Intervention Study on the Regulation of circAno6/miR-296-3p/TLR4 Signaling Axis by Shugan Jianpi Formula to Alleviate Inflammation Cascade and Inhibit HSC Activation

Abstract

Liver fibrosis (LF) is a fibrotic and inflammatory condition resulting from chronic liver damage, and the activation of hepatic stellate cells (HSCs) is the central event. Our prior research has revealed that the circAno6/miR-296-3p/Toll-like receptor (TLR4) pathway is a key signaling axis in the pathogenesis of LF. Shugan Jianpi Formula (SGJPF) is a traditional Chinese medicinal treatment widely used to treat LF. We hypothesized that SGJPF exerts anti-LF effects by modulating the circAno6/miR-296-3p/TLR4 signaling axis, attenuating inflammatory responses, and inhibiting HSC activation, thereby ultimately mitigating LF. In this study, an SGJPF extraction solution was first prepared and administered to rats via gavage at a specified dosage. Blood samples were subsequently collected from the abdominal aorta to prepare SGJPF-containing serum. Optimal SGJPF intervention conditions were determined using the Cell Counting Kit-8 assay. Flow cytometry was used to assess JS-1 cell cycle progression. The levels of interleukin-1 beta (IL-1β) and IL-18 were measured by enzyme-linked immunosorbent assay. The expression levels of collagen type I (collagen I), α-smooth muscle actin (α-SMA), circAno6, TLR4, miR-296-3p, and NOD-like receptor protein 3 (NLRP3) were evaluated using Western blotting, immunofluorescence, and real-time quantitative polymerase chain reaction. The results indicated that the optimal intervention condition involved serum containing 20% SGJPF, which was administered for a duration of 48 h. SGJPF-containing serum has been shown to reduce the viability of JS-1 cells and decrease the cell count in the G2 + S phase, thereby affecting HSC function. Furthermore, SGJPF-containing serum effectively suppressed the expression levels of NLRP3, IL-1β, IL-18, collagen I, α-SMA, circAno6, and TLR4 while upregulating miR-296-3p expression. These findings suggest that SGJPF can modulate the activity of the circAno6/miR-296-3p/TLR4 signaling axis, attenuate inflammatory responses, and inhibit HSC activation, thereby mitigating LF.

Keywords

Shugan Jianpi Formula liver fibrosis inflammatory response HSCs circAno6/miR-296-3p/TLR4 signaling axis

Introduction

Liver fibrosis (LF), characterized by fibrotic and inflammatory processes, is a consequence of chronic liver injury (Zhang et al., 2016). Following hepatic damage, inflammatory cytokines stimulate the activation and transdifferentiation of hepatic stellate cells (HSCs) into myofibroblasts. These myofibroblasts subsequently produce collagen type I (collagen I) and α-smooth muscle actin (α-SMA), thereby facilitating the progression of LF (Chen et al., 2022; Liu et al., 2022).

As a novel form of endogenous noncoding RNA, circular RNAs (circRNAs) exhibit highly conserved and tissue-specific expression patterns and are involved in the regulation of transcription, translation, protein modification, and other processes (Li et al., 2023; Zhang et al., 2023). A substantial body of evidence indicates that circRNAs are significantly involved in the onset and progression of LF through mechanisms such as inflammatory damage, the activation of HSCs, and the acceleration of the fibrotic process (Jin et al., 2023; Xu et al., 2023). On the basis of our previous research, the pathway involving miR-296-3p and Toll-like receptor 4 (TLR4), in conjunction with circAno6, may serve as a regulatory mechanism that impacts the inflammatory response, which, in turn, leads to the activation of HSCs. Consequently, targeting circAno6 might be a promising therapeutic strategy for the treatment of LF (Li et al., 2024).

Shugan Jianpi Formula (SGJPF), also known as “Gan Le granule” or “Gan Le infusion,” was developed by the First Affiliated Hospital of Anhui University of Chinese Medicine for the treatment of LF (Jiang et al., 2017a). SGJPF is composed of 11 distinct herbs. To ensure quality, a fingerprint profile of the SGJPF extracts was established utilizing ultra-performance liquid chromatography in our previous study. Comprehensive details can be found in the Supplementary Data. SGJPF has been demonstrated to reduce inflammatory factor levels and inhibit both the activation and apoptosis of HSCs (Fan et al., 2020; Zhou et al., 2025). Furthermore, our previous research revealed that SGJPF mitigated LF induced by CCL4 in both mice and rats (Jiang et al., 2017a). These findings suggest that SGJPF may have therapeutic potential for the treatment of LF. However, the precise mechanisms through which SGJPF exerts its therapeutic effects on LF remain largely unclear.

Accordingly, the aim of this study was to investigate the potential mechanism by which SGJPF modulates the circAno6/miR-296-3p/TLR4 signaling axis, reduces proinflammatory factor production, and prevents the overactivation of HSCs, which could offer therapeutic benefits for LF therapy.

Materials and Methods

Cell culture

JS-1 mouse HSCs were obtained from Hunan Fenghui Biotechnology Co., Ltd., and cell culture techniques were conducted in accordance with established protocols (Zhang et al., 2020). To activate the JS-1 cells for modeling purposes, they were maintained in medium supplemented with 10 ng/mL transforming growth factor-β1 for 48 h (Peng et al., 2018).

Preparation of medicinal serum

Healthy male specific pathogen-free (SPF) Sprague–Dawley (SD) rats, each weighing ∼200 g with a tolerance of ± 20 g, were obtained from Liaoning Changsheng Biotechnology Co., Ltd. (SCXK2020-0001). All animal experiments were approved by the Experimental Animal Ethics Committee of Anhui University of Chinese Medicine (Ethics Approval No. AHUCM-rats-2024011). Thirty SPF-grade male SD rats were randomly assigned to a blank group (n = 10) and an SGJPF drug-containing serum group (n = 20). The rats in the SGJPF group were gavaged at 20 times the clinical dose, with 2 mL per 100 g given daily for 7 days. One hour after the final administration, the drug-containing serum was prepared according to the method described in the literature (Liu et al., 2025; Zhou et al., 2025). Finally, the serum was inactivated for 30 min in a water bath set to 56°C.

Cell Counting Kit-8

Cell Counting Kit-8 (CCK8) test kits (Servicebio, G4103) were used to evaluate the cell viability of normal resting HSCs and activated HSCs according to the manufacturer’s instructions.

Flow cytometric analysis

The cells were preserved in 90% ethanol at −20°C for 1 h after being rinsed with phosphate-buffered saline (PBS). The subsequent step involved washing the cells three times with PBS and resuspending them in a staining solution of propidium iodide and RNase, including 20 μL of RNase A. Prior to analysis using a BD LSRII flow cytometer, the samples were incubated for 30 min at 37°C. The resulting data were analyzed using FlowJo version 10.

Enzyme-linked immunosorbent assay

The levels of interleukin (IL)-1β and IL-18 present in the supernatants of the cell culture media were quantified using specific enzyme-linked immunosorbent assay kits designed for these cytokines. The kits employed in this study were RX203063M (for IL-1β) and RX203064M (for IL-18), which were obtained from RuiXin Biotech. All measurements were performed strictly according to manufacturer’s protocols to ensure the accuracy and reliability of the results obtained.

Real-time quantitative polymerase chain reaction

TRIzol (Invitrogen) was used to extract total RNA. The relative quantification system and the 2^−ΔΔCt method were used for gene expression analysis, with β-actin as the reference gene. Primer Premier 5.0 software was used to design primers for NOD-like receptor protein 3 (NLRP3), collagen I, α-SMA, TLR4, and circAno6, whereas the stem–loop method was employed to design miR-296-3p primers. The primers used for PCR are listed in Table 1.

Table 1.

The Primer Sequence

Gene	Amplicon size	Forward primer	Reverse primer
NLRP3	141	ATTACCCGCCCGAGAAAGG	TCGCAGCAAAGATCCACACAG
Collagen I	88	AACTGGTACATCAGCCCGAA	TTCCGTACTCGAACGGGAAT
α-SMA	102	GTCCCAGACATCAGGGAGTAA	TCGGATACTTCAGCGTCAGGA
TLR4	170	AAGTGGCCCTACCAAGTCTC	CTGCAGCTCTTCTAGACCCA
circAno6	141	GCTGGGCTATTACACGCAGA	CAGCCCATGGCAGATAAGGT
miR-296-3p	60	GAGGGTTGGGTGGAGGATAT	AGTGCAGGGTCCGAGGTATT
U6	70	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
β-actin	120	AGTGTGACGTTGACATCCGT	TGCTAGGAGCCAGAGCAGTA

α‐SMA, α‐smooth muscle actin; NLRP3, NOD‐like receptor protein 3; TLR4, Toll‐like receptor.

Western blotting

Cells were lysed in radioimmunoprecipitation assay (RIPA) buffer and subjected to centrifugation, followed by protein separation via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). The proteins were then transferred to polyvinylidene fluoride (PVDF) membranes to obtain total protein. The membranes were incubated overnight with primary antibodies specific for several proteins, including β-actin, collagen I, NLRP3, TLR4, and α-SMA. The concentrations used for these antibodies were 1:1000 for β-actin, 1:500 for collagen I, NLRP3, and TLR4, and 1:2000 for α-SMA. Prior to this incubation, the membranes were treated with a blocking solution containing 5% skim milk powder for 2 h to prevent nonspecific binding. The secondary antibody was incubated following the same protocol and proportion for a duration of 2 h. Subsequently, the enhanced chemiluminescence (ECL) luminescent solution was prepared at a 1:1 ratio and applied to the PVDF membrane, and the signals were analyzed using the appropriate instrumentation.

Immunofluorescence experiments

The cells were fixed with a 4% paraformaldehyde solution at room temperature for 10 min. After fixation, the cells were permeabilized for 15 min. To avoid nonspecific antibody binding in later stages, a blocking solution containing 5% goat serum diluted in PBS was applied to the cells at room temperature for 1 h. Afterward, the cells were incubated with the primary antibody, followed by the application of the secondary antibody. The cell nuclei were stained using 4,6-diamidino-2-phenylindole, after which the cells were washed twice with PBS. After being mounted with DABCO (Sigma-Aldrich), the samples were subsequently examined using confocal laser scanning microscopy at 568 nm (Olympus, Tokyo, Japan).

Statistical analysis

Statistical analysis of the data was conducted using SPSS Statistics version 25.0, and the findings are expressed as the mean values accompanied by their respective standard deviations. To assess differences between two groups, a Student’s t-test was carried out. Furthermore, for comparisons involving multiple groups, a one-way analysis of variance was applied. A p value < 0.05 was considered indicative of a statistically significant difference in the results.

Results

Screening for the optimal concentration and treatment time of SGJPF-containing medicinal serum

According to the results of the CCK-8 assay, SGJPF-containing serum exhibited inhibitory effects on the viability of HSCs at various concentrations. When analyzed at different concentrations and time intervals, the optical density (OD) values at 48 and 72 h did not show any significant difference. However, a statistically significant difference was observed between 24 and 48 h, indicating that the inhibitory effect of SGJPF-containing serum on HSCs was greatest at 48 h (Fig. 1A). Furthermore, as illustrated in Figure 1B, the IC₅₀ value of SGJPF-containing serum at 48 h was determined to be 20.3%. Consequently, a serum concentration of 20% SGJPF was identified as the optimal intervention condition for subsequent experiments following a 48-h exposure period. Notably, the selected condition (20% serum, 48 h) did not significantly affect normal resting HSCs (Supplementary Fig. S1), indicating that the subsequent observed effects were due to therapeutic inhibition rather than general cell cytotoxicity.

FIG. 1.

Screening of optimal intervention conditions of SGJPF medicinal serum. (A) OD values of HSCs in SGJPF-containing serum at different concentrations and times. (B) IC50 values of HSCs in SGJPF-containing serum at different concentrations of 48 h. HSC, hepatic stellate cell; SGJPF, Shugan Jianpi Formula.

Effect of SGJPF on the function of HSCs

To examine the effects of serum containing SGJPF on HSC viability and the cell cycle, CCK8 assays were conducted, as depicted in Figure 2A–C. Interestingly, a notable increase in HSC viability was observed in the model group compared with the control group, along with a marked decrease in the number of cells present in the G1 phase of the cell cycle. In contrast, compared with the model group, HSC viability in the SGJPF-containing serum and sh-circAno6 groups decreased by 22.6% and 34.8%, respectively. Additionally, there was a significant increase in the proportion of cells in the G1 phase, accompanied by a decrease in the proportion of cells in the G2 + S phases, which decreased by 20.1% and 28.8%, respectively.

FIG. 2.

Effect of SGJPF on the function of HSCs. (A) The effect of SGJPF on the viability of HSCs. (B, C) Flow cytometry detection of cell cycle and quantitative statistics. (D–H) The protein and mRNA level of α-SMA by IF (×200), RT-qPCR, and WB. (I–M) The protein and mRNA level of collagen I by IF (×200), RT-qPCR, and WB. Vs the control group (^## p < 0.01), Vs the model group (^** p < 0.01). The same below. IF, immunofluorescence; RT-qPCR, real-time quantitative polymerase chain reaction; WB, Western blotting.

The outcomes of the IF, real-time quantitative polymerase chain reaction (RT-qPCR), and Western blotting (WB) assays are shown in Figure 2D–H. Compared with the control group, the model group demonstrated a marked increase in the fluorescence intensity as well as mRNA and protein expression levels. In contrast, compared with the model group, the groups treated with serum containing SGJPF and sh-circAno6 showed significant decreases in α-SMA fluorescence intensity as well as mRNA and protein expression levels. A similar pattern was observed for collagen I, as illustrated in Figure 2I–M.

Effect of SGJPF on inflammatory markers

As illustrated in Figure 3A–E, compared with the control group, the model group had significantly higher NLRP3 fluorescence intensity, as well as elevated mRNA and protein expression levels. In contrast, compared with the model group, both the SGJPF-containing serum group and the sh-circAno6 group exhibited significant decreases in NLRP3 fluorescence intensity as well as mRNA and protein expression levels. Figure 3F–G illustrates that compared with the control group, the levels of IL-1β and IL-18 were significantly increased in the model group, whereas the levels in the SGJPF-containing serum and sh-circAno6 groups were significantly reduced compared with the model group.

FIG. 3.

Effect of SGJPF on inflammatory markers. (A, B) The level of NLRP3 by IF (×200) and IF semiquantitative analysis. (C) The level of NLRP3 mRNA by RT-qPCR. (D, E) WB detection of NLRP3 protein expression. (F, G) The effect of SGJPF on IL-1β and IL-18. IL, interleukin; NLRP3, NOD-like receptor protein 3.

Effect of SGJPF on the circAno6/miR-296-3p/TLR4 signaling axis

The findings from the RT-qPCR analysis revealed a significant increase in circAno6 levels in the model group along with a considerable decrease in the expression of miR-296-3p. In contrast, compared with the model group, both the SGJPF-containing serum group and the sh-circAno6 group exhibited significantly lower circAno6 levels. Conversely, a notable increase in miR-296-3p expression levels was detected in these groups (Fig. 4A, B). IF, RT-qPCR, and WB assays revealed significant increases in TLR4 fluorescence intensity as well as mRNA and protein expression levels in the model group. However, different trends were observed between the SGJPF-treated and sh-circAno6 groups (Fig. 4C–G).

FIG. 4.

Effect of SGJPF on circAno6/miR-296-3p/TLR4 signaling axis. (A, B) Effect of SGJPF on the level of circAno6 and miR-296-3p. (C, D) The level of TLR4 by IF (×200) and IF semiquantitative analysis. (E) The level of TLR4 mRNA by RT-qPCR. (F, G) WB detection of TLR4 protein expression. TLR, toll-like receptor.

SGJPF can rescue the effects of circAno6 overexpression on HSC function and inflammatory reactions

Finally, to investigate whether SGJPF can rescue HSC function and the inflammatory response by regulating circAno6, we conducted a recovery experiment. Notably, as illustrated in Figure 5A–E, both the model group and the pc-circAno6 groups exhibited an increase in cell viability, whereas the overexpression group that received SGJPF treatment reversed this trend. Furthermore, flow cytometry analysis indicated that SGJPF effectively rescued cell cycle arrest in the G2 + S phase induced by circAno6 overexpression. Moreover, SGJPF significantly reduced the levels of the inflammatory cytokines IL-1β and IL-18, thereby alleviating the inflammatory response.

FIG. 5.

SGJPF can rescue the effects of overexpression of circAno6 on the HSC function and inflammatory reaction. (A) Effect of SGJPF on the cell viability of HSC cells in circAno6 overexpression state. (B, C) Quantitative cell cycle statistics and flow cytometry detection of cell cycle. (D, E) Effect of SGJPF on the level of IL-1β and IL-18 in circAno6 overexpression state. Vs the pc-circAno6 group (^△ p < 0.05; ^△△ p < 0.01).

Discussion

Traditional Chinese medicine(TCM) has long been utilized as a therapeutic strategy for addressing LF (Tao et al., 2019). Notably, owing to its comprehensive approach and syndrome differentiation, TCM presents distinct advantages in LF management (Jiang et al., 2017b). The SGJPF, a classical TCM formulation, is composed of Chaihu (CH, Bupleuri Radix), Baishao (BS, Paeoniae Radix Alba), Zelan (ZeL, Lycopus lucidus Turcz), Baizhu (BZ, Atractylodis Macrocephalae Rhizoma), Fuling (FL, Poria), Huangqi (HQ, Astragali Radix), Yiyi Ren (YYR, Coicis Semen), Banlan Gen (BLG, Isatidis Radix), Yinchen (YC, Artemisiae Scopariae Herba), Zhuling (ZL, Polyporus), and Zhiqiao (ZQ, Aurantii Fructus) and has been extensively utilized in the clinical treatment of liver disorders. This investigation revealed that, by regulating the circAno6/miR-296-3p/TLR4 signaling axis, SGJPF can inhibit the production of proinflammatory factors and prevent excessive activation of HSCs, potentially explaining its mechanism in LF treatment.

First, our experimental results revealed that SGJPF significantly reduced the viability of HSCs and increased the proportion of HSCs in the G1 phase of the cell cycle. These observations suggest that SGJPF can inhibit both cell viability and proliferation. Considering the well-established link between LF and the activation and proliferation of HSCs, it is evident that the activation of HSCs results in the upregulation of α-SMA expression and overproduction of collagen, thereby aggravating the progression of LF (Carson et al., 2018). Subsequently, we found that SGJPF-containing serum can significantly reduce the levels of α-SMA and collagen I.

Numerous studies have established a significant association between circRNAs and the occurrence and progression of LF (Chen et al., 2017; Cheng et al., 2018; Jin et al., 2023). Specifically, circAno6 has been identified as a differentially expressed circRNA that is closely linked to LF (Zhou et al., 2019). In our previous work, we demonstrated the involvement of the circAno6/miR-296-3p/TLR4 signaling axis in triggering inflammatory responses and contributing to LF pathogenesis (Li et al., 2024). Notably, serum containing SGJPF significantly reduced the level of circAno6 expression, which indicates that SGJPF may inhibit LF through the modulation of circAno6.

MiR-296-3p is part of the miR-296 gene cluster, which is involved in regulating numerous physiological and pathological functions, such as cell growth, migration, and programmed cell death, and has been linked to the development of several diseases (Bravo-Parra et al., 2020; Wang et al., 2019). Initial experimental findings revealed the presence of a miR-296-3p binding site within the circAno6 sequence, suggesting a potential interaction between circAno6 and miR-296-3p (Li et al., 2024). Moreover, the findings indicated that SGJPF promoted miR-296-3p expression, suggesting that SGJPF exerts a regulatory effect on miR-296-3p.

TLR4 is a type I transmembrane receptor located on the cell membrane that consists of extracellular, transmembrane, and intracellular domains. It is instrumental in the pathogenesis of LF (Li et al., 2021). A substantial body of academic research has demonstrated that TLR4 is capable of initiating inflammatory responses, encouraging HSC activation and proliferation, and inducing excessive ECM production and secretion, which facilitates the onset and progression of LF (Jourdan et al., 2013; Li et al., 2021; Wu et al., 2018; Zhou et al., 2022). TLR4 is integral to the progression of LF, with evidence suggesting that inhibition of the TLR4 signaling pathway mitigates liver injury and subsequently reduces fibrosis (Liang et al., 2016; Tian et al., 2017). In this study, we discovered that SGJPF significantly reduced TLR4 expression. On the basis of previous research, it is plausible to speculate that SGJPF modulates LF by regulating the circAno6/miR-296-3p/TLR4 signaling axis.

Liver inflammation originates from the production of proinflammatory cytokines that promote the activation of HSCs and contribute to the progression of LF and cell death linked to NASH (Manne et al., 2018). Studies have indicated that IL-1β enhances LF, whereas IL-18 belongs to the IL-1 superfamily of cytokines and has a structural resemblance to IL-1β (Arend et al., 2008; Kaplanski, 2018). The NLRP3 inflammasome is essential in various liver conditions, such as fatty liver disease, drug-induced liver injury, ischemia/reperfusion damage, and fibrosis (Artlett, 2012; Henao-Mejia et al., 2012; Zhu et al., 2011). Research has provided empirical evidence indicating that the NLRP3 inflammasome activates caspase-1. This activation is a crucial step in a biochemical cascade that leads to the maturation of cytokines. Specifically, caspase-1 catalyzes the conversion of pro-IL-1β and pro-IL-18, the inactive precursors of these important inflammatory cytokines, into their active forms, IL-1β and IL-18. This process is essential for the initiation and regulation of inflammatory responses (Essam et al., 2019; Gan et al., 2022; Li et al., 2019; Tavakoli Dargani and Singla, 2019). The results of this study revealed that SGJPF significantly decreased the levels of IL-1β, NLRP3, and IL-18, indicating its potential to suppress inflammatory responses. Notably, TLR4 plays a critical role in activating the NLRP3 inflammasome by delivering a strong priming signal that facilitates the synthesis of new pro-IL-1β and increases the expression level of NLRP3. This process is vital for triggering the inflammasome and maturation of the proinflammatory cytokine IL-1β (Tsutsui et al., 2010).

Conclusion

Consequently, as depicted in Figure 6, SGJPF exerts anti-LF effects through modulation of the circAno6/miR-296-3p/TLR4 signaling axis, attenuation of inflammatory responses, and inhibition of HSC activation, thereby ultimately mitigating LF.

FIG. 6.

Mechanism diagram of regulating the circAno6/miR-296-3p/TLR4 signaling axis with SGJPF to alleviate inflammation cascade and inhibit HSCs activation.

Authors’ Contributions

Q.W. and T.L.: Writing—original draft. J.Q.: Data curation. C.F.: Supervision and funding acquisition. L.Z.: Supervision and writing—review and editing. H.J.: Funding acquisition, supervision, writing—review and editing, and conceptualization.

Footnotes

Acknowledgments

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was funded by the National Natural Science Foundation of China (grant no. 82304995) and the Natural Science Research Project of Anhui Educational Committee (grant no. 2024AH040165).

Disclosure Statement

The authors affirm that they have no recognized financial conflicts of interest or personal relationships that could have potentially influenced the research presented in this article.

Funding Information

This study was funded by National Natural Science Foundation of China (grant no. 82304995) and Natural Science Research Project of Anhui Educational Committee (grant no. 2024AH040165).

Supplemental Material

References

Arend

, Palmer

, Gabay

. IL-1, IL-18, and IL-33 families of cytokines. Immunol Rev 2008;223:20–38; doi: 10.1111/j.1600-065X.2008.00624.x

Artlett

. The role of the NLRP3 inflammasome in fibrosis. Open Rheumatol J 2012;6:80–86; doi: 10.2174/1874312901206010080

Bravo-Parra

, Arenas-Padilla

, Brcenas-Preciado

, et al. The probiotic BB12 induces MicroRNAs involved in antigen processing and presentation in porcine monocyte-derived dendritic cells. Int J Mol Sci 2020;21(3):687; doi: 10.3390/ijms21030687

Carson

, Ramm

, Robinson

, et al. Schistosome-Induced fibrotic disease: The role of hepatic stellate cells. Trends Parasitol 2018;34(6):524–540; doi: 10.1016/j.pt.2018.02.005

Chen

, Lian

, Wen

, et al. Shibi tea (adinandra nitida) and camellianin a alleviate CCl(4)-induced liver injury in C57BL-6J mice by attenuation of oxidative stress, inflammation, and apoptosis. Nutrients 2022;14(15):3037; doi: 10.3390/nu14153037

Chen

, Yuan

, Wu

, et al. Microarray profiling of circular RNAs and the potential regulatory role of hsa_circ_0071410 in the activated human hepatic stellate cell induced by irradiation. Gene 2017;629:35–42; doi: 10.1016/j.gene.2017.07.078

Cheng

, Xiao

, Ge

, et al. High-Throughput sequencing strategy for miR-146b-regulated circRNA expression in hepatic stellate cells. Med Sci Monit 2018;24:8699–8706; doi: 10.12659/msm.910807

Essam

, Ahmed

, Abdelsalam

, et al. Phosphodiestrase-1 and 4 inhibitors ameliorate liver fibrosis in rats: Modulation of cAMP/CREB/TLR4 inflammatory and fibrogenic pathways. Life Sci 2019;222:245–254; doi: 10.1016/j.lfs.2019.03.014

Fan

, Wu

, Zhang

, et al. A network pharmacology approach to explore the mechanisms of shugan jianpi formula in liver fibrosis. Evid Based Complement Alternat Med 2020;2020:4780383; doi: 10.1155/2020/4780383

10.

Gan

, Cai

, Tang

, et al. Inflammasomes and pyroptosis of liver cells in liver fibrosis. Front Immunol 2022;13:896473; doi: 10.3389/fimmu.2022.896473

11.

Henao-Mejia

, Elinav

, Jin

, et al. Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity. Nature 2012;482(7384):179–185; doi: 10.1038/nature10809

12.

Jiang

, Qin

, Li

, et al. Effects of shu gan jian Pi formula on rats with carbon tetrachloride-induced liver fibrosis using serum metabonomics based on gas chromatography-time of flight mass spectrometry. Mol Med Rep 2017a;16(4):3901–3909; doi: 10.3892/mmr.2017.7078

13.

Jiang

, Song

, Gao

, et al. Metabolic characterization of the early stage of hepatic fibrosis in rat using GC-TOF/MS and multivariate data analyses. Biomed Chromatogr 2017b;31(6); doi: 10.1002/bmc.3899

14.

Jin

, Guo

, Zhang

, et al. Hsa_circ_0072765 knockdown inhibits proliferation, activation and migration in transforming growth Factor-Beta (TGF-β)-induced hepatic stellate cells (HSCs) by the miR-197-3p/TRPV3 axis. Histol Histopathol 2023;38(11):1295–1306; doi: 10.14670/hh-18-586

15.

Jourdan

, Godlewski

, Cinar

, et al. Activation of the Nlrp3 inflammasome in infiltrating macrophages by endocannabinoids mediates beta cell loss in type 2 diabetes. Nat Med 2013;19(9):1132–1140; doi: 10.1038/nm.3265

16.

Kaplanski

. Interleukin-18: Biological properties and role in disease pathogenesis. Immunol Rev 2018;281(1):138–153; doi: 10.1111/imr.12616

17.

, Mi

, Yan

, et al. Characterization of circSCL38A1 as a novel oncogene in bladder cancer via targeting ILF3/TGF-β2 signaling axis. Cell Death Dis 2023;14(1):59; doi: 10.1038/s41419-023-05598-2

18.

, Ye

, Zhang

, et al. Purification and characterization of a novel pentadecapeptide from protein hydrolysates of cyclina sinensis and its immunomodulatory effects on RAW264.7 cells. Mar Drugs 2019;17(1):30; doi: 10.3390/md17010030

19.

, Chu

, Wang

. MicroRNA-16 regulates lipopolysaccharide-induced inflammatory factor expression by targeting TLR4 in normal human bronchial epithelial cells. Exp Ther Med 2021;22(3):982; doi: 10.3892/etm.2021.10414

20.

, Ma

, Fan

, et al. The circAno6/miR-296-3p/TLR4 signaling axis mediates the inflammatory response to induce the activation of hepatic stellate cells. Gene 2024;920:148497; doi: 10.1016/j.gene.2024.148497

21.

Liang

, Yang

, Yu

, et al. Babao dan attenuates hepatic fibrosis by inhibiting hepatic stellate cells activation and proliferation via TLR4 signaling pathway. Oncotarget 2016;7(50):82554–82566; doi: 10.18632/oncotarget.12783

22.

Liu

, Zeng

, Zhu

, et al. Shenling tongqiao powder targets TGF-β1/Smad-Wnt/β-catenin axis to suppress epithelial-mesenchymal transition in chronic rhinosinusitis. Phytomedicine 2025;145:157065; doi: 10.1016/j.phymed.2025.157065

23.

Liu

, Han

, Xu

, et al. Antibody-drug conjugates targeting CD248 inhibits liver fibrosis through specific killing on myofibroblasts. Mol Med 2022;28(1):37; doi: 10.1186/s10020-022-00460-1

24.

Manne

, Handa

, Kowdley

. Pathophysiology of nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. Clin Liver Dis 2018;22(1):23–37; doi: 10.1016/j.cld.2017.08.007

25.

Peng

, Yang

, Huang

, et al. Salvia miltiorrhiza ameliorates liver fibrosis by activating hepatic natural killer cells in vivo and in vitro . Front Pharmacol 2018;9:762; doi: 10.3389/fphar.2018.00762

26.

Tao

, Tian

, Chen

, et al. Network pharmacology-based prediction of the active compounds, potential targets, and signaling pathways involved in danshiliuhao granule for treatment of liver fibrosis. Evid Based Complement Alternat Med 2019;2019:2630357; doi: 10.1155/2019/2630357

27.

Tavakoli Dargani

, Singla

. Embryonic stem cell-derived exosomes inhibit doxorubicin-induced TLR4-NLRP3-mediated cell death-pyroptosis. Am J Physiol Heart Circ Physiol 2019;317(2):H460–Hh471; doi: 10.1152/ajpheart.00056.2019

28.

Tian

, Li

, Shen

, et al. Protective effects of morin on lipopolysaccharide/d-galactosamine-induced acute liver injury by inhibiting TLR4/NF-κB and activating Nrf2/HO-1 signaling pathways. Int Immunopharmacol 2017;45:148–155; doi: 10.1016/j.intimp.2017.02.010

29.

Tsutsui

, Imamura

, Fujimoto

, et al. The TLR4/TRIF-Mediated activation of NLRP3 inflammasome underlies endotoxin-induced liver injury in mice. Gastroenterol Res Pract 2010;2010:641865; doi: 10.1155/2010/641865

30.

Wang

, Chen

, Zhang

. miR-296-3p targets APEX1 to suppress cell migration and invasion of non-small-cell lung cancer. Oncol Lett 2019;18(3):2612–2618; doi: 10.3892/ol.2019.10572

31.

, Wang

, Yang

, et al. Toll-like receptor 4 and its associated proteins as prognostic factors for HCC treated by post-radiotherapy surgery. Oncol Lett 2018;15(6):9599–9608; doi: 10.3892/ol.2018.8583

32.

, Chen

, Zhu

, et al. Myc-mediated circular RNA circMcph1/miR-370-3p/Irak2 axis is a progressive regulator in hepatic fibrosis. Life Sci 2023;312:121182; doi: 10.1016/j.lfs.2022.121182

33.

Zhang

, Yuan

, He

, et al. Liver fibrosis and hepatic stellate cells: Etiology, pathological hallmarks and therapeutic targets. World J Gastroenterol 2016;22(48):10512–10522; doi: 10.3748/wjg.v22.i48.10512

34.

Zhang

, Dong

, Xu

, et al. SWI/SNF complex subunit BAF60a represses hepatic ureagenesis through a crosstalk between YB-1 and PGC-1α. Mol Metab 2020;32:85–96; doi: 10.1016/j.molmet.2019.12.007

35.

Zhang

, Yang

, Han

, et al. Differential methylation of circRNA m6A in an APP/PS1 Alzheimer’s disease mouse model. Mol Med Rep 2023;27(2):55; doi: 10.3892/mmr.2023.12942

36.

Zhou

, Sun

, Jin

, et al. Erratum: Dual feedforward loops modulate type I interferon responses and induce selective gene expression during TLR4 activation. iScience 2022;25(8):104748; doi: 10.1016/j.isci.2022.104748

37.

Zhou

, Zhang

, Chen

, et al. Shugan jianpi formula attenuate liver fibrosis via regulation of miR-193a-3p/TGF-β2 in hepatic stellate cells: An in vivo and in vitro study. J Ethnopharmacol 2025;340:119120; doi: 10.1016/j.jep.2024.119120

38.

Zhou

, Lv

, Qu

, et al. Differential expression of circular RNAs in hepatic tissue in a model of liver fibrosis and functional analysis of their target genes. Hepatol Res 2019;49(3):324–334; doi: 10.1111/hepr.13284

39.

Zhu

, Duan

, Chen

, et al. Gene silencing of NALP3 protects against liver ischemia-reperfusion injury in mice. Hum Gene Ther 2011;22(7):853–864; doi: 10.1089/hum.2010.145

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.18 MB