Amelioration of Dalton’s lymphoma–induced angiogenesis by melatonin

Chemicals

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT); Dulbecco’s Modified Eagle’s Medium (DMEM) media; melatonin; dexamethasone; fetal bovine serum (FBS); primers for VEGF, VEGFR, FGF, TIMP3, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and β-actin; and antibiotics were purchased form Sigma-Aldrich (India). Methanol and crystal violet were purchased from HiMedia (India). SYBR Green PCR Master Mix was purchased from Applied Biosystems by Life Technologies (UK). Rabbit polyclonal anti-CD31 and Alexa-568-labeled goat anti-rabbit antibodies were purchased by Abcam (UK). Human lung adenocarcinoma A549 and cervical carcinoma SiHa cells were purchased from National Centre for Cell Science (NCCS, India). DL cell line was obtained from Prof. Ajit Sodhi, Banaras Hindu University (BHU, India). For CAM assay, fertilized chick embryos were purchased from Keggfarms Pvt. Ltd. (India).

Animals

The animal experiments were carried out with BALB/c mice aged 3–4 months of either sex obtained from the Animal House Facility of Department of Zoology, University of Delhi, India. In a polypropylene cage, 4–5 animals were housed, provided with a standard pellet diet, water ad libitum, and maintained under standard laboratory conditions of temperature and humidity with an alternating 12-h light/dark cycle in accordance with the guidelines laid by Animal Ethics Committee, University of Delhi, and protocols approved by the CPCSEA, India.

Maintenance of DL and collection of ascitic fluid (DLA)

Dalton lymphoma (DL) cells were maintained in the peritoneum of BALB/c mice by serial passaging of tumor cells via intraperitoneal (IP) injection as described previously.^7,21 Briefly, 1 mL of 1 × 10⁶ cells/mL of DL cell suspension (in phosphate-buffered saline (PBS) was injected in the peritoneal cavity of mice and was left to grow for 18–21 days. Increased body weight and abdominal swelling signified the development of DL, which was clearly visible from 10 to 11 days post transplantation, and these mice survived for 20 ± 3 days.

To get DLA, the peritoneal lavage was drawn from mice having fully grown tumor (15–18 days) and was centrifuged at 5000 r/min for 10 min at 4°C. Supernatant was collected and filtered through 0.45 µm membrane filter. Collected DLA was aliquoted and stored at −20°C until used in experiments.

Preparation of condition media of A549 and SiHa cells

The A549 and SiHa cells were obtained from national tissue repository, NCCS (India). The cells were cultured in DMEM supplemented with 10% FBS, gentamycin (20 mg/mL), streptomycin (100 mg/mL), and penicillin (100 IU) in a CO₂ incubator at 37°C in a humidified atmosphere with 5% CO₂; 80% confluent of exponentially growing cells was sub-cultured and used in the experiments.

In 1 mL of complete DMEM having 10% FBS, 1 × 10⁶ cells/well were plated in six-well plate overnight in a CO₂ incubator. Next day, the cells were washed with PBS two times and re-fed with 500 µL of incomplete DMEM. After 24 h of incubation, the condition media (CM) were collected, centrifuged at 10,000 r/min at 4°C, filtered through 0.45 µ membrane filter, and stored at −20°C to be used later as source of angiogenic factor.

MTT assay

The anti-proliferative effect of melatonin against DL cells was determined by the MTT assay described earlier with slight modification. ¹⁵ Briefly, 1 × 10⁴ cells/well (DL) were grown in medium alone and in the presence of melatonin (1 and 5 mM; 100 mM stock in 17% ethanol) or dexamethasone (5 µg/mL) for different time durations (0–96 h) in CO₂ incubator at 37°C with 70%–80% humidity; 4 h prior to termination, 20 µL MTT solution (5 mg/mL in PBS) was added into each well. For termination, cells were collected in microfuge tubes and centrifuged at 5000 r/min for 5 min, and the medium was removed and washed with PBS and 100 µL of dimethyl sulfoxide (DMSO) was added to the pellet to dissolve the formazan crystal formed in the cells. Finally, optical density was measured at 570 nm using an micro-plate reader (Biotek, USA).^11,29

Isolation of endothelial cells from main thoracic aorta from BALB/c mice using 0.2% collagenase enzyme

The endothelial cells were isolated from main thoracic aorta following protocol described earlier with few modifications.^30–32 Main aorta was dissected out, stripped of extraneous fatty tissue, and washed with PBS (having 3× gentamycin (20 mg/mL), streptomycin (100 mg/mL), and penicillin (100 IU)). Washed artery was placed in cold PBS (having 3× gentamycin (20 mg/mL), streptomycin (100 mg/mL), and penicillin (100 IU)) for 2 h at 4°C in a cold room to reduce the contamination. To dissociate endothelial cells, the artery was first drained off any PBS trapped, cut laterally, and incubated in 0.23% collagenase in DMEM at 37°C in an incubator for 35–45 min in a microfuge tube with intermittent shaking at every 10 min. The enzyme suspension with dissociated cells was collected in a falcon, debris was removed, and cells were rinsed with DMEM two times. Finally, 1 × 10⁵ cells/well were plated to form a monolayer of endothelial cells in 24-well plate in DMEM containing 20% FBS, gentamycin (20 mg/mL), streptomycin (100 mg/mL), and penicillin (100 IU) and were incubated in a CO₂ incubator at 37°C and 70%–80% humidity. Media were replaced after every 2 days.

Characterization of endothelial cells by immunostaining with CD31

Endothelial cells isolated from thoracic aorta (1 × 10⁵) were plated on sterilized cover glasses in a 12-well plate and were allowed to adhere for 4 h. Culture media from 0 and 72 h grown cells were removed, washed with PBS three times, and fixed with 3% paraformaldehyde for 10 min at room temperature. The fixed cells were again washed with PBS and permeabilized with cold 0.5% Nonidet P-40 for 1 min, washed, and then blocked with blocking solution (5% goat serum in 0.2% Tween 20 in PBS (PBST)) for 2 h at room temperature. After blocking, cells were incubated with rabbit polyclonal anti-CD31 (1:100) antibody overnight at 4°C. The cells were washed with PBST thrice and incubated for 2 h with Alexa-568-labeled goat anti-rabbit antibody (1:250) at room temperature in dark. Cells were finally washed with PBST, and the cover slips were mounted in VECTASHIELD with 4′,6-diamidino-2-phenylindole (DAPI) and examined under fluorescence microscope Nikon 90i (Japan).^30,31

Endothelial cell proliferation assay

The endothelial cells harvested from main thoracic aorta of BALB/c mice, 1 × 10⁴ cells/well, were divided in two groups: group I control and group II grown in complete medium alone and in the presence of 25% DLA, respectively, for 48 h. After 48 h, the DLA-treated cells were further divided into two groups: one group (II-a) was no more supplemented with DLA and the other group (II-b) was again supplemented with 25% DLA for 72 h. Different doses of melatonin (1 and 5 mM) or dexamethasone (5 µg/mL) were given to all the three groups (Figure 3) after 48 h for next 72 h and proliferation of cells was analyzed using crystal violet (0.02% aqueous solution). ²⁸ Absorbance was measured at 540 nm using microplate reader (Biotek, USA).

Endothelial cell migration: wound-healing assay

Migration of endothelial cells was analyzed by method described earlier with slight modification.^5,15 Endothelial cells isolated from thoracic main aorta were seeded in 12-well plate in DMEM containing 20% FBS and were allowed to reach full confluence. A line of cells was scraped away in each well with the help of sterile pipette tip. Wells were washed with PBS to remove detached and dead cells. Melatonin (1 or 5 mM) or dexamethasone (5 µg/mL; +ve control) was added in the presence and absence of DLA (25%) in respective wells (as shown in Figure 4(a)) and were photographed at different time points under inverted microscope (4×) to assess cell migration.

Chorioallantoic membrane assay

CAM model allows in vivo system to study tumor angiogenesis and can be utilized for testing of anti-angiogenic molecules. The methodology was described elsewhere and was followed with slight modification.^2,11,17,33 On 4th day after fertilization, a window was formed, and the eggs were incubated at 37°C. The tumor factors such as ascites (DLA; freshly isolated from mice having 18- to -21-day-old tumor), cancer cell condition media (CM of A549 or SiHa), or cancer cells (DL) were added in control embryos and drug-treated embryos, which were supplemented with drugs 2 h prior to tumor cells or tumor factors on sterile Whatman filter paper discs. The window was again sealed and incubated for 96 h at 37°C, with 60%–70% relative humidity in an incubator. After final 96-h incubation, CAMs were fixed with 4% formalin for 15 min at room temperature. Fixed CAM was cut, separated from the egg, and was spread properly to be photographed under stereo zoom microscope (Nikon) and were analyzed with the help of NIS element software. Counting of primary, secondary, and tertiary blood vessels was done to analyze the effect of DLA and treatment on angiogenesis.

Schedule of in vivo melatonin treatment and sample collection

For the experiment, 8- to 10-week-old mice of either sex weighing 25–30 g were used. The animals were randomly distributed into three groups each having six mice per group per cage. Group I was kept as control without any treatment. Group II and group III were injected with 1 × 10⁶ DL cells/mL IP. To evaluate anti-angiogenic activity of melatonin, group III mice were given melatonin treatment at a dose of 50 µg/g/body weight simultaneously with DL transplantation in evening after 6 p.m. for consecutively 10 days. On day 21, post DL transplantation, all the mice from each group were sacrificed by cervical dislocation. Peritoneum and mesentery were exteriorized immediately after sacrificing the animal, washed in chilled PBS, spread on wax plate, and photographed under stereo zoom microscope following the method described by Norrby ³⁴ in 2006 with slight modifications.

Histological study

Furthermore, the histological study of exteriorized peritoneum was performed by hematoxylin and eosin (H&E) staining. The peritoneum was isolated, washed with chilled PBS, and fixed using Bouin’s fixative followed by gradual dehydration and parafilm wax embedding. Tissue sectioning of 5–6 µm was done using microtome. Finally, the sections were stained with H&E. ³⁵ The sections were micro-photographed and analyzed by NIS element software.

Semiquantitative RT-PCR and qRT-PCR analysis of VEGF, FGF, and TIMP3 mRNA expression in DL cells and VEGFR and TIMP3 in mice mesentery

The effect of melatonin on expression of VEGF, FGF, and TIMP3 genes in the DL cells was measured by RNA isolation from the normal thymic cells (isolated from mice), untreated DL cells, and DL cells treated with melatonin (1 mM for 24 h), TIMP3, and VEGFR genes in stromal cells retrieved from mesentery of group I, II, and III, followed by first-strand complementary DNA (cDNA) synthesis, and then, gene-specific PCR was done using forward and reverse primers enlisted in Table 1 to obtain PCR amplicons, and GAPDH was taken as internal control. ²⁹ In the real-time reactions, fold change of each transcript was calculated by the comparative ΔΔCT method and was normalized with β-actin.

OPEN IN VIEWER

Table 1.

List of primers used in RT- and qRT-PCR.

Name of gene	sequence 5′→3′	Annealing temperature (°C)	Product length (bp)
VEGF	5′CCACAAACACCTTCTTTAAACC3′ 5′TTCAAACAACGTCTTGCTGAG3′	60	121
TIMP3	5′TGAGGAGGAGAGAACCCGAG3′ 5′GGGTTTTCTCTGGCTGGTGT3′	67	136
FGF	5′CAGCACAATGGCAGGCAAAT3′ 5′CATGGGGAGGAAGTGAGCAG3′	67	105
VEGFR	5′TAACCTGGCTGACCCGATTC3′ 5′AAGTCACAGAGGCGGTATGC3′	60	117
GAPDH	5′CACACCGACCTTCACCATTTT3′ 5′AGACAGCCGCATCTTCTTGT3′	60	983
β-Actin	5′CTTCTTGGGTATGGAATCCTG3′ 5′GTAATCTCCTTCTGCATCCTG3′	60	158

VEGF: vascular endothelial growth factor; TIMP3: tissue inhibitor of metalloproteinase 3; FGF: fibroblast growth factor; VEGFR: vascular endothelial growth factor receptor; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.

Statistical analysis

Data shown are representative images and difference among groups of cells was analyzed using Student’s t-test. The p value of 0.05 was considered statistically significant (*p ≤ 0.05, **p ≤ 0.01, and ***p≤ 0.001). All experiments were done in triplicate and repeated three times unless otherwise stated.

DLA induces endothelial cell proliferation

Endothelial cells are precursor for the formation of neo-vasculature, and proliferation of endothelial cells is the initial and essential step in sprouting of new blood vessels or angiogenesis in tumor environment. ¹³ In order to study the effect of DLA on angiogenesis and role of melatonin, endothelial cells were isolated from the main thoracic aorta, made single cell suspension, plated in 24-well culture plate, and were allowed to grow as monolayer in DMEM with 20% FBS. The endothelial cell proliferation was monitored from 24 to 72 h (Figure 1). To characterize the cells isolated from aorta, immunostaining with endothelial cell–specific marker CD31 was performed. As shown in Figure 1(a), the isolated cells showed significant proliferation in in vitro culture (Figure 1(a)) and were also CD31 positive (Figure 1(b)). Next, to evaluate the effect of DLA on endothelial cell proliferation, 4-day cultured endothelial cells were fed with 25% DLA and further incubated for 72 h. We observed that DLA induced significant increase in endothelial cell proliferation when compared to control endothelial cells that were not exposed to DLA (Figure 2(a)), suggesting that DLA must have factors leading to endothelial cell proliferation. The number of endothelial cells increased up to 2.3 fold (Figure 2(a)).

OPEN IN VIEWER

Figure 1.

In vitro proliferation and CD31 immunostaining of aortic endothelial cells. (a) Endothelial cells harvested from main thoracic aorta were seeded in 96-well culture plates (1 × 10⁴ cells/well) in medium supplemented with 20% FBS and incubated for 0–72 h. (a(i)) The cells were fixed with chilled methanol, stained with crystal violet, and photographed. (a(ii)) The same stained cells were solubilized in DMSO to measure the absorbance for graphical presentation of proliferation. (b) Photomicrograph of endothelial cells showing expression of CD31 surface marker by immunostaining with anti-CD31 antibody and secondary antibody tagged with Alexa568. Nuclei are counterstained by DAPI.

OPEN IN VIEWER

Figure 2.

Effect of (a) DL-ascitic fluid (DLA) or (b) melatonin on endothelial cells. Endothelial cells harvested from main thoracic aorta were seeded in 96-well culture plates (1 × 10⁴ cells/well) in a medium supplemented with 20% FBS for 24 h. Then, media were aspirated and replaced with fresh media supplemented with 20% FBS containing 25% freshly isolated DLA (from 14- to 15-day-old DL-bearing BALB/c mice) or (b) increasing concentration of melatonin and further incubated for 72 h. (a(i)) Representative photomicrograph of control and DLA-treated endothelial cells. (a(ii)) Graphical presentation of crystal violet assay for the same groups. (b) Graphical presentation of dose kinetics study of melatonin on endothelial cells (**p < 0.01; ###p < 0.001 vs control).

Melatonin inhibits DLA-induced endothelial cell proliferation

To evaluate role of melatonin on DLA-induced endothelial cell proliferation, based on previous studies ¹⁵ and dose kinetics of melatonin on normal endothelial cells (Figure 2(b)), pharmacological concentration of melatonin (1 mM) and an higher dose of 5 mM were used for treatment. As described in section “Material and methods,” the cells were divided into three groups. Group I—endothelial cells without DLA; Group IIa—endothelial cells induced with DLA for 48 h, washed, and treated with melatonin for 72 h; and Group IIb—endothelial cells grown in DLA for 48 h, washed, and treated with different concentrations of melatonin for 72 h in the presence of DLA. A volume of 1 mM concentration of melatonin showed cytostatic effect, whereas 5 mM concentration showed growth inhibitory effect on group I control cells. The Group IIa cells (induced with DLA for initial 48 h only) showed high sensitivity toward melatonin, and significant apoptosis was observed in a dose- and time-dependent manner. Melatonin also induced apoptosis in Group IIb cells in dose-dependent manner. However, the effect was less pronounced in the presence of DLA. A volume of 5 µg/mL dexamethasone was taken as positive control in all conditions (Figure 3).

OPEN IN VIEWER

Figure 3.

Effect of melatonin on endothelial cell proliferation. Endothelial cells isolated from main thoracic aorta were divided into three groups. In group I, the cells were incubated in medium alone, group IIa cells were grown in the presence of 25% DLA for 48 h, washed, and treated with drugs (melatonin 1 and 5 mM or dexamethasone 5 µg/mL) for 72 h. In group IIb, the cells were grown in the presence of 25% DLA for 48 h, washed, and treated with drugs (melatonin 1 and 5 mM or dexamethasone 5 µg/mL) in the presence of 25% DLA for further 72 h. After the treatment, the cells were fixed with chilled methanol, stained with crystal violet, and (a) photographed at 10× magnification. (b) Graphical representation of growth profile from crystal violet assay (*p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001).

Regulation of endothelial cell migration by melatonin

Migration of endothelial cell is an essential event for neovascularization during angiogenesis. Therefore, we focused on the anti-migratory effects of melatonin treatment on endothelial cells using wound-healing assay. As shown in Figure 4, the wound created was covered considerably within 72 h by the DLA-induced endothelial cells signifying cell migration. Melatonin treatment significantly inhibited the migration of endothelial cells in a dose-dependent manner. An amount of 5 µg/mL dexamethasone was taken as positive control (Figure 4).

OPEN IN VIEWER

Figure 4.

Effect of melatonin on endothelial cell migration analyzed by the wound-healing assay. (a) Representative photomicrographs after 72 h of wound created with or without DLA in the presence or absence of drugs (melatonin 1 and 5 mM or dexamethasone 5 µg/mL). Pictures are shown at 40× magnification and migration distance was measured using Motic Image Plus 2.0 software. (b) Graphical representation of distance migrated by the endothelial cells in the presence of DL ascites with or without drugs. (Data presented as mean ± SEM and ***p ≤ 0.001 and ^###p ≤ 0.001 for control vs DLA.)

Effect of DLA on angiogenesis in CAM

In in vitro study, we observed that DLA induced endothelial cell proliferation and melatonin treatment and significantly downregulated the DLA-induced endothelial cell proliferation. Next, we extended our investigation to monitor the effect of DLA on angiogenesis in vivo in CAM assay. Initially, we compared the effect of DLA and cancer cell (A549 and SiHa) conditioned media for angiogenic response in CAM; 50 µL of freshly isolated DL-ascitic (DLA) fluid was injected in 4-day-old fertilized chick egg and left to grow for another 4 days. The chorioallantoic membrane was analyzed for new blood vessel formation. As shown in Figure 5(a), DLA treatment to growing embryo resulted in increased sprouting of tertiary blood vessels suggesting the presence of pro-angiogenic factors in DLA. There was significant 2.25-fold increase in growth of tertiary vessel formation (control: DLA (mean ± standard error of mean (SEM)) 65 ± 4.8: DLA: 146.5 ± 4.5). In addition, there was a significant increase in the branch points (p = 0.0001). The secondary branches also increased but not to the significant level (Figure 5(b)). The DLA treatment did not affect the primary vessel development. Next, as shown in Figure 5(b), 24-h conditioned media of A549 and SiHa cells known to secrete pro-angiogenic factors also promoted tertiary branching of blood vessels in CAM of developing chick embryo to 1.4- and 1.04-fold increases in A549- and SiHa-conditioned media, respectively (Figure 5).

OPEN IN VIEWER

Figure 5.

Effect of DLA and tumor cell–conditioned media from A549 and SiHa cells on CAM. (a) Photomicrograph showing control and DLA-, A549 CM–, and SiHa CM–treated CAM. (b) Graphical representation of number of micro-blood vessels formed after 96 h of incubation, quantified using NIS element software as described in section “Material and methods” (*p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001).

Melatonin pretreatment suppressed DL- and DLA-induced angiogenesis in CAM

Furthermore, after establishing DLA-mediated angiogenesis in CAM, we sought to investigate the effect of melatonin on DLA-induced angiogenesis by giving 2 h pretreatment of melatonin (5 mM) or dexamethasone (5 µg/mL) on a disc before treating with DL cells or DLA to CAM. In Figure 6(a), quantification of images from various CAM assay showed anti-angiogenic activity of melatonin. It can be very clearly observed that groups which are treated with DL cells or DLA show relatively higher number and thicker blood vessels with more branching points, whereas the CAMs pretreated with melatonin before supplementing DL cells or DLA showed significant inhibition in branching and tertiary blood vessel development, which strongly suggested that melatonin treatment suppressed sprouting of tertiary vessels from the main vessels, a hallmark feature of tumor angiogenesis. Statistical analysis displayed 2.5- and 1.3-fold inhibition in vascularization in case of DLA and DL-induced angiogenesis, respectively. Dexamethasone was used as a positive control for anti-angiogenic activity (Figure 6(b)). The control groups with no treatment or treatment with only 5 mM melatonin showed normal vascularization with primary, secondary, and tertiary branching.

OPEN IN VIEWER

Figure 6.

In vivo effect of melatonin on angiogenesis in chick embryo CAMs; 4-day-old developing embryos were pretreated with 50 µL of 5 mM/disc of melatonin or 12 µg/disc dexamethasone, and then, DL ascites were added. After 96 h of incubation, the CAM was harvested, photographed, counted, and plotted. (a) Photomicrograph of control groups including medium, DL cells (1 × 10⁶), ascites, and 5 mM melatonin, and DL cells + melatonin, ascites + melatonin, and ascites + 12 µg/disc of dexamethasone were the experimental groups. (b) Graphical representation of number of tertiary blood vessels formed at 96 h of incubation of different control and pretreated chick embryo CAMs, and a number of blood vessels were quantified using NIS element software (*p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001).

Melatonin suppresses DL-induced angiogenesis in mice peritoneum

Many reports suggest that highly vascularized tumors are bad for survival and also results in recurrence. ³⁶ DL can serve as reliable model for angiogenic experimentations because DL cells can be easily grown in mice abdominal cavity, and DL growth is related to the progression and enlargement of peritoneal micro-vessels. The mice were divided into three groups that included control without tumor, DL group, and melatonin-treated DL group. Melatonin (50 µg/g/body weight) was injected (IP) for 10 consecutive days starting simultaneously with DL transplantation. Peritoneal blood vessels were analyzed after 21 days post tumor transplant. Peritoneum of control mice exhibited very few micro-vessels, while the number of micro-vessels was found to be significantly high in DL-bearing mice. Melatonin treatment to DL mice resulted in considerable reduction in the development of new micro-vasculature (Figure 7(a)). Furthermore, the histological H&E-stained sections of control mice showed normal peritoneal histology. DL-bearing mice showed the symptoms of peritonitis, that is, the inflammation of peritoneum resulted from increased leukocytes infiltration clearly visible in the section at higher magnification (Figure 7(b)). The melatonin-treated mice showed reduction in peritonitis with less leukocytes infiltration and normal histoarchitecture. Increased leukocyte infiltration is the hallmark of more blood vessels with increased permeability.

OPEN IN VIEWER

Figure 7.

Effect of melatonin on DL-induced angiogenesis in mice peritoneum. (a) Anatomy and (b) photomicrographs of H&E-stained section of peritoneum from control and DL- and melatonin-treated mice. DL-transplanted mice were given simultaneous treatment of melatonin (50 µg/g body weight; intraperitoneal) and were continued for 10 days consecutively. The peritoneum was collected on day 21 of tumor transplantation. Control section of peritoneum revealed normal tissue architecture. Inflammation of peritoneum due to an increase in leukocyte infiltration in circulation as well as in between the loose connective tissue layer was observed in case of tumor (arrow indicates the infiltrating cells and BV represents blood vessels. (b) Melatonin-treated group showed preserved histoarchitecture of peritoneum. Magnification is 100× and 400×.

Effect of melatonin on DL-induced angiogenesis in mesentery perivasculature of mice

The mice mesentery was exteriorized from all the three groups (described in earlier section) after 21 days post tumor transplantation. Reports suggest that adult normal mice have 40–50 thin mesentery windows which are surrounded by fat tissue. Whole mount microscopic view of mesentery window from control mice showed avascular central part and very few capillaries present toward intestinal tissue. The translucent fatty part of the membranous mesentery in normal mice had no or very little vascularization. In DL-bearing mice, crowded network of capillaries originating from the pre-existing mesenteric blood vessels were developed. The capillaries were more on both intestinal side and in perivascular fat tissue (Figure 8). The melatonin-treated mice showed no capillaries in the perivascular fat tissue as well as there were very few capillaries on the intestinal tissue as compared to DL-bearing mice (Figure 8).

OPEN IN VIEWER

Figure 8.

Effect of melatonin on angiogenic growth in mesentery. DL-transplanted mice were given simultaneous treatment of melatonin (50 µg/g body weight; intraperitoneal) and were continued for 10 consecutive days. Peritoneum and mesentery from control and DL- and melatonin-treated mice were photographed using stereo zoom microscope at 0.8× magnification on day 21 post DL transplantation. Black arrows represent perivascular fatty tissue full of micro-vessels.

Melatonin differentially regulates VEGF, VEGFR, FGF, and TIMP3 mRNA expression in DL cells and in mesenteric tissue

Induction and suppression of pro-angiogenic and anti-angiogenic genes are the key markers of angiogenic switch in cancer progression and survival. The imbalance between these genes causes activation of endothelial cell proliferation. In order to study the involvement of these genes in DLA-induced angiogenesis and its subsequent modulation by melatonin, DL cells (2 × 10⁶ cells/well) were grown for 24 h with or without melatonin (1 mM) or dexamethasone (5 µg/mL) in six-well plate. mRNA expression of VEGF, FGF, and TIMP3 was analyzed by semiquantitative RT-PCR as well as by qRT-PCR. As DL cells are spontaneous T-cell lymphoma, we used normal thymic cells from BALB/c mice as control. There was significant decrease in expression of TIMP3 in DL cells as compared to normal thymic cells. When DL cells were treated with melatonin (1 mM for 24 h), the expression of TIMP3 increased in comparison to untreated DL cells (Figure 9(a)). Pro-angiogenic VEGF expression is reported to be higher in many cancer cells; therefore, we also investigated the expression of VEGF in DL cells. There was marked increase in VEGF mRNA expression in DL cells than in normal thymic cells. Melatonin (1 mM for 24 h) treatment led to suppression of VEGF expression (Figure 9(a)). Similarly, FGF mRNA expression in DL cells was also found to be more than normal thymic cells, which decreased with melatonin treatment (Figure 9(a)). In the mouse model, mesentery is the thinnest tissue showing change in perivascular angiogenic growth in the presence of tumor. So, we also analyzed the mesentery of normal, DL-bearing, and melatonin-treated DL mice for expression of VEGFR and TIMP3 mRNA. Melatonin treatment significantly reduced the VEGFR expression, whereas TIMP3 expression was found to be increased significantly with melatonin treatment (Figure 9(c)). The qRT-PCR results further corroborated RT-PCR data. There was significant increase in VEGF and FGF expression in DL cells as compared to normal thymic cells, whereas the TIMP3 levels were relatively low. With melatonin treatment the expression of VEGF and FGF reduced significantly (p ≥ 0.001), which was very much comparable with the control and dexamethasone groups (Figure 9(b(i)) and (b(ii))). On the contrary the melatonin treatment resulted in increase in the expression of TIMP3 to a significant level (p ≥ 0.05) (Figure 9(b(iii))). The mesentery tissue also showed high VEGFR expression in DL-bearing groups (p ≥ 0.001) and melatonin caused significant reduction in VEGFR expression (p ≥ 0.01) almost to that of control (Figure 9(d(i))). The TIMP3 expression, which was reduced in DL-bearing mice (p ≥ 0.05), was found to be induced to a significant level (p ≥ 0.001) (Figure 9(d(ii))) with melatonin treatment. Change in pro and anti- angiogenic genes VEGF, VEGFR, FGF and TIMP3 mRNA expression in DL cells and mesentery with melatonin treatment suggested that melatonin may regulate angiogenesis at transcriptional level in both in vitro and in vivo conditions.

OPEN IN VIEWER

Figure 9.

Effect of melatonin on expression of VEGF, FGF, and TIMP3 in DL cells and VEGFR and TIMP3 in mesentery. (a) Gel electrophoresis photomicrograph of RT-PCR products and (b) qRT-PCR analysis of DL cells (2 × 10⁶ cells/mL) grown with or without melatonin (24 h) for mRNA expression of VEGF, FGF, and TIMP3 genes. (c) Gel electrophoresis photomicrograph with RT-PCR products and (d) qRT-PCR analysis of mesentery tissue obtained from control, DL-bearing, and DL-bearing melatonin-treated mice for expression of VEGFR and TIMP3 mRNA. mRNA was analyzed by semiquantitative RT-PCR and qRT-PCR as described in section “Materials and methods.” GAPDH was taken as endogenous control for RT-PCR. Fold change of the target mRNAs was normalized with that of β-actin in qRT-PCR. Values are indicated as the mean ± SD. (b(i), b(ii), b(iii), d(i), and d(ii)) Graphs showing fold change in mRNA expression of various genes.