Comparative analysis of the bio-safety of HuMSCs and HuMenSCs in the nude mice and their impacts on reproductive organs’ histological morphology

Abstract

The tumorigenesis and long-term bio-function of the implanted mesenchymal stromal cells (MSCs) were needed before clinical applications. We herein observed 7 months and investigated the viable tumors formation, the survival rate, the distribution of the injected cells in different reproductive organs after intravenous (IV) injection of the human menstrual blood–derived MSCs (LXT- and CDH-huMenSCs), and the human umbilical MSCs (huMSCs). The survival rate was not different among the huMenSCs, the huMSCs, and the negative control (IV injection of PBS) group. The longevities of the mice died within the observation period of the LXT and the huMSCs groups were significantly longer than that in the other groups; the positive control (IV injection of LLC (Lewis lung carcinoma cells)) group had the shortest longevity. The number of visible tumors in the huMenSCs, huMSCs, and the negative control group was lower than that in the positive control group. Human-sourced DNA was only detected in the ovaries of the huMSCs-injected mice. The histological morphology of the CDH- group had more normal follicles than that in other groups; the CDH- and the huMSCs group had more atretic follicles than that in other groups. In the huMenSCs and the huMSCs groups, the testis seminiferous tubules were fuller and more orderly arranged than the negative control group. The endometrial thickness of the LXT- group was thicker than that of the huMSCs- and the negative control groups, whereas the number of uterine glands was similar among all groups. The results suggested that IV administrations of xenogeneic huMenSCs and huMSCs in nude mice did not cause tumor formation. The injected huMenSCs from different donors functioned differentially on the mice’s life-span, endometrial thickness, and the number of follicles.

Graphical Abstract

Keywords

huMenSCs huMSCs IV injection nude mice

Introduction

Intravenous (IV) administration of mesenchymal stromal cells (MSCs) had opened a new window to treat several kinds of diseases. The clinical application of the MSCs needed to be specific, pathogen-free, with a normal karyotype, with proven differentiation potency, and no tumorigenicity¹. Menstrual blood, a product of the cyclical shedding of the endometrium², is an accessible, non-invasive, and ethically acceptable clinical source. Compared with MSCs from other sources, human menstrual blood–derived MSCs (huMenSCs) offer advantages such as non-invasive collection, ease of collection, reproducibility, and low immunogenicity. Furthermore, huMenSCs possess the potential for autologous cell reinfusion³. As a convenient source of MSCs, the clinical applications of the huMenSC required rigorous control to ensure full compliance with the principles of good manufacturing practice (GMP).

Although the safety and tumorigenicity of MSCs have been extensively studied, the focus has primarily been on traditional sources such as bone marrow, adipose tissue, and umbilical cord⁴. As a novel MSC source with potential clinical applications, huMenSCs offer advantages such as non-invasiveness, wide availability, and low immunogenicity. While MSCs are generally considered to have low tumorigenicity, their safety still requires comprehensive evaluation in clinical translation. However, systematic studies on the long-term safety, tumorigenicity, and tissue-specific effects of huMenSCs are still lacking. Although clinical trials remain limited, there were two clinical trials of huMenSCs (source: http://www.clinicaltrials.gov, “Menstrual mesenchymal stem cell” queried in November 2024). The applications included those patients with liver cirrhosis (NCT01483248) and with type 1 diabetes (NCT0149339). The academic assessments of the huMenSCs and other MSCs’ application to industrial platforms were very low⁵. Tumorigenicity assay in nude mice was a widely used experiment to monitor tumor growth in vivo^6–8. The absence of a thymus in nude mice severely affected the development of their immune system. T lymphocytes were almost completely absent, reducing their ability to identify and fight infectious pathogens. B lymphocytes were present in these mice, but their development is partially defective. Most common forms of antibodies were not present in nude mice (source: The Jackson Laboratory, 2018)^7,9. Reportedly, MSCs could not only delay aging by repairing damaged tissues, promoting tissue regeneration, and regulating immunity¹⁰ but also extend lifespan through mechanisms such as regulating mitochondrial function, paracrine effects, and preventing telomere shortening^11,12. Notably, the decline in reproductive system function can accelerate the aging process^13,14. Furthermore, the impact of huMenSCs on reproductive system function remains unclear, which is particularly important in clinical applications. Female nude mice began to ovulate and ceased ovulating at around 2 and a half months and 4 months of age, with very low fertility and ovarian stock¹⁵. Thus, the male nude mice were often used in breeding programs with heterozygous females to produce offspring. The lifespan of nude mice ranged from 6 months to a year in standard laboratory conditions. In controlled environments, they can live up to 18 months to 2 years¹⁵.

However, the in vivo tumorigenicity of huMenSCs has not been fully investigated, especially the effects of huMenSCs transplantation on reproductive cell generation and reproductive tissue safety. In addition, direct comparison with other traditional sources of MSCs (huMSCs) remains scarce. Therefore, this study aimed to systematically evaluate the tumorigenic potential and reproductive tissue safety of huMenSCs in nude mice, which are more appropriate for xenotransplantation studies than normal mice, and compare these with those of huMSCs, thereby providing a scientific basis for the clinical application of huMenSCs.

Materials and methods

Experimental design

Tumorigenesis of the huMenSCs (LXT and CDH, which were isolated from different donors) and huMSCs (from a 46-XY donor umbilical cord) produced under GMP-compatible conditions was assessed in both sexes of 8-week-old nude mice via IV administration. Injection of PBS and LLC were also performed as negative and positive controls. The viability of the naturally died mouse during the 7-month assessment period post IV transplantation was checked. All mice were checked for tumor occurrence in the brain, gastro-intestine (GI), lung, and liver by anatomical observations at the time of death or at the end of 7-month assessment periods. The testis, ovaries, and uterus were fixed at 7 months post injection of the alive injected mice. H&E staining of the tissues was carried out and the histological morphologies of the spermatogenic cells, the arrangement of the seminiferous tubes, the number of normal and atretic follicles, the thickness of the endometrium, and the number of endometrial glands were compared. Total DNA from the testis, ovary, and uterus was isolated, and the human-specific DNA relative amounts were compared among different groups.

Collection and culture of the HuMenSCs

The project was approved by the Ethics Committee of Kiang Wu Hospital (Ethics No. KWH 2022-016, Approval Date: September 2022). All volunteers provided written informed consent for their participation in the study and the use of their collected data. Menstrual blood samples were collected on the second day of the volunteers’ menstrual cycles from healthy female volunteers with regular menstrual cycles and no other diseases, using a Divacup (Zhaoqing AIWO Silicone Technology Co., LTD., China). The isolation and culture methods of HuMenSCs were as described above¹⁶, and they were identified according to the standards for mesenchymal stem cells (MSCs) established by the International Society for Cell and Gene Therapy (ISCT). Briefly, before the mononuclear cells were separated by density centrifugation using Ficoll Paque (Thermo, Waltham, MA, USA), the blood was first diluted with phosphate-buffered saline (PBS, pH 7.4) containing gentamycin. The interlayer cells were then gathered and cultivated into cell culture flasks using serum-free 3D Flowtrix mesenchymal stem cell media (CytoNiche, Beijing, China), with the medium being changed every 2–3 days under 5% CO₂ and 37°C. The cells were passaged using 0.25% trypsin-EDTA (Gibco; Thermo, Waltham, MA, USA) once they had reached 80–90% confluence. Before the first three passages, blood agar plates, Sabouraud agar plates, and the Trypticase soy agar plates were used to detect bacterial contamination in huMenSCs, and the fifth passage was used for experiments.

Collection and culture of the HuMSCs

Informed consent was obtained from healthy volunteers. The umbilical cord was placed in a culture dish containing 75% ethanol and soaked for 1–2 min. The surface of the umbilical cord and any residual blood clots were cleaned with sterile saline. About 1 cm was cut off from each end of the umbilical cord, and the middle part was retained and cut into 2–4 cm segments. The umbilical cord was cut open to remove the blood vessels and the outer amniotic membrane. The umbilical cord was then cut into 2–3 mm³ tissue blocks, and each block was inoculated in a culture dish with an interval of 0.5 cm. The serum-free 3D Flowtrix mesenchymal stem cell medium (CytoNiche, Beijing, China) was then added, and fresh culture medium was replaced after culturing in a 37°C, 5% CO₂ humidity incubator for 7 days. The culture medium was then replaced every 3 days. When the cells reached 70%–80% confluence, the cells were passaged and recorded as the first generation (P1). The project was approved by the Ethics Committee of Kiang Wu Hospital (Ethics No. KWH 2022-016, Approval Date: September 2022). All volunteers provided written informed consent for their participation in the study and the use of their collected data.

Laboratory animals

Eight-week-old SPF grade BALB/c nude mice were purchased from Shenzhen Huarui model organism Biotechnology Co., LTD (Approval No. 44822700027720, Shenzhen, China) and housed in the microbiological monitoring individually ventilated cages (IVC) and kept in the microbiological monitoring individually ventilated cages (IVC) (22°C–24°C, 45%–70% humidity), with a 12-h light/dark cycle and unlimited access to food and drink. Based on the clinical guidelines¹⁷ and mouse safety studies¹⁸, all cells were administered to mice via tail vein injection at a dose of 1 × 10⁶ cells (in 100 μl PBS) per mouse. The nude mice were divided into five groups: the huMSC injection group (five male and five female mice); the CDH injection group (five male and five female mice); the LXT injection group (5 male and five female mice); the LLC injection group (two male and two female mice) and the PBS injection group (100 μl/mouse, three male and three female mice). The 8-week-old young mice were used as an uninjected control (Young) for histological morphology observations. All animal experiments were approved by the Animal Experiment Ethical Inspection Committee, Shenzhen Huarui Model Organisms Biotechnology Co, LTD, Shenzhen, China (Ethics No. APS-220915-020-01, Approval Date: September 26, 2022) and received humane care.

Viable tumor observation

We observed the nude mice for 7 months after MSCs injections. The mice were observed daily for any visible signs of tumor growth. The “tumor check” was carried out as soon as the mice were detected dead or sacrificed by veterinarians. The abdomen, thoracic, and cranial cavities of the mouse were opened to check the GI, liver, lung, and brain tumors¹⁹.

H&E and histological morphology measurements

The uterus, ovary, and testis were fixed in 4% paraformaldehyde and then embedded in liquid paraffin. The tissue blocks were cut into 5 μm paraffin sections using a paraffin slicer (Leica, Germany). The paraffin tissue sections were dewaxed and dehydrated by gradient dewaxing. Hematoxylin-eosin (H&E) staining (Solerbo, China) was performed according to the manufacturer’s standard operating procedures, and then, the sections were mounted with neutral resin.

Determination of human-sourced cells by PCR

Relative quantitative PCR was used to detect the human-specific human leukocyte antigen G (HLA-G) DNA in tissues. HLA-G is a human-specific non-classical major histocompatibility complex (MHC) class I molecule, crucial for maternal-fetal immune tolerance and immunomodulation^20,21, while mice lack the HLA-G gene^22,23. Total DNA from the uterine, ovarian, and testicular tissues collected above was extracted using TIANamp Genomic DNA Kit (TINANGEN, Beijing, China). Subsequently, the TransStart^® Top Green qPCR SuperMix (+Dye Ⅰ/+Dye Ⅱ) Kit (TransGen Biotech, Beijing, China) was used for detection on the Roche Real-Time PCR Systems instrument (Roche, Switzerland, China). The primers used for quantitative PCR are listed in Table 1. Data were analyzed using the 2^−ΔΔCt method to calculate relative DNA levels, and the DNA level of each sample was normalized to GAPDH.

Table 1.

The primers used for quantitative PCR.

	Forward primer	Reverse primer
hHLA-G	GGCTACGGAATGAAGACGC	TGTCGTCCACGTAGCCCAT
hGAPDH	TCGGAGTCAACGGATTTGGT	TTCCCGTTCTCAGCCTTGAC

Statistical analysis

Data were analyzed using SPSS software. The rates of natural deaths, survival, and tumor occurrence were analyzed by chi-square analysis. The average ages of the naturally died mice from different groups were analyzed by t-test. The follicle number and endometrial thickness from different groups were performed using GraphPad Prism 9.1 software (GraphPad Software Inc., San Diego, CA, USA). One-way analysis of variance (ANOVA) was used to compare differences between groups. A P-value less than 0.05 indicates a significant difference between groups.

Results

Characterization of huMenSCs and huMSCs

The huMenSCs and huMSCs were characterized according to ISCT standards. They displayed fibroblast-like morphology and adhered to culture plates. Both cell types showed trilineage differentiation potential. Flow cytometry indicated strong expression of CD73, CD90, and CD105, while CD14, CD117, and other negative markers were absent. Detailed data are available in our previous publication²⁴.

Effects of MSCs injection on mouse longevity

Two-month-old mice were given a single IV injection of huMenSCs (LXT and CDH) and huMSCs. During 7 months observation period, the survival of each group of mice was recorded. As shown in Table 2, at the end of the observation period, the survival rate of the PBS-, LXT-, CDH-, huMSCs-, and LLC-injected mice were 33.33%, 50.00%, 40.00%, 30.00%, and 0%, respectively, and Kaplan-Meier survival curves were plotted (Figure 1). As shown in Table 3, the longevity of the PBS-, the LXT-, the CDH-, the huMSCs-, and LLC-injected mice that died within 7 months post transplantation was 111.65, 151.20, 115.50, 143.50, and 10.25 days, respectively. The LXT- and huMSCs-injected mice had a significantly longer life than the PBS- and CDH-injected mice. The LLC-injected mice had a significantly shorter life than the other mice.

Table 2.

Number of mice deaths and survival within 7 months post transplantation.

Group (N)	Survival rate
PBS (6)	33.33% ^a
LXT-huMenSC (10)	50.00% ^a
CDH-huMenSC (10)	40.00% ^a
huMSC (10)	30.00% ^a
LLC (4)	0% ^b

Note. Values with different superscript letters (a or b) indicate significant differences among groups (P < 0.05), whereas values sharing the same letter are not significantly different.

Figure 1.

Kaplan–Meier survival curves comparing of percent survival analysis of mice in different groups.

Table 3.

The longevity of mice died within 7 months post transplantation.

Group (N)	Age (days)
PBS (4)	111.65 ± 17.16 ^a
LXT-huMenSC (5)	151.20 ± 21.35 ^b
CDH-huMenSC (6)	115.50 ± 14.00 ^a
huMSC (7)	143.50 ± 14.50 ^b
LLC (4)	10.25 ± 2.36 ^c

Note. Values with different superscript letters (a, b, or c) indicate significant differences among groups (P < 0.05), whereas values sharing the same letter are not significantly different.

The number of visible tumors discovered in the injected mice within 7 months of observation

The ex vivo expanded huMenSCs and huMSCs injection did not increase the tumor formation rate in nude mice. As shown in Table 4, the number and percentage of visible tumors observed in the injected mice within 7 months were 0 (0%), 0 (0%), 0 (0%), 1 (10%), and 4 (100%) in the PBS-, LXT-, CDH -, huMSCs-, and LLC-injected mice, respectively. The LLC-injected group had significantly more tumors than the other groups.

Table 4.

Number of visible tumors observed in the injected mice within 7 months observation.

Group (N)	No. of visible tumors(percentages)
PBS (6)	0 ^a (0%)
LXT-huMenSC (10)	0 ^a (0%)
CDH-huMenSC (10)	0 ^a (0%)
huMSC (10)	1 ^a (10%)
LLC (4)	4 ^b (100%)

Note. Values with different superscript letters (a or b) indicate significant differences among groups (P < 0.05), whereas values sharing the same letter are not significantly different.

Human-specific DNA residue in reproductive organs of the nude mice

Figure 2 shows the folds change of “human DNA” in the testis, ovary, and uterus of the injected mice, compared with those in the PBS-injected (negative) control mice. In the ovary, the huMSCs-injected mice had significantly more human DNA (>10-folds) than other mice. Human DNA was not found in testis and uterus of the injected mice.

Figure 2.

Human DNA content fold changes in the testis, ovary, and uterus after MSCs transplantation.

The morphology of the ovaries 7 months post injection

The morphology of the ovaries from the 9-month-old PBS- (Negative control), LXT-, CDH-, and huMSCs-injected mice and the young mice ovaries were compared (Figure 3). We calculated the number of normal follicles and the atretic follicles in the biggest cross-section of the ovary. The average number of normal follicles of the CDH-injected mice was significantly more than that of the huMSC-, LXT-, and PBS- injected mice (Figure 3k). The average number of atretic follicles of the CDH-injected mice was significantly more than that of the huMSC-, LXT-, and PBS-injected mice (Figure 3l). There were no atretic follicles in the young mice (Figure 3l).

Figure 3.

The histological structure of the ovary after MSCs injection. The ovary of the huMSC-injected mice 7 months post injection in (a) low resolution and (b) high resolution. The ovary of the CDH-injected mice 7 months post injection in (c) low resolution and (d) high resolution. The ovary of the LXT-injected mice 7 months post injection in (e) low resolution and (f) high resolution. The ovary of the PBS-injected mice (Control), 7 months post injection in (g) low resolution and (h) high resolution. The ovary of the non-injected 2-month-old mice (Young) in (i) low resolution and (j) high resolution. “a” indicates the Atretic follicles; “b” indicates the normal follicles. Comparisons of the number of (k) normal follicles and (l) atretic follicles in different groups.

The morphology of the testis 7 months post injection

The morphology of the testis from the 9-month-old PBS-, LXT-, CDH-, and huMSCs-injected mice and the young mice was analyzed from the largest cross-section of the testis (Figure 4). We compared the fullness of the seminiferous tubes, the arrangement, and the margins of the seminiferous tubes of each group of mice. All MSC-injected mice had fuller and more orderly arranged seminiferous tubes, a smoother seminiferous margin than the control group.

Figure 4.

The histological structure of the testis after MSCs injection. In huMSCs-injected mice, most of the seminiferous tubes were full of spermatogenic cells, orderly arranged and with smooth, clear margins (a) and (b). In CDH-injected and LXT-injected mice, most of the seminiferous tubes were full of spermatogenic cells, orderly arranged with some empty spaces, with smooth, clear margins (c-f). In the PBS-injected mice, most of the seminiferous tubes were empty, disorderly arranged, with a lot of vacuoles and with smooth, clear margins (g) and (h). In the 8-week-old young mice, most of the seminiferous tubes are full of spermatogenic cells, orderly arranged and with convoluted margins (i) and (j).

The morphology of the uterus 7 months post injection

The morphology of the uterus from the 9-month-old PBS-, LXT-, CDH-, huMSCs-injected mice, and the young mice was compared on the biggest cross-section of the uterus (Figure 5). We calculated the thickness of the endometria and the number of glands in each group. The LXT-injected mice had significantly thicker endometria and more endometrial glands than the other group mice. The endometrial thickness in the CDH-injected mice was also thicker than that in young mice (Figure 5k). The number of uterine glands was similar among the injected groups, which was all significantly less than that in young mice (Figure 5l).

Figure 5.

The histological structure of the uterus after MSCs injection. The uterine of the huMSC-injected mice 7 months post injection in (a) low resolution and (b) high resolution. The uterus of the CDH-injected mice 7 months post injection in (c) low resolution and (d) high resolution. The uterus of the LXT-injected mice 7 months post injection in (e) low resolution and (f) high resolution. The uterus of the PBS-injected mice (Control) 7 months post injection, in (g) low resolution and (h) high resolution. The uterus of the non-injected 2-month-old mice (Young) in (i) low resolution and (j) high resolution. “P” indicates the perimetrium; “M” indicates the myometrium; “E” indicates the endometrium; “L” indicates the lumen; “LE” indicates the lumen epithelium; “GE” indicates the glandular endometrium. Comparisons of (k) endometrial thickness and (l) the number of normalized uterine glands in different groups (P < 0.001) and (P < 0.05).

Discussion

IV administration continues to serve as a primary delivery route in MSC-based therapy clinical trials. When MSCs were injected intravenously, their fate and distribution in the body varied. At first, the injected cells accumulated in the lungs, trapping the cells as they passed through the bloodstream. The injected cells left the lungs and re-distributed to other organs and might remain in these organs for varying periods. Some cells had a “homing” ability, meaning they could migrate to specific tissues or injury sites in the body where they were needed for repair and regeneration²⁵. A lot of strategies have been applied to assist the MSCs targeting specific organs, such as genetic engineering, physical modifications, chemical modifications, pretreatment, magnetic targeting, and enucleation²⁶.

MSCs could promote tumor growth by supporting angiogenesis, suppressing the immune response, and enhancing cancer cell survival. On the flip side, MSCs could suppress tumors by inducing apoptosis, promoting inflammatory infiltration, and inhibiting tumor cell growth and spread pathways²⁷. Tumorigenicity represented a critical challenge in MSC-based therapies; the “nude mice tumorigenicity test” thus became the prerequisite before the cells were being used for therapies. Notably, in this study, only one mouse in the huMSC group developed a liver tumor, resulting in an incidence rate of 10%. This result was consistent with reported studies, which suggested that MSC transplantation might induce tumors in rare cases, especially during long-term observation or under conditions of weakened host immune function^28–30. Therefore, the bio-safety of the MSC therapies was always the first concern of the scientists and the cell receivers. MSCs were considered a suitable source for treating various canine and feline diseases³¹. However, there were very few reports about the function of injecting MSCs on the host mouse’s longevity. Herein, we for the first time observed that mice injected with huMenSCs or huMSCs exhibited higher overall survival compared with the PBS control group (Figure 1), suggesting that these MSCs might confer beneficial effects on host lifespan while maintaining safety. A scientific paper described that the engineered human ESC-derived vascular cells promote vascular protection and regeneration, and extended the host mice’s life-span³². Several reports have shown that injecting MSCs into mice could significantly extend their lifespan, especially in cases involving rapidly aging mice (Shot of young MSCs makes rapidly aging mice live much longer and healthier, researchers report. ScienceDaily; Old Mice Made “Young”-May Lead to Anti-Aging Treatments; Startup says genetic reprogramming allows mice to live longer. MIT Technology Review). According to reported studies, the mechanisms by which MSCs prolong life span may include regulating paracrine function, optimizing the tissue microenvironment to activate the repair and regeneration capacity of tissue-resident stem/progenitor cells³³, reducing chronic oxidative and inflammatory responses³⁴, and delaying telomere shortening³⁵, thereby protecting cell function, repairing tissues, and maintaining life span. These effects may work synergistically to prolong the aging process and maintain vitality and life span.

Normal mice possess a complete immune system, enabling them to more effectively eliminate foreign cells and exhibiting better safety outcomes, but their sensitivity to immune responses is also reduced. In contrast, nude mice lack mature T cells, exhibit greater immunosuppression, and develop tumors or abnormal tissue proliferation earlier after xenograft transplantation, which is beneficial for long-term monitoring of persistence. In accordance with stem cell safety guidelines, such as the US FDA “Preclinical Assessment of Investigational Cellular and Gene Therapy Products” (2013), which recommend long-term monitoring in immunodeficient mice to detect delayed biodistribution or tumorigenic changes, we extended the observation period to 7 months.

Here, we proved the injected huMSCs could accumulate in the ovaries after 7 months of IV injection. The MSCs had shown promise in homing to the ovaries²⁶. However, it was difficult to determine how the injected MSCs made “homing” to the ovaries^36–38. Although human-derived DNA was still detectable at this timepoint, this does not necessarily indicate long-term survival of viable MSCs, as residual DNA, low-level engraftment, or phagocytosed human material could account for this observation. Furthermore, we hypothesize that the transient retention effect of huMenSCs within the ovary is influenced by multiple factors. First, huMenSCs are derived from menstrual blood, the formation of which is closely linked to the shedding of the endometrium and the cyclical hormonal regulation of the ovary², which may facilitate their directed migration to reproductive tissues. Second, upon entering the bloodstream via the tail vein, a subset of these cells may access the ovarian arteries via the abdominal aorta, thereby distributing themselves throughout the ovary³⁹. In addition, ovarian tissue is characterized by a loose structure and a rich capillary network, whereas uterine tissue possesses a thick smooth muscle layer and a dense structure⁴⁰, which may render the ovary a more favorable environment than the uterus for the short-term accumulation of these cells.

The ovarian follicular development during the whole life span of the “nude” mice was uncertain. Female mice typically began their reproductive life around 4–6 weeks of age and could continue to reproduce until death. However, the “nude mice” seldom ovulated and stopped ovulation as early as 4 months old (source: The Jackson Laboratory). In this study, we observed and compared the histological morphology of the 6-week-old (young) and the 9-month-old (old) nude mouse ovaries. The number of atretic follicles in the young was significantly less than that of the old mice, which indicated the non-ovulated follicles became atretic during aging. Furthermore, we observed an intriguing phenomenon wherein huMenSC intervention simultaneously increased the numbers of both normal and atretic follicles, which may be attributed to the improvement of the ovarian microenvironment. By stimulating follicular development and growth, MSCs can enhance the generation of normal, healthy follicles⁴¹. Concurrently, follicular maturation is accelerated, yet a portion of aging follicles undergo atresia due to inherent developmental limitations or local microenvironmental factors⁴². This suggests a regulatory role for huMenSCs in maintaining the dynamic homeostasis of ovarian function. The reproductive function of male nude mice was also assessed. Nude male mice could produce offspring¹⁵. Spermatogenesis in the aged mice shows declined spermatogenesis compared with that of younger mice. Age-related changes in the testes include the formation of vacuoles in Sertoli cells, thickening of the basement membrane, and a decrease in the number of Sertoli cells and spermatogonia⁴³.

The therapeutic effects of IV-administered MSCs could include promoting tissue repair, modulating the immune system, and supporting the regeneration of damaged cells²⁵. There was an estrus cycle in mice; however, the estrus cycle in the 9-month-old nude mice were unknown⁴⁴. Cells, including the MSCs, could repair the endometrium^45,46. We observed that huMenSCs could promote endometrial thickening, which was linked to their regulation of hormones and estrous cycle dynamics. The estrous cycle in mice spans approximately 4–5 days. During the proestrus and estrus phases, elevated estrogen levels stimulate endometrial thickening, whereas endometrial thickness decreases during the metestrus and diestrus phases following ovulation⁴⁷. Furthermore, MSCs have been demonstrated to regulate the estrous cycle via paracrine mechanisms, thereby facilitating the restoration of ovarian function⁴⁸. Moreover, they modulate hormone levels and ameliorate the endometrial microenvironment, thereby further promoting endometrial thickening⁴⁹. The endometrial thickness in nude mice could be affected by hormonal treatments, which could lead to a thicker endometrium³⁷. As the mouse aged, the endometrium underwent cellular aging too, resulting in reduced cell proliferation, increased fibrosis, and thus led to a thinner and less functional endometrium⁴³.

This study is the first to evaluate the tumorigenic potential of huMenSCs in vivo with a nude mouse system and explores their potential impact on reproductive tissue and germ cell generation after transplantation. Furthermore, it provides the first direct comparison between huMenSCs and huMSCs, further supporting the biological safety of huMenSCs and the new experimental evidence for its potential clinical application.

While this study yielded some promising results, it still has some limitations. Although major organs were histologically examined, the lack of whole-body imaging means that very small or asymptomatic lesions may have been overlooked. The estrous cycle was not strictly controlled, which could introduce natural variability in uterine and ovarian morphology. Due to the long duration of animal experiments, the number of animals that could be included in each group is limited, resulting in a relatively limited sample size. The lack of assessment of functional fertility, such as reproductive function or in-vitro fertilization. Moreover, the use of immunodeficient nude mice limits the ability to fully predict how immunocompetent hosts would respond to transplanted cells. In addition, the potential MUSE (multilineage-differentiating stress-enduring cells) subset in huMenSCs, which possesses unique potential for stress resistance and extended healthy lifespan^50,51, was not identified and explored.

Conclusion

IV injection of the huMSCs and the huMenSCs was safe and did not increase the tumorigenesis in the injected mice during a 7-month observation period. The huMSCs accumulated in the ovarian tissues after injection, whereas the huMenSCs did not. Both the injected huMSCs and the huMenSCs showed therapeutic effects in the nude mice, which include increasing longevity and prevention of spermatogenesis, ovarian, and endometrial aging.

Footnotes

Acknowledgements

The authors express their gratitude to all participants who contributed to this study. The authors used Nano Banana Pro to assist the generation of graphical abstract and are fully responsible for the content of the manuscript.

ORCID iD

Yibing Han

Ethical considerations

The clinical protocol for collecting samples from healthy subjects was approved by the Ethics Committee of Kiang Wu Hospital (Ethics No. KWH 2022-016, Approval Date: September 2022). All volunteers provided written informed consent for their participation in the study and the use of their collected data. The animal protocol was approved by the Animal Experiment Ethical Inspection Committee, Shenzhen Huarui Model Organisms Biotechnology Co, LTD, Shenzhen, China (Ethics No. APS-220915-020-01, Approval Date: 26 September 2022).

Author contributions

Z.L., Y.H., and Y.Z.Z. designed the whole study; Z.L., G.X., W.H., and Y.H. conducted the experiments; Z.L., T.I.C., and Y.H. analyzed the data and prepared the figures; Z.L., W.H., T.I.C., G.X., T.H., and Y.Z.Z. wrote the manuscript; all the authors approved the manuscript for submission.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The study was supported by The Science and Technology Development Fund, Macau SAR (File no. 0003/2025/NRP, 0135/2025/AFJ, 0001/2024/RDP, 0001/2024/AKP, 0144/2022/A3, 0083/2024/RIB2, 0004/2025/EQP, 0095/2024/RIB2).

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data availability statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Use of artificial intelligence statement

The authors used Nano Banana Pro to assist the generation of graphical abstract and are fully responsible for the content of the manuscript.

Statement of human and animal rights

This article contains studies with human and animal subjects that were approved by the relevant institutional ethics committees, as detailed in the “Ethical considerations” section.

Statement of informed consent

There are no human subjects in this article and informed consent is not applicable.

References

Lovell-Badge

Anthony

Barker

Bubela

Brivanlou

Carpenter

Charo

Clark

Clayton

Cong

Daley

, et al. ISSCR guidelines for stem cell research and clinical translation: the 2021 update. Stem Cell Rep. 2021;16:1398–408.

Feng

. The secrets of menstrual blood: emerging frontiers from diagnostic tools to stem cell therapies. Front Cell Dev Biol. 2025;13:1623959.

Chen

Xiang

. The multi-functional roles of menstrual blood-derived stem cells in regenerative medicine. Stem Cell Res Ther. 2019;10:1.

Chen

Cheng

Chen

Xiang

. Menstrual blood-derived stem cells: toward therapeutic mechanisms, novel strategies, and future perspectives in the treatment of diseases. Stem Cell Res Ther. 2019;10:406.

Andrzejewska

Lukomska

Janowski

. Concise review: mesenchymal stem cells: from roots to boost. Stem Cells. 2019;37:855–64.

Giovanella

Stehlin

Williams

Jr . Heterotransplantation of human malignant tumors in “nude” thymusless mice. II. Malignant tumors induced by injection of cell cultures derived from human solid tumors. J Natl Cancer Inst. 1974;52(3):921–30.

Pantelouris

. Observations on the immunobiology of ‘nude’ mice. Immunology. 1971;20:247.

Petricciani

Kirchstein

Hines

Wallace

Martin

. Tumorigenicity assays in nonhuman primates treated with antithymocyte globulin. J Natl Cancer Inst. 1973;51(1):191–96.

Wortis

. Immunological studies of nude mice. In: Cooper

Warner

, editors. Contemporary topics in immunobiology. New York, Plenum Press; 1974. p. 243–63.

10.

Liu

Song

Zhu

Qiao

Wang

Gao

Cai

. Mesenchymal stem cells alleviate aging in vitro and in vivo. Ann Transl Med. 2022;10(20):1092.

11.

Jing

Zhou

Zou

Chen

DPC

. Application of telomere biology and telomerase in mesenchymal stem cells. Nano Transmed. 2022;1:e9130007.

12.

Zhu

Huang

Liu

Jiang

. Application of mesenchymal stem cell therapy for aging frailty: from mechanisms to therapeutics. Theranostics. 2021;11(12):5675–85.

13.

Reproductive aging research as a gateway to health and wellbeing. Nat Aging. 2024;4(12):1657.

14.

Shirasuna

Iwata

. Effect of aging on the female reproductive function. Contracept Reprod Med. 2017;2:23.

15.

Holub

. The nude mouse. ILAR Journal. 1992;34:1–3.

16.

Allickson

Sanchez

Yefimenko

Borlongan

Sanberg

. Recent studies assessing the proliferative capability of a novel adult stem cell identified in menstrual blood. Open Stem Cell J. 2011;3(2011):4–10.

17.

Renesme

Cobey

Lalu

Bubela

Chinnadurai

De Vos

Dunbar

Fergusson

Freund

Galipeau

Horwitz

, et al. Delphi-driven consensus definition for mesenchymal stromal cells and clinical reporting guidelines for mesenchymal stromal cell-based therapeutics. Cytotherapy. 2025;27(2):146–68.

18.

Liu

Wang

Luo

Feng

Kuang

Zhang

Zhou

, et al. HUC-MSCs: evaluation of acute and long-term routine toxicity testing in mice and rats. Cytotechnology. 2022;74(1):17–29.

19.

Zhao

Fan

. Tumorigenicity assay in nude mice. Bio-protocol. 2017;7:e2364.

20.

Castelli

Ramalho

Porto

Lima

Felício

Sabbagh

Donadi

Mendes-Junior

. Insights into HLA-G genetics provided by worldwide haplotype diversity. Front Immunol. 2014;5:476.

21.

Yao

Shu

Shi

Peng

Song

Jin

Sun

. Expression and potential roles of HLA-G in human spermatogenesis and early embryonic development. PLoS ONE. 2014;9(3):e92889.

22.

Ajith

Portik-Dobos

Horuzsko

Kapoor

Mulloy

Horuzsko

. HLA-G and humanized mouse models as a novel therapeutic approach in transplantation. Hum Immunol. 2020;81(4):178–85.

23.

Comiskey

Goldstein

De Fazio

Mammolenti

Newmark

Warner

. Evidence that HLA-G is the functional homolog of mouse Qa-2, the Ped gene product. Hum Immunol. 2003;64(11):999–1004.

24.

Han

Shi

Dong

Chan

Xiao

Zhu

. HuMenSCs initiate the uterus stromal decidualization in mouse. Curr Stem Cell Res Ther. 2025;20(10):1068–76.

25.

Wagner

Henschler

. Fate of intravenously injected mesenchymal stem cells and significance for clinical application. Mesenchymal stem cells-basics clinical application II. Adv Biochem Eng Biotechnol. 2013;130:19–37.

26.

Song

Liu

Bai

Wang

. The remodeling of ovarian function: targeted delivery strategies for mesenchymal stem cells and their derived extracellular vesicles. Stem Cell Res Ther. 2024;15:90.

27.

Liang

Chen

Zhang

Fang

Chen

. Mesenchymal stem cells as a double-edged sword in tumor growth: focusing on MSC-derived cytokines. Cell Mol Biol Lett. 2021;26:25.

28.

Foster

Sivarapatna

Gress

. The aging immune system and its relationship with cancer. Aging Health. 2011;7:707–18.

29.

Jeong

Han

Kim

Cho

Park

Lee

Kim

Yoon

. Malignant tumor formation after transplantation of short-term cultured bone marrow mesenchymal stem cells in experimental myocardial infarction and diabetic neuropathy. Circ Res. 2011;108:1340–47.

30.

Mallapaty

. Do stem-cell transplants increase cancer risk? Long-lived recipients offer clues. Nature. 2024 Oct 25.

31.

Jeung

Kim

Seo

Jan

Lee

. Exploring the tumor-associated risk of mesenchymal stem cell therapy in veterinary medicine. Animals. 2024;14:994.

32.

Yan

Wang

Suzuki

Liu

Lei

Wang

Ding

. FOXO3-engineered human ESC-derived vascular cells promote vascular protection and regeneration. Cell Stem Cell. 2019;24:447–618.

33.

Bhartiya

Singh

Sharma

Kaushik

. Very small embryonic-like stem cells (VSELs) regenerate whereas mesenchymal stromal cells (MSCs) rejuvenate diseased reproductive tissues. Stem Cell Rev Rep. 2022;18(5):1718–27.

34.

Branco

Moniz

Ramalho-Santos

. Mitochondria as biological targets for stem cell and organismal senescence. Eur J Cell Biol. 2023;102(2):151289.

35.

Serakinci

Graakjaer

Kolvraa

. Telomere stability and telomerase in mesenchymal stem cells. Biochimie. 2008;90(1):33–40.

36.

Esfandyari

Chugh

Park

H-s

Hobeika

Ulin

Al-Hendy

. Mesenchymal stem cells as a bio organ for treatment of female infertility. Cells. 2020;9:2253.

37.

Hoang

Pham

Bach

Ngo

Nguyen

Phan

TTK

Nguyen

PTT

Hoang

Forsyth

Heke

, et al. Stem cell-based therapy for human diseases. Signal Transduct Target Ther. 2022;7:1–41.

38.

Kabat

Bobkov

Kumar

Grumet

. Trends in mesenchymal stem cell clinical trials 2004-2018: is efficacy optimal in a narrow dose range? Stem Cells Transl Med. 2020;9(1):17–27.

39.

Wolff

Green

Paton

JFR

Collier

. New understanding of circulatory blood flow and arterial blood pressure mechanisms. Cardiovasc Res. 2022;118:e29–31.

40.

Konarska-Wlosinska

Nasser

Ostrowski

Bonczar

Ochwat

Walocha

Koziej

. The arterial blood supply of the ovaries: a comprehensive review. Folia Morphologica. Epub 2024 Aug 13.

41.

Cacciottola

Vitale

Donnez

Dolmans

. Use of mesenchymal stem cells to enhance or restore fertility potential: a systematic review of available experimental strategies. Human Reproduction Open. 2023;2023:hoad040.

42.

Zhang

Lin

Wang

Zhou

. Mechanisms of follicular atresia: focus on apoptosis, autophagy, and ferroptosis. Front Endocrinol (Lausanne). 2025;16:1603467.

43.

Nakano

Nakata

Kadomoto

Iwamoto

Yaegashi

Iijima

Kawaguchi

Nohara

Shigehara

Lzumi

Kadono

. Three-dimensional morphological analysis of spermatogenesis in aged mouse testes. Sci Rep. 2021;11:23007.

44.

Elvis-Offiah

Isuman

Johnson

Ikeh

Agbontaen

. Our clear-cut improvement to the impact of mouse and rat models in the research involving female reproduction. In: Karapehlivan

Gelen

Kükürt

, editors. Animal models and experimental research in medicine. London (UK): IntechOpen; 2022.

45.

Zhang

Sun

Lai

. Human amniotic epithelial cells improve fertility in an intrauterine adhesion mouse model. Stem Cell Res Ther. 2019;10:14.

46.

Strug

Aghajanova

. Making more womb: clinical perspectives supporting the development and utilization of mesenchymal stem cell therapy for endometrial regeneration and infertility. J Pers Med. 2021;11:1364.

47.

Byers

Wiles

Dunn

Taft

. Mouse estrous cycle identification tool and images. PLoS ONE. 2012;7(4):e35538.

48.

Mehdinia

Ashrafi

Fathi

Taheri

Valojerdi

. Restoration of estrous cycles by co-transplantation of mouse ovarian tissue with MSCs. Cell Tissue Res. 2020;381(3):509–25.

49.

Hoang

Nguyen

Hoang

Nguyen

Nguyen Thanh

. Adipose-derived mesenchymal stem cell therapy for the management of female sexual dysfunction: literature reviews and study design of a clinical trial. Front Cell Dev Biol. 2022;10:956274.

50.

Alanazi

Alhwity

Almahlawi

Alatawi

Albalawi

Abdel-Maksoud

Elsherbiny

. Multilineage differentiating stress enduring (muse) cells: a new era of stem cell-based therapy. Cells. 2023;12:1676.

51.

Dezawa

. Comparison of MSCs and muse cells: the possible use for healthspan optimization. Biogerontology. 2025;26:139.