The first part of p15 including the first CpG island and the first half of the second CpG island of p15.

^b The second part of p15 including the latter half of the second CpG island and the third CpG island of p15.

Statistical analysis

All statistical analyses were performed with SPSS16.0 for Windows (Chicago, IL, USA). Data were presented as means and standard deviations. One-way analysis of variance (ANOVA) was utilized to test the differences in means of cell survival rate and the mRNA expression level of genes (p < 0.05), respectively. Turkey test was performed when ANOVA test indicated statistical significance.

Results

Cell viability test

In order to determine the acute toxic effect of 1,4-BQ on mouse bone marrow cells and provide a reference for choosing the exposure concentration of 1,4-BQ for subsequent studies on the expression level and methylation status, we observed the survival rate of cells exposed to 0, 0.1, 1, 5, 10, 20, 40 μmol/L of 1,4-BQ. 1,4-BQ exhibited a dose-dependent toxicity to mouse bone marrow cells (Figure 1). The cell survival rate decreased with increasing 1,4-BQ concentration. The median lethal concentration (LC₅₀) was 8.3 μmol/L (95% confidence interval [CI]: 4.6–10.6 μmol/L).

Figure 1.

The effect of vigor on mouse marrow cells expo-sed to 1,4-benzoquinone (1,4-BQ). One-way analysis of variance (ANOVA) was used to analyze the difference in the five groups. Compared with normal cells, 10, 20, and 40 μmol/L were considered statistically significant. **p < 0.01.

Expression level

Using real-time PCR, we observed that both p15 and p16 mRNA expression levels were downregulated by increasing the exposure concentration of 1,4-BQ. The decline in p15 and p16 was 57% (p < 0.01) and 66% (p < 0.01) in the highest concentration group, respectively. Compared with the control group, 1 μmol/L (p < 0.05) and 10 μmol/L (p < 0.01) treated groups were considered statistically significant in p15 (Figure 2A), and 10 μmol/L (p < 0.01) treated groups were statistically significant in p16 (Figure 2B).

Figure 2.

The mRNA expression level of p15 and p16 in 1,4-benzoquinone (1,4-BQ)-treated mouse marrow bone cells by real-time PCR. (A) The mRNA expression level of p15. (B) The mRNA expression level of p16. The cells were treated with 0, 0.1, 1, and 10 μmol/L of 1,4-BQ for 24 h. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control to normalize the expression levels. The data were typical example of three independent experiments; the data were analyzed with ΔΔCT method. The expression of p15 was 43% in 10 μmol/L of 1,4-BQ. Compared with the control group, the largest expression of p16 decline (10 μmol/L) was 66%. Statistically significant comparison with the control, *p < 0.05, **p < 0.01.

The prediction of CpG islands, amplification, and sequencing

Results of the prediction of the CpG islands of p15 and p16 show three CpG islands from −1786 to 300 (2087 bp) including a total of 56 CpG sites in the p15 promoter regions (Figure 3A). One CpG island was predicted in p16 from −1221 to –906 (2127 bp), including 21 CpG sites (Figure 3B). The p15 was amplified by performing the PCR twice, with a product size of 375 and 331 bp, including all three CpG islands. One island of p16 was amplified by performing the PCR once.

Figure 3.

The CpG islands in p15 and P16 promote region. CpG islands of p15 and p16 were predicted by ‘MethPrimer,’ an online program to design primers for methylation-specific PCR (MSP) and bisulfite sequencing PCR. (A) Predicted CpG islands of p15, three CpG islands can be observed in p15 promoter regions from −1786 to –300 (2087 bp). CpG island 1: 111 bp (−399 to −289 bp): CpG island 2: 221 bp (−277 to –57 bp); CpG island 3: 269 bp(−48 to 221 bp). (B) Predicted CpG island of p16, one CpG island can be observed in p16 promoter regions from −324 to −99. The product size was 285 bp. —: DNA sequence; Ö: CpG island; Ξ: exon.

BSP products, 5 μl, were loaded to 2% agarose gels, with a product size similar to that of the target products. All electrophoretic bands were specific and clear. The BSP products were purified and sequenced. The results of sequencing showed that all 56 CpG sites in the p15 promoter region for both the exposure groups and the control groups were unmethylated (Figure 4A). The same results were obtained for the 21 CpG sites in the p16 promoter region (Figure 4B). These results suggest that the methylation patterns of p15 and p16 were not influenced by the 1,4-BQ treatment. The sequencing results of the methylation mouse DNA standard sequence showed that the bisulfite modification results are reliable.

Figure 4.

Primary and bisulfate-treated CpG islands sequ-ences of the p15 and p16 promoter in mouse marrow bone cells. CpG dinucleotides are numbered and marked in yellow. Primer sequences are underlined. Upper strands are the primary nucleotide sequences and lower strands are bisulfate-treated nucleotide sequences of p15 and p16. (A) Nucleotide sequence of p15 CpG islands (from −399 to 221), where 56 CpG sites were unmethlylated. (B) Nucleotide sequences of p16 CpG island (from −324 to −99), where 21 CpG sites were unmethylated.

Discussion

The bone marrow is the target organ of benzene toxicity, 1,4-BQ is an active metabolite of benzene.²⁵ Benzene exposure can induce leukopenia, myelodysplastic syndromes, and aplastic anemia.²⁶ The inactivation of tumor suppressor genes is a critical event in the development of all common forms of human cancer.²⁷ This inactivation is often associated with DNA methylation.^28,29 DNA methylation, one of the most important epigenetic events, is a biological process where CH₃ is added to the 5 positions of the cytosine pyrimidine ring under the function of DNA methyltransferases (DNMTs),³⁰ which mostly occurs at the CpG islands in promoter regions. A decreased expression level of several tumor suppressor genes has been reported to be associated with the DNA methylation of their promoter regions,^31,32 such as the DNA hypermethylation of p15 and p16 genes in leukemia.³³

In the current study, although the cells were treated with 0, 0.1, 1, and 10 μmol/L for 24 h and did not appear to influence the methylation status, we observed that the statistically significant mRNA expression decreases in p15 and p16. This implied that potential carcinogenic risk may also exist, despite the short-time exposure to 1,4-BQ. In 2007, Bollati et al.²¹ discovered that hypermethylation in p15 was associated with very low benzene exposures (∼22 ppb), in healthy subjects including gas station attendants and traffic police officers, although the corresponding effects on methylation were very low. In 2010, Xing et al.²² observed that the mRNA expression levels of p15 and p16 in workers with benzene poisoning were lower than those of healthy workers in the same factory (control groups), and that the average methylation level of p16 is higher in the benzene-poisoning group compared with the controls. These studies provided that benzene could negatively affect the mRNA expression of p15 and p16 through DNA methylation. Analyzing the differences among the three research. Studies by Bollati et al. and Xing et al. belong to the epidemiology research, benzene exposure was mixed with air pollutants exposure in both the studies. Thus, their results may have not excluded the influence of other air pollutants, such as CO, SO₂, polycyclic aromatic hydrocarbons, and so on. In our study, we used analytically pure 1,4-BQ, which can remove the effects of other pollutants, and proved that benzene could induce the decrease in p15 and p16 mRNA expressions. With regard to the difference between the methylation status of these two genes, the subjects of the studies on the gas station attendants, traffic police officers, and benzene poisoning were all chronically exposed to benzene, whereas the 1,4-BQ exposed cells for 24 h was a short-time treatment. There are studies that consider DNA methylation to be closely related to gene expression silence. DNA methylation is the result of gene silence but does not cause gene silence.³⁴ For instance, the genes of a retrovirus were closed after being infected for 2 days, whereas the corresponding promoter was in the state of methylation until 15 days later. This shows that gene silence generally occurs before DNA methylation.^35,36 In our study, acute exposure to 1,4-BQ was done over a short period of time, 24 h may not be enough for the p15 and p16 to proceed to the methylation status.

This article analyzed the mRNA expression levels of p15 and p16 and the methylation status in 1,4-BQ-treated primary cultivated mouse bone marrow cells in vitro. We found that 1,4-BQ induced the decreased expression of p15 and p16 despite the short-time exposure process. However, the promoter methylation status of the two genes did not change. The results suggest that the p15 and p16 expression changes observed were not caused by methylation changes. Nevertheless, the concrete mechanism of 1,4-BQ responsible for the decreased expression of p15 and p16 remains still unknown. Further investigations are required to define the underlying mechanisms better.

Footnotes

This research was supported by the National Natural Science Foundation of China (No. 30972510) and the Scientific and Technological Project of Wenzhou (No. Y20090104).

References

Molinini

Mera

Pavone

Liso

. Aplastic anemia in a young coke plant worker. Int Arch Occup Environ Health 1997; 69: 144–146.

Tompa

Jakab

Major

. Risk management among benzene-exposed oil refinery workers. Int J Hyg Environ Health 2005; 208: 509–516.

Brugnone

Perbellini

Romeo

Bianchin

Tonello

Pianalto

Benzene in environmental air and human blood. Int Arch Occup Environ Health 1998; 71: 554–559.

Crosignani

Tittarelli

Borgini

Codazzi

Rovelli

Porro

Childhood leukemia and road traffic: a population-based case-control study. Int J Cancer 2004; 108: 596–599.

Johnson

Langard

Lin

. A critique of benzene exposure in the general population. Sci Total Environ 2007; 374: 183–198.

Shiga

Suzuki

Yamamoto

. Hydroquinone, a benzene metabolite, induces Hog1-dependent stress response signaling and causes aneuploidy in Saccharomyces cerevisiae . J Radiat Res (Tokyo) 2010; 51: 405–415.

Kerzic

Liu

Pan

Zhou

Schnatter

Analysis of hydroquinone and catechol in peripheral blood of benzene-exposed workers. Chem Biol Interact 2010; 184: 182–188.

Snyder

. Recent developments in the understanding of benzene toxicity and leukemogenesis. Drug Chem Toxicol 2000; 23: 13–25.

Huff

. Benzene-induced cancers: abridged history and occupational health impact. Int J Occup Environ Health 2007; 13: 213–221.

10.

Yin

. Progress of epidemiological and molecular epidemiological studies on benzene in China. Ann N Y Acad Sci 2006; 1076: 800–809.

11.

Brosselin

Rudant

Orsi

Leverger

Baruchel

Bertrand

Acute childhood leukaemia and residence next to petrol stations and automotive repair garages: the ESCALE study (SFCE). Occup Environ Med 2009; 66: 598–606.

12.

Whysner

Reddy

Ross

Mohan

Lax

. Genotoxicity of benzene and its metabolites. Mutat Res 2004; 566: 99–130.

13.

Hartwig

. The role of DNA repair in benzene-induced carcinogenesis. Chem Biol Interact 2010; 184: 269–272.

14.

Gao

Zuo

Song

Guo

Tian

. Epigenetic modification involved in benzene-induced apoptosis through regulating apoptosis-related genes expression. Cell Biol Int 2011; 35: 391–396.

15.

Zhang

Peng

Ren

McHale

Smith

. A comparison of the cytogenetic alterations and global DNA hypomethylation induced by the benzene metabolite, hydroquinone, with those induced by melphalan and etoposide. Leukemia 2010; 24: 986–991.

16.

Krug

Ganser

Koeffler

. Tumor suppressor genes in normal and malignant hematopoiesis. Oncogene 2002; 21: 3475–3495.

17.

Kostka

Urbanek

Ludwicki

. The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver. Toxicology 2007; 239: 127–135.

18.

Guo

Taki

Ohnishi

Piao

Tabuchi

Bessho

Hypermethylation of p16 and p15 genes and RB protein expression in acute leukemia. Leuk Res 2000; 24: 39–46.

19.

Hannon

Beach

. p15INK4B is a potential effector of TGF-beta-induced cell cycle arrest. Nature 1994; 371: 257–261.

20.

Guillerm

Gyan

Wolowiec

Facon

Avet-Loiseau

Kuliczkowski

p16(INK4a) and p15(INK4b) gene methylations in plasma cells from monoclonal gammopathy of undetermined significance. Blood 2001; 98: 244–246.

21.

Bollati

Baccarelli

Hou

Bonzini

Fustinoni

Cavallo

Changes in DNA methylation patterns in subjects exposed to low-dose benzene. Cancer Res 2007; 67: 876–880.

22.

Xing

Wang

Tian

Yin

Methylation and expression analysis of tumor suppressor genes p15 and p16 in benzene poisoning. Chem Biol Interact 2010; 184: 306–309.

23.

Herman

Graff

Myohanen

Nelkin

Baylin

. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996; 93: 9821–9826.

24.

Dahiya

. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002; 18: 1427–1431.

25.

Ahmad Khan

. Benzene’s toxicity: a consolidated short review of human and animal studies. Hum Exp Toxicol 2007; 26: 687–696.

26.

Bayliss

Sonawane

. Issues for discussion: benzene-induced leukemia—human studies. J Toxicol Environ Health A 2000; 61: 467–470

27.

Cui

Wakai

Shirai

Yokoyama

Hatakeyama

Hirano

. Arsenic trioxide inhibits DNA methyltransferase and restores methylation-silenced genes in human liver cancer cells. Hum Pathol 2006; 37: 298–311.

28.

Herman

Baylin

. Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 2003; 349: 2042–2054.

29.

Feinberg

Tycko

. The history of cancer epigenetics. Nat Rev Cancer 2004; 4: 143–153.

30.

Bird

. DNA methylation patterns and epigenetic memory. Genes Dev 2002; 16: 6–21.

31.

Jones

Laird

. Cancer epigenetics comes of age. Nat Genet 1999; 21: 163–167.

32.

Gao

Zuo

Liu

Guo

Tian

. Methylation of PARP-1 promoter involved in the regulation of benzene-induced decrease of PARP-1 mRNA expression. Toxicol Lett 2010; 195: 114–118.

33.

Yin

Hayes

Linet

Dosemeci

Travis

Benzene Study Group . An expanded cohort study of cancer among benzene-exposed workers in China. Environ Health Perspect 1996; 104: 1339–1341.

34.

Clark

Melki

. DNA methylation and gene silencing in cancer: which is the guilty party? Oncogene 2002; 21: 5380–5387.

35.

Kim

Leonard

. CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. J Exp Med 2007; 204: 1543–1551.

36.

Stengel

Fiebig

Kurth

Denner

. Regulation of human endogenous retrovirus-K expression in melanomas by CpG methylation. Genes Chromosomes Cancer 2010; 49: 401–411.