MiR-32-5p knockdown inhibits epithelial to mesenchymal transition and renal fibrosis by targeting SMAD7 in diabetic nephropathy

Abstract

Diabetic nephropathy (DN) is primary cause of end-stage renal disease. A previous study has shown that miR-32-5p (miR-32) is highly expressed in kidney tissue during chronic allograft dysfunction with interstitial fibrosis and tubular atrophy. However, the role of miR-32-5p (miR-32) in DN is still unclear. In this study, streptozotocin-induced DN rat models and high glucose (HG)-incubated human kidney proximal tubular epithelial (HK-2) cells were established to investigate the role and underlying mechanisms of miR-32 in DN. Results of real-time PCR revealed that miR-32 levels were greatly increased in DN rats and HG-incubated HK-2 cells. Downregulation of miR-32 effectively relieved HG-induced autophagy suppression, fibrosis, epithelial-mesenchymal transition (EMT) and inflammation in HK-2 cells. Besides, miR-32 overexpression significantly down-regulated the expression of mothers against decapentaplegic homolog 7 (SMAD7), whereas knockdown of miR-32 markedly up-regulated the level of SMAD7. Dual-luciferase reporter gene assay confirmed that SMAD7 was a target of miR-32. Reintroduction of SMAD7 expression rescued miR-32-induced HK-2 cells autophagy suppression, EMT and renal fibrosis. Our findings indicate that miR-32 may play roles in the progression of EMT and fibrosis in DN.

Keywords

Diabetic nephropathy miR-32-5p mothers against decapentaplegic homolog 7 fibrosis epithelial-mesenchymal transition

Introduction

Diabetic nephropathy (DN) is one of the most common microvascular complications of diabetes, which is the primary reason of end-stage renal disease worldwide.¹ Approximately 30% of patients with type Ⅰ diabetes and 40% of patients with type Ⅱ diabetes ultimately develop DN. Notably, many macrovascular complications, such as atherosclerosis, hypertension and stroke, are associated with the presence of DN. The mortality caused by DN rose by 94% from 1990 to 2012.^2,3 The typical features of DN include glomerular hyperfiltration and hyperperfusion, mesangial matrix expansion and hypertrophy, glomerular basement membrane thickening, as well as accumulation of extracellular matrix (ECM) proteins, thereby leading to glomerulosclerosis, tubulointerstitial inflammation, fibrosis, and even renal failure.⁴ Despite great advances in DN treatment, the pathogenesis of DN is still elusive. Therefore, widespread innovation is necessary to improve health conditions for patients with DN.

microRNAs (miRNAs, miRs) are a class of small noncoding RNAs of approximate 19–24 nucleotides in length. Mature miRNAs bind to the 3′-untranslated regions (3′-UTRs) within target messenger RNAs (mRNAs), thereby directing mRNA degradation and/or inhibiting translation.⁵ miRNAs play substantial roles in the cell cycle, proliferation, apoptosis, differentiation and gene regulation.⁶ Growing evidence suggests that miRNAs are involved in diabetes.^7,8 miR-32-5p (miR-32) is a kind of miRNA located on chromosome band Xq26.2. Increased expression of miR-32 was found in type Ⅱ diabetes patients with obesity and streptozotocin (STZ)-induced diabetic rats.^9,10 A previous study revealed that miR-32 level was obviously enhanced in kidney tissue during chronic allograft dysfunction with interstitial fibrosis and tubular atrophy,¹¹ implying that miR-32 may be associated with renal fibrosis. However, the role and underlying mechanisms of miR-32 are elusive in DN.

SMAD7, also namely mothers against decapentaplegic homolog 7, is a key negative regulator of transforming growth factor β (TGFβ) signaling. Multiple studies indicated that SMAD7 exerted a protective role in renal injury.^12
–14 SMAD7 inhibited renal fibrosis by altering expression of TGFβ/SMAD3-regulated miRNAs.¹² Li et al. found that SMAD7 suppressed TGFβ-induced SMAD2 activation with the prevention of collagen synthesis and myofibroblast transformation.¹³ Another study suggested that SMAD7 protected against acute kidney injury through rescuing tubular epithelial cells from the G1 cell cycle arrest.¹⁴ SMAD7 has been found to play a protective role in diabetes and diabetes-related complications.^15,16 Overexpression of SMAD7 attenuated kidney injury in a rat model of diabetes.¹⁵ Besides, SMAD7 alleviated TGFβ-mediated inflammation and fibrotic response in diabetic wound skin.¹⁶ However, it remains unclear whether SMAD7 mediates the role of miR-32 in DN.

In this study, STZ-induced DN rats and high glucose (HG)-incubated human kidney proximal tubular epithelial (HK-2) cells models were established to investigate the role and underlying mechanism of miR-32 in DN.

Methods

Animal model

Six-week-old male Sprague-Dawley (SD) rats (Changsheng, Benxi, China) were used for all experiments. All animal procedures followed the guide for the care and use of laboratory animals and this study was approved by the Experimental Animal Ethics Committee of The Fourth Affiliated Hospital of Harbin Medical University. Rats (n = 24) were randomly divided into two groups. The animals of normal control group (NC, n = 8) received a standard diet and the other animals (n = 16) were fed a high-fat diet (HFD) for 8 weeks. HFD-fed rats received 30 mg/kg STZ (S110910, Aladdin, Shanghai, China) in citrate buffer intraperitoneally, while NC rats were injected with an equal volume of citrate buffer. Blood glucose levels were measured 3 days after injection and rats with random glucose levels ≥16.7 mmol/L were regarded as diabetic.¹⁷ After 4 weeks of hyperglycemia, urine samples after 24 h were collected and rats with urinary microalbumin (UMA) levels ≥30 mg/day were considered to have DN.¹⁷

Cell culture

Human kidney proximal tubular epithelial (HK-2) cells were purchased from Procell (Wuhan, China). Cells were cultured in minimum Eagle’s medium (MEM; PM150455, Procell) supplemented with 10% fetal bovine serum (SH30084.03, Hyclone, Logan, Utah, USA) at 37°C and 5% CO₂. After serum deprivation for 8 h, cells from the normal glucose (NG) group were cultivated in MEM with 5 mmol/L glucose (PB180418, Procell), and cells from the high glucose (HG) group were exposed to 30 mmol/L glucose for 48 h.

Cell transfection

The hsa-miR-32 agomir, hsa-miR-32 antagomir, and their corresponding negative controls (NC) were obtained from GenePharma (Shanghai, China). HK-2 cells were transfected using Lipofectamine 2000 reagent (11668-019, Invitrogen, Carlsbad, California, USA) according to the manufacturer’s protocol. A SMAD7-overexpression pcDNA3.1 plasmid (Vigene, Jinan, China) was cotransfected into HK-2 cells with a miR-32 agomir. An empty pcDNA3.1 vector was regarded as negative control. After 48 h of transfection, RNA and protein were monitored by quantitative Real-time Polymerase Chain Reaction (qRT-PCR) and western blot.

ELISA

Human IL-1β ELISA Kit or human IL-6 ELISA Kit (Uscn, Wuhan, China) was used to assess the effect of miR-32 on inflammation. The assay was carried out according to the instructions of manufacturer.

Dual-luciferase reporter gene assay

The 3′-UTR segments of SMAD7 containing wild type (WT) or mutated type (Mut) miRNA-responsive elements were inserted into the pmirGLO vector (Promega, Madison, USA): SMAD7 3′-UTR WT: 5′-GCATT…TATTGTGCAATGTGT…GAATG-3′; SMAD7 3′-UTR Mut: 5′-GCATT…TATTGACGTTTGTGT…GAATG-3′. Subsequently, the constructs were cotransfected with miR-32 and luciferase reporter plasmid into HK-2 cells in 12-well plates using Lipofectamine 2000 according to the manufacturer’s instructions. Renilla luciferase was applied for normalization. Luciferase activity was detected 48 h after transfection.

qRT-PCR

Total RNA was isolated from the treated tissues and cells with Total RNA Isolating Kit (DP419, Tiangen, Beijing, China) according to the manufacturer’s instructions. Samples of 1 µg total RNA were reverse transcribed into complementary DNA (cDNA) using an RT Primer (Genscript, Nanjing, China) and RNase inhibitor (DP418, Tiangen, Beijing, China). qRT-PCR was carried out using SYBR Green PCR kits (SY1020, Solarbio, Beijing, China) to examine the relative expression levels of miR-32 and SMAD7. The expression of GAPDH was used as an internal control of mRNA level. The expression of U6 was applied as an internal control of miRNA level. The primers are shown in Table 1.

Table 1.

Primers sequenced for PCR.

Source	Primer	Direction	Sequence (5′–3′)
rno	GAPDH	Forward	GTGGAGTCTACTGGCGTCTT
	GAPDH	Reverse	TGCTGACAATCTTGAGGGA
	SMAD7	Forward	ACTGGTGCGTGGTGGCATACT
	SMAD7	Reverse	CCGATCTTGCTCCTCACTTTCTG
	U6	Forward	GATCTCGGAAGCTAAGCAGG
	U6	Reverse	GGTGCAGGGTCCGAGGTAT
	miR-32	Forward	TATTGCACATTACTAAGTTGCA
	miR-32	Reverse	GTGCAGGGTCCGAGGTATTC
hsa	GAPDH	Forward	GACCTGACCTGCCGTCTAG
	GAPDH	Reverse	AGGAGTGGGTGTCGCTGT
	SMAD7	Forward	CAACCGCAGCAGTTACCC
	SMAD7	Reverse	GTCGAAAGCCTTGATGGAGA
	U6	Forward	GCTTCGGCAGCACATATACT
	U6	Reverse	GGTGCAGGGTCCGAGGTAT
	miR-32	Forward	TATTGCACATTACTAAGTTGCA
	miR-32	Reverse	GTGCAGGGTCCGAGGTATTC

Western blot

Cells were lysed for 5 min in ice-cold RIPA buffer (R0010, Solarbio, Beijing, China) containing PMSF (P0100, Solarbio). The supernatant was collected after centrifugation at 10000 g for 5 min at 4°C. Equal amounts of protein were separated on 5% sodium dodecyl sulfate-polyacrylamide gel and then transferred onto polyvinylidene fluoride (PVDF; IPVH00010, Millipore, MA, USA) membrane. After blocking in 5% (m/v) skimmed milk (A600669, Sangon Biotech, Shanghai, China) for 1 h at room temperature, the membranes were incubated with primary antibodies against P62 (1: 1000 dilution, #39749, CST, Boston, USA), light chain 3 II/I (LC3 II/I; 1: 1000 dilution, #4108, CST), E-cadherin (1: 500 dilution, #14472, CST), vimentin (1:500 dilution, #5741, CST), α-smooth muscle actin (α-SMA; 1: 500 dilution, 55135-1-AP, Proteintech, Beijing, China), SMAD7 (1: 500 dilution, bs-0566 R, Bioss, Beijing, China), type IV Collagen (Collagen IV; 1:400 dilution, bs-4595 R, Bioss), fibronectin (FN; 1: 400 dilution, bs-0666 R, Bioss), and GAPDH (1: 10000 dilution, 60004-1-Ig, Proteintech) at 4°C overnight. The HRP-conjugated secondary antibodies (SE131/ SE134, Solarbio) at a dilution of 1: 3000 in blocking buffer were incubated for 1 h at 37°C. Blots were then visualized using the ECL system (PE0010, Solarbio). The relative protein levels of interest were normalized to that of GAPDH protein.

Statistical analysis

Data were analyzed using the Graph-pad Prism 8.0. All experiments were performed three times. The unpaired two-tailed Student t-test was used to assess the difference between two groups. For multiple groups’ difference, one-way ANOVA followed by Dunnett test as a post hoc test was used. All results were means the mean ± standard deviation (SD). Values for p ≤ 0.05 were defined as statistically significant.

Results

MiR-32 is upregulated in the kidneys of DN rats

Blood glucose and urinary microalbumin changes in the investigated rats are given in Table 2. After 4 weeks of STZ-induced diabetes, urinary microalbumin had a significant difference between the DN group and the NC group (***p ≤ 0.001), and data revealed a fivefold increase of urinary microalbumin in DN rats (Table 2). As shown in Figure 1(a), miR-32 level was markedly enhanced in kidney of DN rats with respect to NC rats (***p ≤ 0.001). We also found the SMAD7 expression to be greatly downregulated in kidney of DN rats, as evaluated by qRT-PCR (Figure 1(b), ***p ≤ 0.001).

Table 2.

Blood glucose and urinary microalbumin variables in NC and DN rats.^a

Group	Blood glucose (mmol/L)	Urinary microalbumin (mg/day)
NC rats	5.25 ± 0.729	16.315 ± 4.038
DN rats	24.283 ± 2.439^b	82.819 ± 22.337^b

NC: normal control; DN: Diabetic nephropathy.

^a Values are mean ± SD.

^bp < 0.001 versus NC rats.

Figure 1.

Expression of miR-32 in diabetic nephropathy (DN) rats. (a) miR-32 and (b) SMAD7 expression levels were detected by quantitative real-time Polymerase Chain Reaction (qRT-PCR) in kidney of normal control (NC) rats and DN rats (n = 6/group). *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001.

MiR-32 affects fibrosis, EMT, inflammation and autophagy in HG-incubated HK-2 Cells

Having determined that DN induced miR-32 expression in kidney of rats, we assessed whether exposure to HG milieu affected miR-32 expression in HK-2 cells. Compared with exposure to NG, miR-32 content was significantly enhanced in HG milieu (Figure 2(a), ***p ≤ 0.001). MiR-32 was highly expressed in NG-treated HK-2 cells after using hsa-miR-32 agomir transfection (***p ≤ 0.001). However, miR-32 level was markedly lower when HK-2 cells were transfected with a hsa-miR-32 antagomir (Figure 2(b), ***p ≤ 0.001). The results of western blot showed that miR-32 overexpression significantly upregulated the levels of Col IV and FN in HG-incubated HK-2 cells (Figure 2(c), **p ≤ 0.01, ***p ≤ 0.001), while silencing of miR-32 downregulated their levels (Figure 2(d), ***p ≤ 0.001). Changes of EMT markers were further explored in HK-2 cells after HG treatment. E-cadherin expression levels were greatly decreased in HG and hsa-miR-32 agomir (HG + hsa-miR-32 agomir) treatment group but were increased in HG + hsa-miR-32 antagomir group (Figure 2(e) and (f), **p ≤ 0.01, ***p ≤ 0.001). In contrast to the E-cadherin expression, miR-32 overexpression upregulated the expression level of vimentin and α-SMA, and silencing of miR-32 downregulated the vimentin and α-SMA expression. Besides, miR-32 overexpression obviously promoted the protein expression of IL-6, IL-1β and P62 in HG-incubated HK-2 cell, while knockdown of miR-32 significantly inhibited these protein expression (Figure 2(g) to (i), *p < 0.05, **p ≤ 0.01, ***p ≤ 0.001). Furthermore, the ratio of LC3 II to LC3 I greatly decreased after overexpression of miR-32, but the ratio of LC3 II to LC3 I was restored after miR-32 silencing (Figure 2(i), ***p ≤ 0.001).

Figure 2.

MiR-32 expression in human kidney proximal tubular epithelial (HK-2) cells. (a) HK-2 cells were exposed to either normal (5 mM NG) or high (30 mM HG) glucose concentrations for 48 h. MiR-32 levels were detected by qRT-PCR. (b) qRT-PCR was used to assess expression of miR-32 transfected with either miR-32 agomir or antagomir. After miR-32 agomir/antagomir transfection, protein expression levels of (c and d) type IV Collagen (Collagen IV) and fibronectin (FN), (e and f) α-smooth muscle actin (α-SMA), E-cadherin and vimentin, (h and i) LC3 II/I and P62 were determined by western blot in HG HK-2 cells. (g) The protein expression levels of IL-6 and IL-1β. Error bars represent SD (n = 3/group). *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001.

SMAD7 is a target of miR-32

Next, we assessed the regulation of SMAD7 by miR-32 in HK-2 cells under NG condition. Overexpression of miR-32 by transfection with miR-32 agomir, in comparison to miR-32 agomir NC group, extremely reduced SMAD7 mRNA levels, whereas silencing of miR-32 transfected by miR-32 antagomir obviously enhanced SMAD7 mRNA levels (Figure 3(a), ***p ≤ 0.001). These results were also confirmed in western blot (Figure 3(b) and (c), ***p ≤ 0.001), which supported our assumption that SMAD7 may be a target of miR-32. To confirm these results, we predicted the miR-32 potential binding site through TargetScan (http://www.targetscan.org). The 3′-UTR of SMAD7 exactly matched the sequence of miR-32 (Figure 3(d)). We fused the WT or the MUT 3′-UTR of SMAD7 to a luciferase reporter gene. Luciferase activity was greatly decreased in miR-32 agomir transfected HK-2 cells with constructs containing the WT 3′-UTR of SMAD7 compared with agomir-transfected NC group. However, luciferase activity was not changed when the 3′-UTR of SMAD7 bore mutations at the miR-32 binding site (**p ≤ 0.01).

Figure 3.

SMAD7 as a target of miR-32 in HK-2 cells exposed to HG. (a) qRT-PCR was used to detect the SMAD7 mRNA level by transfection with miR-32 agomir or antagomir. (b and c) Protein levels of SMAD7 after transfection with (b) miR-32 agomir and (c) miR-32 antagomir were determined by western blotting. (d) Left runnel: predicted consequential pairing of SMAD7 target region and miR-32 (http://www.targetscan.org); right runnel: luciferase activity of SMAD7 targeting miR-32 after overexpression of miR-32 by transfection with miR-32 agomir in comparison to NC with either wild-type or mutated 3′-UTR of SMAD7 (n = 3/group). *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001.

SMAD7 overexpression alleviates fibrosis and EMT induced by miR-32

After we determined the role of miR-32 on fibrosis, EMT, inflammation and autophagy, we further investigated the underlying mechanism. The protein level of SMAD7 by transfection with SMAD7-overexpression plasmid was markedly upregulated compared with parental and empty vector groups (Figure 4(a), ***p ≤ 0.001). Next, SMAD7-overexpression plasmid was cotransfected into HK-2 cells with miR-32 agomir to assess the function of SMAD7. The results of western blot showed that the protein expression level of FN was significantly lower under HG condition in miR-32 agomir + SMAD7 group compared to those in miR-32 agomir + vector group, whereas the levels of E-cadherin and LC3 II/I were greatly increased (Figure 4(b), **p ≤ 0.01, ***p ≤ 0.001).

Figure 4.

MiR-32 alleviates fibrosis, inflammation and autophagy by the SMAD7 pathway. (a) Western blotting analysis was used to determine the protein level of SMAD7 after transfection with SMAD7-overexpression plasmid. (b) SMAD7-overexpression plasmid was cotransfected into HK-2 cells with miR-32 agomir. The protein levels of FN, E-cadherin and LC3 II/I were detected by western blotting (n = 3/group). *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001.

Discussion

There is growing interest in the role of miRs among people in chronic diseases, including diabetic complications. MiRs mediate post-transcriptional regulation of genes through inhibiting target gene mRNA translation.^18,19 In this study, we find miR-32 levels to be greatly upregulated in STZ-induced DN rat kidneys. In line with the findings in DN rats, increased miR-32 was also observed in vitro models of DN. These results show that miR-32 has an unfavorable effect on renal function and might be used to reflect the severity of renal fibrosis in DN. MiR-32 can be efficiently expressed in HK-2 cells by using miR-32 agomir, whereas miR-32 is significantly downregulated after miR-32 antagomir transfection. A previous study has found pharmacological miR-21 silencing can extremely alleviate fibrosis and ameliorate the injury of nephropathy via stimulating metabolic pathways.⁸ Consisted with this finding, our study reveals that knockdown of miR-32 significantly decreases the levels of Col IV and FN. Downregulated Col IV and FN expression reduces the deposition of ECM in DN and thereby attenuates fibrosis.²⁰

EMT serves an important role in the progression of fibrogenesis. During EMT, epithelial cells lose the intrinsic characteristics and induce expression and phenotypic changes of mesenchymal markers thus produce more fibroblast-like cells.²¹ Tubular fibroblasts usually are induced to myofibroblasts due to the loss of epithelial marker expression and activation of mesenchymal markers.²² Several miRs have been reported as fibrosis promoters and underlying prognostic markers in diabetes or diabetes-related complications, such as miR-27a and miR-135a.^23,24 Li et al. found that the pathological silencing of miR-32 could improve hepatic fibrosis.²⁵ However, there was no direct evidence to support the role of miR-32 in DN fibrosis. In this study, we observe that miR-32 overexpression potentiates EMT process in HG-incubated HK-2 cells, exhibited by the upregulation of α-SMA and vimentin expressions as well as the downregulation of E-cadherin expression. In contrast, a decreased α-SMA and vimentin expression as well as an increased E-cadherin expression are induced by miR-32 silencing. These findings imply that miR-32 silencing may mitigate the degree of EMT in DN. To elucidate the potential molecular mechanisms by which miR-32 involves in the progression of DN, TargetScan and dual-luciferase reporter gene assay are used to confirm SMAD7 as a target gene of miR-32. SMAD7 is a suppressive member of the SMAD family, who participates in the TGFβ/SMAD signaling pathway.²⁶ A previous study has revealed the protective role of SMAD7 in diabetic kidney disease and overexpression of SMAD7 can efficiently reduce diabetic renal injury.¹⁵ Besides, overexpression of SMAD7 in nephropathy is known to inhibit renal fibrosis.¹² The current study finds that reintroduction of SMAD7 expression rescues miR-32-induced HK-2 cells EMT and renal fibrosis. These results indicate that miR-32/SMAD7 axis can regulate the progress of fibrosis and EMT in DN.

MiR-32 overexpression results in an obvious upregulation of IL-1β and IL-6 levels in HG-treated HK-2 cells. However, silencing of miR-32 inhibits the release of the above inflammatory cytokines, which is in line with a previous study.²⁷ Our results imply the inhibitory effect of miR-32 silencing on inflammation in DN. In addition, autophagy is a biological regulatory process to maintain metabolic homeostasis.²⁸ Multiple studies have demonstrated that miRNAs serve as important players in the regulation of autophagy and are involved in DN.^29,30 However, the role of miR-32 on autophagy in DN was unknown. Changes in autophagy are examined by microtubule-associated protein LC3. LC3 is located on the membrane of autophagosomal and is composed of cytosolic LC3 I and membrane-bound LC3 II. In the present study, miR-32 overexpression significantly downregulates LC3 II/I levels and upregulates P62 level, thereby inhibiting autophagy. The conversion of water soluble LC3 I to the autophagosome-associated lipidated form (LC3 II) and the degradation of P62 are observed with the knockdown of miR-32. Combined with the results of LC3 II/I and P62, we think that autophagy is suppressed by miR-32 overexpression in HG-cultured HK-2 cells, whereas knockdown of miR-32 reverses autophagy. These data are in agreement with the results using renal mesangial cells.¹⁷ As miR-32 overexpression inhibits autophagy in HG-cultured HK-2 cells, we speculate that miR-32 may be involved in the regulation of autophagy in DN. A previous report shows that miR-22 promotes renal tubulointerstitial fibrosis and inhibits autophagy by targeting PTEN in DN.²⁹ As shown in our study, miR-32 overexpression contributes to autophagy suppression and fibrosis in HG-cultured HK-2 cells, whereas overexpression of SMAD7 protectively antagonizes HG- and miR-32-induced autophagy suppression and fibrosis. Therefore, our findings indicate that silencing of miR-32 may induce autophagy and attenuate fibrosis by targeting SMAD7 in DN.

In summary, miR-32 is upregulated in kidneys of DN rats and HG-incubated HK-2 cells. Overexpression of miR-32 inhibits autophagy and promotes fibrosis, EMT and inflammation, whereas the knockdown of miR-32 effectively relieved HG-induced autophagy suppression, fibrosis, EMT and inflammation in HK-2 cells. Reintroduction of SMAD7 expression protectively antagonized HG- and miR-32-induced autophagy suppression, EMT and fibrosis. Although additional exploration is still required, our study indicates that miR-32 may play roles in the process of EMT and fibrosis in DN via targeting SMAD7.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by a grant from the Natural Science Foundation of Heilongjiang Province (No. LH2020H064).

ORCID iD

H-J Wang

References

Raptis

Viberti

. Pathogenesis of diabetic nephropathy. Exp Clin Endocrinol Diabetes 2001; 109(Suppl 2): S424–S437.

Saran

Robinson

, et al. US Renal Data System 2014 annual data report: epidemiology of kidney disease in the United States. Am J Kidney Dis 2015; 66: Svii, S1–S305.

Reutens

. Epidemiology of diabetic kidney disease. Med Clin North Am 2013; 97: 1–18.

Dronavalli

Duka

Bakris

. The pathogenesis of diabetic nephropathy. Nat Clin Pract Endocrinol Metab 2008; 4: 444–452.

Bartel

. MicroRNAs: target recognition and regulatory functions. Cell 2009; 136: 215–233.

Bartel

. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116: 281–297.

Wang

Yin

, et al. MiR-320a induces diabetic nephropathy via inhibiting MafB. Aging (Albany NY) 2019; 11: 3055–3079.

Kolling

Kaucsar

Schauerte

, et al. Therapeutic miR-21 silencing ameliorates diabetic kidney disease in mice. Mol Ther 2017; 25: 165–180.

Jones

Danielson

Benton

, et al. miRNA signatures of insulin resistance in obesity. Obesity (Silver Spring) 2017; 25: 1734–1744.

10.

Lin

, et al. High glucose promotes hepatic fibrosis via miR-32/MTA3-mediated epithelial-to-mesenchymal transition. Mol Med Rep 2019; 19: 3190–3200.

11.

Scian

Maluf

David

, et al. MicroRNA profiles in allograft tissues and paired urines associate with chronic allograft dysfunction with IF/TA. Am J Transplant 2011; 11: 2110–2122.

12.

Chung

Dong

Yang

, et al. Smad7 suppresses renal fibrosis via altering expression of TGF-beta/Smad3-regulated microRNAs. Mol Ther 2013; 21: 388–398.

13.

Zhu

Huang

, et al. Smad7 inhibits fibrotic effect of TGF-beta on renal tubular epithelial cells by blocking Smad2 activation. J Am Soc Nephrol 2002; 13: 1464–1472.

14.

Tang

Huang

, et al. Smad7 protects against acute kidney injury by rescuing tubular epithelial cells from the G1 cell cycle arrest. Clin Sci (Lond) 2017; 131: 1955–1969.

15.

Chen

Huang

Wang

, et al. The protective role of Smad7 in diabetic kidney disease: mechanism and therapeutic potential. Diabetes 2011; 60: 590–601.

16.

Bian

Iriyama

, et al. Smad7 ameliorates TGF-beta-mediated skin inflammation and associated wound healing defects but not susceptibility to experimental skin carcinogenesis. J Invest Dermatol 2019; 139: 940–950.

17.

Wang

Han

, et al. Triptolide restores autophagy to alleviate diabetic renal fibrosis through the miR-141-3p/PTEN/Akt/mTOR pathway. Mol Ther Nucleic Acids 2017; 9: 48–56.

18.

Sataranatarajan

Feliers

Mariappan

, et al. Molecular events in matrix protein metabolism in the aging kidney. Aging Cell 2012; 11: 1065–1073.

19.

Tian

, et al. miR-137 prevents inflammatory response, oxidative stress, neuronal injury and cognitive impairment via blockade of Src-mediated MAPK signaling pathway in ischemic stroke. Aging (Albany NY) 2020; 12: 10873–10895.

20.

Miller

Pozzi

Zent

, et al. Effects of high glucose on integrin activity and fibronectin matrix assembly by mesangial cells. Mol Biol Cell 2014; 25: 2342–2350.

21.

Liu

. New insights into epithelial-mesenchymal transition in kidney fibrosis. J Am Soc Nephrol 2010; 21: 212–222.

22.

Garcia-Sanchez

Lopez-Hernandez

Lopez-Novoa

. An integrative view on the role of TGF-beta in the progressive tubular deletion associated with chronic kidney disease. Kidney Int 2010; 77: 950–955.

23.

Shi

Tian

Liu

, et al. MicroRNA-27a targets Sfrp1 to induce renal fibrosis in diabetic nephropathy by activating Wnt/beta-catenin signalling. Biosci Rep 2020; 40: BSR20192794.

24.

Zhang

Wang

Yang

, et al. MiR-135a regulates renal fibrosis in rats with diabetic kidney disease through the Notch pathway. Eur Rev Med Pharmacol Sci 2020; 24: 1979–1987.

25.

Lin

, et al. High glucose promotes hepatic fibrosis via miR-32/MTA3-mediated epithelial-to-mesenchymal transition. Mol Med Rep 2019; 19: 3190–3200.

26.

Loboda

Sobczak

Jozkowicz

, et al. TGF-beta1/Smads and miR-21 in renal fibrosis and inflammation. Mediators Inflamm 2016; 2016: 8319283.

27.

Zhao

Zhang

Qiu

, et al. MiRNA-337 leads to podocyte injury in mice with diabetic nephropathy. Eur Rev Med Pharmacol Sci 2019; 23: 8485–8492.

28.

Ding

Choi

. Regulation of autophagy by TGF-beta: emerging role in kidney fibrosis. Semin Nephrol 2014; 34: 62–71.

29.

Zhang

Zhao

, et al. MicroRNA-22 promotes renal tubulointerstitial fibrosis by targeting PTEN and suppressing autophagy in diabetic nephropathy. J Diabetes Res 2018; 2018: 4728645.

30.

Sun

Zhang

, et al. Repression of miR-217 protects against high glucose-induced podocyte injury and insulin resistance by restoring PTEN-mediated autophagy pathway. Biochem Biophys Res Commun 2017; 483: 318–324.