Differential Ability of Somatic Stem Cells

Isolation and Culture of Mouse Adipose Tissue-Derived Stem/Progenitor Cells

Subcutaneous adipose tissue was obtained from 8-week-old adult mice (CLEA Japan, Inc. Meguro, Tokyo). Mouse studies were approved by the review committee of Nagoya University Graduate School of Medicine. Adipose tissue (0.5 g) was washed three times with Hank's balanced salt solution, cut finely, and digested with 1 ml of 1 mg/ml type I collagenase (Collagenase Type I, 274 U/mg, Koken Co., Ltd., Tokyo, Japan) for 1 h at 37°C in a water bath with reciprocal shaking. Cells obtained after filtering the digested tissue through 250-μm meshes were suspended in Dulbecco's modified Eagle's medium (DMEM)/F12 containing 20% fetal bovine serum (FBS: Trace Scientific Ltd., Melbourne, Australia, Uin: 53141 Lot: B01249-500) and centrifuged at 1200 rpm for 5 min at room temperature. The sedimentary cell layer was collected. Suspension and centrifugation of the sedimentary cells were repeated three times before culturing.

For the attached culture, 1 × 10⁵ adipocytes (sedimentary cells) were seeded into a T-25 flask (NUNC) with DMEM/F12 containing 20% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin at 37°C in a humidified atmosphere of 5% CO₂. Cells were allowed to attach and spread, and were passaged two to three times.

Adipogenic Differentiation

Adipogenic differentiation was induced by culturing the cells for 1 week in DMEM (high glucose) containing 100 μM indometacin, 1 μM dexamethasone, 1 μM hydrocortisone, 10 μg/ml insulin, and 10% FBS. The cells were cultured further in DMEM (high glucose) containing 10% FBS for 1 week. Differentiation was confirmed by Oil Red O staining of intracellular lipid droplets. For Oil Red O staining, the cells were fixed in a 10% solution of formaldehyde in PBS for at least 10 min, washed with 60% isopropanol, and stained with Oil Red O solution for 10 min followed by repeated washing with water. They were then destained in 100% isopropanol for 1 min.

Osteogenic Differentiation

Osteogenic differentiation was induced by culturing the cells for 1 week in DMEM containing 200 μM dexamethasone, 50 μM ascorbate-2-phosphate, 10 mM β-glycerophosphate, and 10% FBS (17). The differentiation was examined by staining extracellular matrix calcification by von Kossa's method. For von Kossa staining, the cells were stained with a solution containing naphthol AS MX-PO4, N,N-dimethylformamide, Red Violet LB salt, and Tris-HCl (pH 8.3) for 45 min. Von Kossa staining was carried out with 2.5% silver nitrate solution for 30 min.

Induction of ASC Differentiation Into Insulin-Producing Cells (Induction 1)

For induction of differentiation, the cells were seeded at a cell density of 2–3 × 10⁵/well in a six-well plate and cultured for 3 days in ultra-low attachment plates (Vitaris AG, Baar, Switzerland). Differentiation medium consisted of serum-free DMEM/F12 medium with 17.5 mM glucose in the presence of nicotinamide 10 mM, activin-A 2 nM, exendin-4 10 nM, hepatocyte growth factor 100 pM, and pentagastrin 10 nM (all from Sigma, Basel, Switzerland) as well as B-27 serum-free supplement, N-2 Supplement, and 1% penicillin/streptomycin 5000 U/L (all from Invitrogen) (18).

Induction of ASC Differentiation Into Insulin-Producing Cells (Induction 2)

For induction of differentiation, the cells were seeded at a cell density of 2–3 × 10⁵/well of a six-well plate. Cells were cultured for 24 h with predifferentiation medium and reinduced with differentiation medium for another 10 h. Predifferentiation medium consisted of L-DMEM with 10 mmol/L nicotinamide and 1 mmol/L 2-mercaptoethanol (all from Sigma), 1% penicillin/streptomycin 5000 U/L (Invitrogen), and 20% FBS. Differentiation medium consisted of serum-free H-DMEM with 10 mmol/L nicotinamide and 1 mmol/L 2-mercaptoethanol (all from Sigma), as well as B-27 serum-free supplement, 1% penicillin/streptomycin 5000 U/L (all from Invitrogen) (12).

Isolation and Culture of Mouse Pancreatic Islets and Duct Cells

Islets and pancreatic stem cells were isolated from the pancreata of 8-week-old mice (CLEA Japan, Inc.). Mouse studies were approved by the review committee of Kyoto University Graduate School of Medicine and Nagoya University Graduate School of Medicine. For islet isolation, the common bile duct was cannulated and injected with 2 ml cold M199 medium containing 1.5 mg/ml collagenase (30,31). The islets were separated on a density gradient, hand-picked under a dissecting microscope to ensure a pure islet preparation and used immediately afterward.

Pancreatic stem cells (ductal cell morphology) were isolated using a modified islet isolation method. A previous study showed that, after purification on a Ficoll gradient, the top interface (1.062–1.096 density range) was 50–95% islet cells with varying amounts of duct and degranulated acinar tissue; the middle interface (1.096–1.11 density range) contained 1–15% islets, duct, and degranulated acini; and the pellet was mostly well-granulated acinar tissue with less than 1% islets (8). Therefore, the cells in the top and middle layers were used in this study. After hand-picking islets from the top and middle layers under a dissecting microscope, the remaining cells were stained by dithizone, and the remnant islets were deleted. The duct-rich population after islet isolation was then cultured in DMEM with 10% FBS (BIO-WEST, Inc., Logan, UT, S1560 Lot #SO5094S1560). After cells attached and spread, nonductal cells (fibroblast morphology) were removed mechanically with a rubber scrapper. The “duct-like” cells were then inoculated into 96-well plates, cloned by limiting dilution, and cultured in DMEM with 20% FBS.

Induction for Differentiation From Pancreatic Stem Cells Into Insulin-Producing Cells

For inducing cell differentiation into insulin-producing cells, the cells were cultured in DMEM with 10% FBS, 10 nM exendin-4, 10 mM nicotinamide, 10 ng/ml KGF, 100 nM PDX-1 protein, and 100 nM BETA2/NeuroD protein for 7–10 days. For PDX-1 and BETA2/NeuroD protein, the cDNAs were amplified by PCR using appropriate linker-primers and then subcloned into the NdeI and XhoI sites of pET21b(+) (Novagen, Madison, WI) using a ligation kit (TaKaRa, Tokyo, Japan). BL21 (DE3) cells containing the expression plasmids were grown at 37°C to an OD₆₀₀ of 0.8. Isopropyl-β-D-thiogalactopyranoside was added to a 0.1 mmol/L final concentration, and the cells were then incubated for 12 h at 24°C. Cells were sonicated and the supernatants were recovered and applied to a column of Ni-nitrilotriacetic acid agarose (Invitrogen, San Diego, CA) (28,29,32).

Semiquantitative RT-PCR

Total RNA was extracted from cells using RNeasy Mini Kit (QIAGEN, Tokyo, Japan). After quantifying RNA by spectrophotometry, 2.5 μg of RNA was heated at 85°C for 3 min and then reverse-transcribed into cDNA in a 25-μl solution containing 200 units of Superscript II RNase H-RT (Invitrogen), 50 ng random hexamers (Invitrogen), 160 μmol/L dNTP, and 10 nmol/L dithiothreitol. The reaction consisted of 10 min at 25°C, 60 min at 42°C, and 10 min at 95°C. Polymerization reactions were performed in a Perkin-Elmer 9700 Thermocycler with 3 μl cDNA (20 ng RNA equivalents), 160 μmol/L cold dNTPs, 10 pmol appropriate oligonucleotide primers, 1.5 mmol/l MgCl₂, and 5 units AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, CT). The oligonucleotide primers and cycle number used for semiquantitative PCR are shown in Table 1. The thermal cycle profile used a 10-min denaturing step at 94°C followed by amplification cycles (1 min denaturation at 94°C, 1 min annealing at 57°C, and 1 min extension at 72°C) with a final extension step of 10 min at 72°C. The steps taken to validate these measurements were previously reported (29).

OPEN IN VIEWER

Table 1.

List of Gene-Specific Primers

Gene	Forward/Reverse Primer	Size	Cycles
Insulin 1	ccagctataatcagagacca/gtgtagaagaagccacgct	197	35
Insulin 2	tccgctacaatcaaaaaccat/gctgggtagtggtgggtcta	411	35
PDX-1	cctgcgtgcctgtacatggg/tttccacgcgtgagctttgg	300	40
NeuroD	gcgctcaggcaaaagccc/gccattgatgctgagcggcg	374	30
Pax4	ctgtgtgagcaagatcctag/ggagaagatagtccgattcc	379	40
Pax6	cagtcacagcggagtgaatc/cgcttcagctgaagtcgcat	658	30
Nkx6.1	tcttctggcccggagtgatg/tcctgcttcttcttggccg	313	40
GAPDH	accacagtccatgccatcac/tccaccaccctgttgctgta	452	25

TaqMan Real-Time PCR

Quantification of insulin mRNA levels was carried using the TaqMan real-time PCR system according to the manufacturer's instructions (Applied Biosystems, Foster City, CA, USA). PCR was performed for 40 cycles, preceded by 2 min at 50°C and 10 min at 95°C as initial steps. In each cycle, denaturation was achieved for 15 s at 95°C and annealing/extension was achieved for 1 min at 60°C. PCR was carried out in 20 μ l of solution using cDNAs synthesized from 1.11 ng of total RNA. Standard curves were obtained using cDNAs generated from total RNA isolated from primary mouse islets. For each sample, the expression of insulin was normalized by dividing by the β-actin expression level. Mouse insulin-2 and β-actin primers are commercially available (Assays-on-Demand Gene Expression Products; Applied Biosystems).

Adipose Tissue-Derived Stem/Progenitor Cells

ASCs were isolated from 8-week-old mice (Fig. 1A). To test whether harvested cells had adipogenic differentiation capabilities, the cells were treated with adipogenic induction media for 1 week and then Oil Red O staining was performed. The cells were positive for Oil Red O staining, suggesting that the cells had adipogenic differentiation capabilities (Fig. 1B). To examine whether the harvested cells had osteogenic differentiation capabilities, the cells were treated with osteogenic induction media for 1 week and then von Kossa staining was performed. The cells were positive for von Kossa staining, suggesting that the cell had osteogenic differentiation capabilities (Fig. 1C). These data suggest that the harvested cells included adipose tissue-derived stem/progenitor cells.

OPEN IN VIEWER

Figure 1.

Adipo/osteogenic differentiation of ASCs. (A) Morphology of adipose tissue-derived stem/progenitor cells. (B) Adipogenic differentiation of ASCs. The cell populations were obtained from 8-week-old adult mice. The cells were stained with Oil Red O 1 week after adipogenic induction. (C) Osteogenic differentiation of ASCs. The cell populations were obtained from 8-week-old adult mice. The cells were stained with Von Kossa 1 week after osteogenic induction. Scale bar: 200 μm.

Induction of ASC Differentiation Into Pancreatic β-Cells

To test whether ASCs had the capacity to differentiate into pancreatic β-cells, two different induction protocols that have previously been reported to induce the differentiation into insulin-producing cells from human ASCs (18) or from bone marrow MSCs (12) were performed (Fig. 2B). ASCs formed islet-like clusters after culturing in ultra-low attachment plates using induction protocol 1 (Fig. 2B, left). However, ASCs formed fibroblast-like monolayer that was similar to noninduced ASCs when induction protocol 2 was used (Fig 2B, right). Using semiquantitative RT-PCR, ASCs did not express insulin mRNA using induction protocol 1. Similarly, ASCs did not express insulin mRNA with induction protocol 2. In addition, pancreatic developmental transcriptional factors (such as PDX-1, BETA2/NeuroD, Pax4, Pax6, and Nkx6.1) were not observed in ASCs after either induction method (Fig. 2C). These data suggest that these culture conditions did not induce the differentiation from mouse ASCs into pancreatic β-cells.

OPEN IN VIEWER

Figure 2.

Characterization of ASCs after induction into pancreatic β-cells. (A) ASCs were induced using two separate protocols (induction 1 and nduction 2) to facilitate the differentiation of stem/progenitor cells into insulin-producing cells. (B) Morphology of ASCs after induction 1 and induction 2. Scale bar: 200 μm. (C) Expression of pancreas-related genes in ASCs before and after incubation in induction media. The oligonucleotide primers and cycle numbers used for semiquantitative PCR are shown in Table 1. MIN6 cells were used as a positive control.

Pancreatic Stem Cells

Pancreatic stem cells were isolated as previously reported (33). They formed a flat “cobblestone” monolayer (Fig. 3A) that is characteristic of cultured duct cells. To evaluate whether these cells have the same potential as endodermal stem cells (namely, to differentiate into β-islet cells), pancreatic stem cells were cultured with exendin-4, PDX-1 protein, and BETA2/NeuroD protein for 7–10 days. The treated cells induced the expression of the insulin gene (Fig. 3B) and pancreas-related genes (data not shown), suggesting that the cells could differentiate into pancreatic β-cells.

OPEN IN VIEWER

Figure 3.

Pancreatic stem cells. (A) Morphology of pancreatic stem cells. Scale bar: 100 μm. (B) Insulin mRNA levels from pancreatic stem cells before and after treatment with induction media. Pancreatic stem/progenitor cells were cultured in DMEM with 10% FBS, 10 nM exendin-4, 10 mM nicotinamide, 10 ng/ml KGF, 100 nM PDX-1 protein, and 100 nM BETA2/NeuroD protein for 7–10 days. The expression of insulin-2 mRNA was measured by real-time PCR. Mouse islets were used as a positive control.

Adipo/Osteogenic Differentiation Capabilities of Pancreatic Stem Cells

To test whether pancreatic stem cells had adipogenic differentiation capabilities, the cells were treated with adipogenic induction media for 1 week and then Oil Red O stained. Pancreatic stem cells were negative for Oil Red O staining, suggesting that the cells did not have adipogenic differentiation capabilities (Fig. 4A). To test whether pancreatic stem cells had osteogenic differentiation capabilities, the cells were treated with osteogenic induction media for 1 week and then von Kossa stained. Pancreatic stem cells did not have osteogenic differentiation capabilities (Fig. 4D). These data suggest that pancreatic stem cells are unlikely to differentiate into mesodermal cell type.

OPEN IN VIEWER

Figure 4.

Characterization of pancreatic stem cells after adipo/osteogenic induction. (A, B, C) Adipogenic induction. Pancreatic stem cells (A), ASCs (B; positive control), or MIN 6 cells (C; negative control) were stained with Oil Red O 1 week after adipogenic induction. (D, E, F) Osteogenic induction. Pancreatic stem cells (D), ASCs (E; positive control), or MIN6 cells (F; negative control) were stained with Von Kossa 1 week after osteogenic induction. Scale bar: 200 μm.