Silencing Long Noncoding RNA CRNDE Alleviates Hypoxia-Induced Myocardial Cell Injury by Inhibiting the NLRP3/ASC Pathway

Abstract

Myocardial ischemia-induced cell injury involves the concurrent occurrence of pyroptosis, apoptosis, and oxidative stress, whereas its upstream regulatory mechanism remains unclear. The present study aimed to investigate the functional association between long noncoding RNA CRNDE and the NLRP3/ASC pathway in H9c2 cardiomyocytes subjected to hypoxia-induced injury. Using H9c2 cardiomyocytes as the research model, a hypoxia-induced injury model was constructed, shRNA-mediated knockdown of CRNDE was performed, and functional rescue experiments were conducted in combination with an NLRP3 agonist. Results showed that hypoxia treatment significantly upregulated the expression level of CRNDE in H9c2 cells, and this upregulation was significantly positively correlated with the activation of the NLRP3/ASC pathway. Knockdown of CRNDE specifically inhibited the mRNA and protein expression of key molecules in the NLRP3/ASC pathway (NLRP3, ASC, Caspase-1, GSDMD); reduced the secretion of inflammatory factors IL-1β and IL-18; decreased the cell apoptosis rate; and improved oxidative stress imbalance. RNA FISH assay confirmed that CRNDE was localized in the cytoplasm of H9c2 cells; knockdown of CRNDE alleviated hypoxia-induced mitochondrial damage, G1/S phase cell cycle arrest, and impairment of cell membrane integrity, and the above protective effects could be reversed by the NLRP3 agonist. In conclusion, CRNDE is closely associated with hypoxia-induced cardiomyocyte injury, and its effects in mediating pyroptosis, apoptosis, and oxidative stress rely on activation of the NLRP3/ASC pathway. Targeting CRNDE may provide a supplementary strategy for the treatment of myocardial ischemia-related diseases.

Keywords

myocardial hypoxia NLRP3/ASC pathway pyroptosis oxidative stress apoptosis

Introduction

Myocardial ischemia is a major cause of death in failing hearts, with hypoxia-induced cell injury as its core pathological event (Pagliaro et al., 2020). Both clinical and experimental studies have demonstrated that this injury is not a single pathological process but a synergistic amplification of pyroptosis, apoptosis, and oxidative stress (Li et al., 2025; Liang et al., 2021; Wang et al., 2024). Specifically, NLRP3/ASC inflammasome-mediated pyroptosis triggers an inflammatory cascade, which further promotes mitochondrial dysfunction and oxidative stress, ultimately accelerating cardiomyocyte apoptosis (Lin et al., 2021; Sun et al., 2019; Zhou et al., 2011). However, the upstream-related factor integrating these multiple injury pathways remains elusive, hampering the development of effective therapeutic strategies.

Long noncoding RNAs (lncRNAs) have emerged as key regulators in the pathophysiological processes of cardiovascular diseases by regulating signaling pathways at the transcriptional and posttranscriptional levels (Song et al., 2019; Yue et al., 2022). Previous studies have reported that lncRNA CRNDE is significantly upregulated in various diseases and contributes to cell survival, inflammation, and apoptosis (Jiang et al., 2023; Sun et al., 2022). However, the role of CRNDE in hypoxic myocardial injury remains unexplored. Our preliminary experiments showed that CRNDE exhibits a significant upregulation in hypoxic H9c2 cells, and its expression trend is highly consistent with the activation of the NLRP3/ASC pathway and the release of lactate dehydrogenase (LDH), a marker of cell injury. This suggests that CRNDE may act as an upstream activator of the NLRP3/ASC pathway, synergistically driving pyroptosis, apoptosis, and oxidative stress in hypoxic cardiomyocytes. Although the core role of lncRNA CRNDE in the pathophysiological regulation of cardiomyocytes has been partially confirmed by previous studies—with evidence that it participates in key processes such as cardiomyocyte apoptosis and proliferation by regulating specific signaling axes—these studies still have significant limitations (Chen et al., 2024; Qiu et al., 2017; Xu et al., 2023; Zhu et al., 2021). However, these studies remain insufficient. Meanwhile, the cascade reactions of pyroptosis, apoptosis, and oxidative stress mediated by the NLRP3/ASC inflammasome have been confirmed as the key molecular mechanisms underlying hypoxia-induced cardiomyocyte injury (Liu et al., 2024; Qi et al., 2022; Zheng et al., 2025). However, the potential association between CRNDE and the NLRP3/ASC inflammasome pathway in this pathological context remains unaddressed, and the specific role of upstream lncRNA factors such as CRNDE in molecular events upstream of the NLRP3/ASC pathway has not been systematically elucidated. This knowledge gap limits further understanding of hypoxic myocardial injury and impedes the development of targeted therapeutic strategies.

Based on the above research status, this study focuses on the key scientific question of the “CRNDE-NLRP3/ASC axis,” aiming to characterize the expression profile of lncRNA CRNDE in hypoxia-induced cardiomyocyte injury, determine its functional involvement in the NLRP3/ASC inflammasome and downstream pyroptosis, apoptosis, and oxidative stress pathways, and explore the associated molecular events. The results of this study are expected to enrich the molecular network of lncRNA-regulated hypoxic myocardial injury, offer supplementary evidence for exploring upstream factors related to the NLRP3/ASC pathway, and provide a preliminary experimental basis for developing potential intervention strategies in the targeted therapy of myocardial ischemia-related diseases.

Methods

The culture and hypoxia-induced treatment of H9c2 cells

H9c2 cells were obtained from Procell Life Science & Technology Co., Ltd. (CL-0089) and cultured in high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Procell) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin at 37°C with 5% CO₂ and constant humidity.

To construct hypoxia-injured cells, H9c2 cells were digested by 1 mL of 0.25% trypsin for 90 s, after the cell fusion rate reached 80–90% confluence. The reaction was terminated with complete medium, and cells were subcultured at a ratio of 1:3 split ratio. Logarithmic-phase cells were seeded into 6-well plates at 5 × 10⁵ cells per well and transferred to a tri-gas incubator after 18 h. Cells were exposed to 0% O₂, 95% N₂, and 5% CO₂ for 8 h (Lindsey ML et al., 2018). This anoxic condition (0% O₂) is widely used to mimic severe myocardial ischemia/hypoxia injury in vitro. Hypoxic injury was induced in the model group. Cells in the control group were cultured under standard normoxic conditions throughout the experiment. The NLRP3 agonist group was treated with 10 μM NLRP3 agonist (MCE, Cat. No. HY-156413) for 24 h after hypoxia exposure. Only the 3rd–8th generation cells were selected for the experiment.

Cell transfection

Knockdown sequences of lncRNA CRNDE were designed and prepared by General Biol. Cell transfection was performed using KeygenMAX 3000 transfection reagent according to the manufacturer’s instructions. H9c2 cells were seeded at 5 × 10⁵ cells per well 1 day before transfection. When cell confluence reached 30%, sh-CRNDE lentivirus and 5 μg/mL Polybrene were added. The medium was replaced after 8–12 h, and cells were subjected to continuous selection with 2 μg/mL puromycin for 7 days after 72 h. After transfection, cells were harvested for quantitative real-time polymerase chain reaction analysis to examine knockdown efficiency.

Detection of cell proliferation by CCK8 assay

H9c2 cells were grown in 96-well plates at 1 × 10⁵ cells/mL (200 μL/well). Followed by 24 h of reoxygenation, cells were treated with CCK-8 reagent (Solarbio, CA1210) for another 2 h. The optical density value at 450 nm was determined using a microplate reader (Thermo Fisher, USA).

Measurement of reactive oxygen species generation

Intracellular reactive oxygen species (ROS) levels were assayed by the fluorescent probe dichloro-dihydrofluorescein diacetate (DCFH-DA) (Solarbio). After the introduction of different stimuli, cells were incubated with DCFH-DA, which was diluted 1:5000 in serum-free DMEM, at 37°C for 60 min in the dark. Then, the cells were washed three times using cold Phosphate-Buffered Saline (PBS), and 0.5 mL of PBS was added to each well. The fluorescence images of intracellular ROS were acquired using fluorescence microscopy (Nikon, Japan). The average fluorescence intensity was analyzed by using an image analysis system (ImageJ, National Institutes of Health).

Cell cycle detection by flow cytometry

Cell cycle was determined using propidium iodide (PI) staining kit (Solarbio, China). H9c2 cells were digested by trypsin and centrifuged at 189 × g for 5 min. After different stimulation, cells were washed by pre-cooled PBS and fixed with 70% cold ethanol at 4°C overnight. Following centrifugation, 500 μL of PI/RNase staining solution (Solarbio, China) was added, and cells were incubated for 30 min in the dark. A total of 20,000 cells were collected by flow cytometry (Agilent, USA), and the proportions of cells in G0/G1, S, and G2/M phases were analyzed using FlowJo software.

Apoptosis detection by flow cytometry

Apoptosis was determined using Annexin V-FITC/propidium iodide (PI) double staining kit (Solarbio, China). Directly, cells were digested by trypsin and centrifuged at 189 × g for 5 min. After being resuspended with precold PBS, cells were treated with 5 μL Annexin V- FITC and 5 μL PI staining for 20 min in the dark. Apoptosis rate was analyzed using the flow cytometer (Agilent, USA). PI-positive cells indicate loss of cell membrane integrity, a hallmark feature associated with pyroptosis.

Location of lncRNA CRNDE RNA fluorescence in situ hybridization

To determine the cellular localization of lncRNA CRNDE, a FISH kit was assessed according to the manufacturer’s instructions (Beyotime, China) (Table 2). The sequence of the probe was designed by Fuboshengwu (Table 3). In brief, H9c2 cells were fixed in 4% paraformaldehyde and hybridized with 1 μg/mL probe in a hybridization buffer. Cells were washed with buffer and counterstained with DAPI. Images were obtained using a laser scanning microscope (Nikon, Japan).

Hochest 33342/PI double staining

After hypoxia and drug treatment, the cells were collected by trypsinization into a cell culture medium, centrifuged at 189 × g for 5 min at room temperature to collect the cell pellet, and washed twice with PBS. Then, the cells were stained with 5 μL Hoechst 33342 (10 μg/mL) and 5 μL PI (5 μg/mL) at 4°C for 30 min in the dark. The images of the cells were acquired immediately and analyzed using a fluorescence microscope (Nikon, Japan). The percentage of positive cells was counted, and the average fluorescence intensity was assessed with ImageJ software.

ELISA

Culture supernatants were collected, and the concentrations of IL-1β and IL-18 in the supernatants were assessed by enzyme-linked immunosorbent assay (ELISA) (LCSKit, China) according to the manufacturer’s instructions. The levels were normalized to cell protein concentrations.

Western blot analysis

After hypoxia and drug treatment, H9c2 cells were collected and lysed in ice-cold radio immunoprecipitation assay buffer (Beyotime, China) containing protease inhibitors phenylmethylsulfonyl fluoride (PMSF) (Beyotime, China) and protease inhibitor cocktail (Beyotime, China) and then centrifuged at 189 × g for 15 min at 4°C to harvest the supernatants. Equal amount of protein was separated by SDS-PAGE gel and transferred to polyvinylidene difluoride (PVDF) membrane. The membranes were blocked in 5% nonfat milk for 1 h at room temperature and then incubated overnight with primary antibodies against actin (Proteintech, China), NLRP3 (Proteintech, China), ASC (Abmart, China), caspase-1 (ABclonal, USA), Bcl-2 (Abmart, China), and GSDMD (Abmart, China). The membranes were subsequently incubated with fluorescent secondary antibody (Proteintech, China) for 1 h at room temperature. Then, the membranes were washed again with TBST 3 times, 5 min each time. Protein bands were analyzed using ImageJ (National Institutes of Health, USA).

Quantitative real-time PCR analysis

Total RNA was extracted from H9c2 cells using Trizol reagent (Shenzhen Biochem Biotechnology Co., China) according to the manufacturer’s instructions, and 1 μg of total RNA was reversely transcribed into cDNA using a FastKing RT Kit (Tiangen, China). Primers were synthesized by Sangon Biotech (Shanghai) (Table 1). The mRNA levels of NLRP3, ASC, GSDMD, Bcl-2, CRNDE, and Caspase-1 were performed by RT-qPCR in a 20 μL reaction system containing specific primers and FastReal qPCR PreMix (Tiangen, China). The mRNA expression levels were normalized relative to Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH). The expression of genes was analyzed by using the 2^−△△CT method.

Transmission electron microscopy

H9c2 cells were collected by centrifugation and fixed for electron microscopy and fixed at 4°C for 2–4 h. After rinsing three times with 0.1 M phosphate buffer (PB, pH 7.4), cells were preembedded in 1% agarose. Samples were postfixed in 1% OsO₄ (prepared with 0.1 M PB, pH 7.4) at room temperature for 2 h in the dark, then rinsed three times with 0.1 M PB. Dehydration was performed sequentially with graded ethanol (30 − 100%) and acetone, followed by infiltration with acetone-812 embedding medium mixtures (1:1, 1:2) and pure 812 embedding medium. Samples were polymerized at 60°C for 48 h, and 60–80 nm ultrathin sections were prepared and collected on 150-mesh Formvar-coated copper grids. Sections were stained with 2% uranyl acetate (in ethanol) for 8 min and 2.6% lead citrate (CO₂-protected) for 8 min, with rinses in 70% ethanol and ultrapure water between steps. Finally, sections were observed, and images were collected using a transmission electron microscope.

Statistical analysis

All data are represented as the mean ± standard deviation. All statistical tests were performed using GraphPad Prism version 6.0 (GraphPad Software, USA). One-way analysis of variance (One-way ANOVA) or two-way analysis of variance (two-way ANOVA) followed by Tukey’s post hoc (a Bonferroni post hoc) test was performed to analyze the differences among the experimental groups. p Values <0.05 were considered to be statistically significant.

Results

Hypoxia induces CRNDE upregulation and activates the NLRP3/ASC pathway, triggering pyroptosis, apoptosis, and oxidative stress in H9c2 cardiomyocytes

We found that hypoxia significantly increased the expression levels of lncRNA CRNDE (Fig. 1a) according to the result of RT-qPCR between the control group and model group. Next, the pyroptosis-related protein (NLRP3, ASC, GSDMD, and Caspase-1) and the antiapoptotic protein Bcl-2 were measured using Western blotting and RT-qPCR. Compared with the control group, the model group showed that the pyroptosis-related protein was significantly upregulated, while the antiapoptotic protein was sharply decreased (Fig. 1b and c). These results showed that hypoxia is associated with exacerbated H9c2 cell injury, accompanied by increased NLRP3 inflammasome activity and elevated pyroptotic cell death. To further evaluate whether the NLRP3/ASC inflammasome was activated functionally, we examined the expression of IL-1β and IL-18 (Fig. 1d). Consistent with the results for Western blotting and RT-qPCR, hypoxia was associated with markedly increased production of IL-1β and IL-18 relative to the control group.

FIG. 1.

Hypoxia induces CRNDE upregulation, activates the NLRP3/ASC pathway, and triggers pyroptosis, apoptosis, and oxidative stress in H9c2 cardiomyocytes. (a) Quantitative real-time PCR (qRT-PCR) analysis of lncRNA CRNDE expression levels in Control and Model groups. (b) Western blot (WB) analysis of pyroptosis-related proteins (NLRP3, ASC, GSDMD, caspase-1) and antiapoptotic protein Bcl-2 in Control and Model groups (molecular weights: NLRP3 108–120 KD, ASC 23 KD, GSDMD 53 KD, caspase-1 45 KD, Bcl-2 26 KD, ACTIN 42 KD). (c) qRT-PCR analysis of mRNA expression levels of pyroptosis- and apoptosis-related genes (NLRP3, ASC, GSDMD, Caspase-1, Bcl-2) in Control and Model groups. (d) Enzyme-linked immunosorbent assay (ELISA) detection of inflammatory factors IL-1β and IL-18 secretion in cell supernatants of Control and Model groups. (e) Fluorescence microscopy images and quantitative analysis of intracellular reactive oxygen species (ROS) levels (DCFH-DA staining) in Control and Model groups; magnification: 200×. (f) Quantitative analysis of oxidative stress-related indicators: superoxide dismutase (SOD) activity, lactate dehydrogenase (LDH) release, and malondialdehyde (MDA) content in Control and Model groups. (g) Cell Counting Kit-8 (CCK-8) assay for relative cell viability in Control and Model groups. Data are presented as mean ± SD. n = 3 independent experiments. ****p < 0.0001, ***p < 0.001, **p < 0.01, and *p < 0.05 vs. Control group. SD, standard deviation.

To investigate the dual effects of pyroptosis and apoptosis on H9c2 cell injury under hypoxia, we next measured cell viability, ROS level, superoxide dismutase (SOD) activity, LDH release, and malondialdehyde (MDA) content (Fig. 1e and f). The relative viability of H9c2 cells in the model group was obviously suppressed, while ROS levels were significantly increased, SOD activity was greatly decreased, and LDH release as well as MDA content were significantly elevated compared to the control group. These results show that hypoxia-induced ROS overproduction is associated with NLRP3 inflammasome activation and subsequent H9c2 cell injury. Moreover, impaired intracellular oxidative–antioxidative balance is accompanied by elevated lipid peroxidation and impaired cell membrane integrity, which causes decreased cell viability. Collectively, our findings show that hypoxia is associated with the occurrence of dual programmed cell death (pyroptosis and apoptosis) in H9c2 cells by activating the NLRP3/ASC pathway and oxidative stress injury.

Expression level and subcellular localization of lncRNA CRNDE under hypoxic conditions

To investigate the cellular localization of CRNDE and the effect of hypoxia on its expression, we assessed the distribution of CRNDE using RNA fluorescence in situ hybridization (RNA FISH). It was found that CRNDE was mainly located in the cytoplasm, suggesting that it may participate in processes related to the NLRP3/ASC pathway. Compared with the control group, the mean fluorescence intensity (MFI) in the model group was significantly upregulated, which was consistent with the upregulated trend of CRNDE expression detected by RT-qPCR (Fig. 2). This further verified that the NLRP3/ASC inflammasome pathway is activated and the apoptotic program is initiated, and lncRNA CRNDE may be closely involved in the process of hypoxic injury. Collectively, these changes mainly occur at the transcriptional level.

FIG. 2.

Subcellular localization and expression level of lncRNA CRNDE under hypoxic conditions. RNA FISH images showing the localization of CRNDE (red fluorescence) in H9c2 cells; DAPI (blue) stains the nucleus, and merged images show colocalization; magnification: 200×. Quantitative analysis of mean fluorescence intensity (MFI) of CRNDE in Control and Model groups. The upregulated trend of CRNDE expression is consistent with the results of qRT-PCR, indicating that CRNDE is mainly localized in the cytoplasm and involved in hypoxic injury. Data are presented as mean ± SD. n = 3. ***p < 0.001 versus Control group.

Verification of lentiviral transfection efficiency for lncRNA CRNDE

To determine whether there is a functional link between CRNDE and the NLRP3 inflammasome, we knocked down the expression of lncRNA CRNDE via lentiviral transfection. We selected sh-lncRNA-CRNDE (1), which exhibited higher silencing efficiency, for subsequent experiments (Fig. 3). Moreover, we exogenously added an NLRP3 agonist to perform functional rescue experiments.

FIG. 3.

Verification of lentiviral transfection efficiency for lncRNA CRNDE. qRT-PCR analysis of CRNDE expression levels in H9c2 cells after transfection with sh-control or different sh-CRNDE lentiviruses. sh-CRNDE (1) showed the highest silencing efficiency and was selected for subsequent experiments. Data are presented as mean ± SD. n = 3. *p < 0.05.

Silencing CRNDE is associated with attenuated pyroptosis and apoptosis in H9c2 cardiomyocytes by association with the NLRP3/ASC pathway

It is well known that the NLRP3 inflammasome is a multiprotein complex composed of NLRP3, ASC, and Caspase-1 and functions as the main pathway for pyroptosis and inflammatory responses during cell injury. We further analyzed molecular changes associated with hypoxia-induced H9c2 cell injury. In H9c2 cells with lncRNA CRNDE knockdown, sh-lncRNA CRNDE was associated with reduced NLRP3 inflammasome activity, as evidenced by lower protein levels of NLRP3, ASC, GSDMD, and Caspase-1. Additionally, CRNDE silencing was associated with increased expression of the antiapoptotic protein Bcl-2, along with suppressed apoptotic progression (Fig. 4a and b). Notably, the downstream effects of the inflammasome were significantly attenuated, and the secretion levels of IL-1β and IL-18 were significantly reduced in CRNDE-silenced cells, together with reduced expression of CRNDE (Fig. 4c). In H9c2 cells treated with the NLRP3 agonist combined with sh-lncRNA CRNDE, the aforementioned trends were completely reversed. These results showed that CRNDE knockdown is associated with alleviated hypoxia-induced cell injury, accompanied by decreasing the activation level of the NLRP3/ASC inflammasome and reducing the Bcl-2-mediated apoptotic response.

FIG. 4.

Silencing CRNDE alleviates pyroptosis and apoptosis in H9c2 cardiomyocytes by inhibiting the NLRP3/ASC pathway. (a) WB analysis of NLRP3/ASC pathway-related proteins (NLRP3, ASC, GSDMD, caspase-1) and antiapoptotic protein Bcl-2 in Control, Model, Model + sh-control, Model + sh-CRNDE, and Model + sh-CRNDE + NLRP3 agonist groups. (b) qRT-PCR analysis of mRNA expression levels of NLRP3, ASC, GSDMD, Caspase-1, Bcl-2, and lncRNA CRNDE in each group. (c) ELISA detection of inflammatory factors IL-1β and IL-18 secretion in cell supernatants of each group. Silencing CRNDE downregulates the protein and mRNA expression of NLRP3/ASC pathway key molecules and reduces the secretion of proinflammatory cytokines, while the NLRP3 agonist reverses these protective effects. Data are presented as mean ± SD. n = 3. ****p < 0.0001, ***p < 0.001, **p < 0.01, and *p < 0.05.

Silencing CRNDE improves hypoxia-induced myocardial cell structural damage and oxidative stress imbalance link to the NLRP3/ASC pathway

In the subsequent experiments, we detected intracellular ROS levels and key biological indicators including MDA content, LDH release, and SOD activity to evaluate the associations of CRNDE silencing on cellular structure and phenotypic changes in H9c2 cells. As shown in Figure 5a, CRNDE-silenced H9c2 cells (model + sh-lncRNA CRNDE group) exhibited significantly reduced ROS production, MDA content, and LDH release compared with the model group, in accord with increased SOD activity. In addition, treatment with the NLRP3 agonist completely reversed the aforementioned trends in CRNDE-silenced cells—ROS production, MDA content, and LDH release were increased, while SOD activity was decreased. These observations support a functional link between CRNDE, pyroptosis, apoptosis, and redox balance related to NLRP3/ASC pathway activity.

FIG. 5.

Silencing CRNDE improves hypoxia-induced myocardial cell structural damage and oxidative stress imbalance via the NLRP3/ASC pathway. (a) Quantitative analysis of oxidative stress-related indicators: SOD activity, MDA content, and LDH release in Control, Model, Model + sh-control, Model + sh-CRNDE, and Model + sh-CRNDE + NLRP3 agonist groups. (b) Fluorescence microscopy images (DCFH-DA staining) and quantitative analysis of intracellular ROS levels in each group; magnification: 200×. (c) Hoechst 33342/PI double staining images showing cell membrane integrity (scale bar: 50 μm); Hoechst 33342 (blue) stains intact nuclei, and PI (red) stains cells with impaired membrane integrity. (d) Transmission electron microscopy (TEM) images of mitochondrial structure (scale bar: 500 nm); red arrows indicate mitochondrial swelling, cristae disruption, or vacuolization. Silencing CRNDE reduces oxidative stress, maintains cell membrane integrity, and preserves mitochondrial structure, while the NLRP3 agonist reverses these protective effects. Data are presented as mean ± SD. n = 3. ****p < 0.0001, ***p < 0.001, **p < 0.01, and *p < 0.05.

FIG. 6.

Silencing CRNDE alleviates cell cycle arrest and promotes proliferation of H9c2 cardiomyocytes by regulating the NLRP3/ASC pathway. (a) Flow cytometry analysis of cell cycle distribution (G0/G1, S, G2/M phases) in each group. Quantitative analysis of G1/S phase cell ratio in each group. (b) Flow cytometry analysis of apoptosis rate (Annexin V-FITC/PI double staining) in each group. Quantitative analysis of apoptosis rate and PI-positive cell proportion in each group. Silencing CRNDE relieves hypoxia-induced G1/S phase arrest, reduces apoptosis rate, and promotes cell proliferation, while the NLRP3 agonist reverses these effects. Data are presented as mean ± SD. n = 3. *p < 0.05.

Table 1.

Primer Sequences and Related Characteristics

Primer	Sequence (5′-3′)	Length (bp)	Tm (°C)
Rat-GAPDH-F	AGGCTGTGGGCAAGGTCATC	20	60.9
Rat-GAPDH-R	TTCTCCAGGCGGCATGTCAG	20	60.7
Rat-NLRP3-F	TCACCCAAGGAGGAAGAAGAAGAG	24	58.3
Rat-NLRP3-R	TGAGGCAGCAGTTCACCAGTC	21	60.3
Rat-ASC-F	TATGGAAGAGTCTGGAGCTGTGG	23	58.5
Rat-ASC-R	AATGAGTGCTTGCCTGTGTTGG	21	55.6
Rat-GSDMD-F	CGTGTTTGTGGTGACCGAGGTG	22	61.5
Rat-GSDMD-R	ACGAGGCTCCAGGCAGTGTG	20	63.4
Rat-BCL-2-F	GTGTGTGGAGAGCGTCAACAGG	22	61.2
Rat-BCL-2-R	GGTGTGCAGATGCCGGTTCAG	21	62.2
Rat-Caspases-1-F	CGCATTTCCTGGACCGAGTGG	21	61.7
Rat-Caspases-1-R	GAGGGCAAGACGTGTACGAGTG	22	60.6
Rat-LncRNAcende-F	AATGAGTGCTTGCCTGTGTTGG	20	63.1
Rat-LncRNAcende-R	GCACAGCATCCTCGGCATCC	20	62.5

Table 2.

Information of RNA FISH Reagents and Kits

Name	Manufacturer	Item No.
RNA FISH	beyotime	R0306S
FISH probe kit	beyotime	FBFPR123

Table 3.

Sequences of IncRNA (NR_132649.1) from Rattus Norvegicus

>NR_132649.1 Rattus norvegicus colorectal neoplasia differentially expressed (Crnde), long non-coding RNA
ATGGAGACCAGAAGCGGTCCGCCGCTGAGGCGGCGGGCTGTGAGCTAGGCTGACAGGGTTGCGGAGCCGGAGCCCCGGGGAGCGTGAAGCAGCCTGAGGCTGCCTCTCCGGCTAACCATTCGGGGTTCGGGGCAGGCCGGAGTTCTACAGGGAGCGTCCCCGCCCCGACGCGCGGGTCCCCGCCTCCCGCGGCCGTACCGCCCCCCGGCTCCGCCCGCTCAGCCGGACTAACGGTCGGCGCGGCCTGCCACGAGGGAGCGTCCGCGGCCCGCGCAGAGCCGCGCACCAAGCGGATGGCGTGGACGCAGCCGGGTCGGGCGGTCTGCGTGCGAGCAGGCGCGCGTGGGCGTGTCTCCCTGGCCCACGCGTGTCCCGGACATCAGTGTCTCGGCTCTGGTCCAGGACGAAGACTTCTGAAAGCGAGCCAAGGAGAATCACAGTTCGGAACGGAGCCCCTGACTGCCTGGTGGAAGGAGGTGATTCAGAAGAGAGCGAGATTCAGTGGATGTGCCCGGGCTTCCCGAGATGTGTTTGCATCTGGATGCCGAGGATGCTGTGCACACAAGCTCTCGGGTGATGCGGCCATGGAGCTTGGAGGTGGCTGTCTGTGGACTAGAGTGTTCCCCAGTCACTGCAAAGGTGAAGTGCAGTATGTCACTAGTTCTGTTGAGGATGCTTAATTCTACAATGCATTGTTGAATATTTGCTGCTTTAGTCAAAGGATAGAAAAAGTAAAATAAATTTTATGTTATTTTTTTTCTAAAATAAAATGTCTTTATTTGATTGAATGACTATTGATGATTAAAAAGAGTTCTAAAAATT

Further Hoechst/PI double staining and transmission electron microscopy (TEM) observation revealed that hypoxia was associated with marked mitochondrial damage in H9c2 cells, manifested as mitochondrial swelling, disrupted cristae structure, and vacuolization, accompanied by impairment of cell membrane integrity and increased ROS production (Fig. 5b, c, and d). In contrast, CRNDE silencing was associated with preserved mitochondrial structure and restored cell membrane continuity. In the Model + sh-CRNDE + NLRP3 agonist group, mitochondria were again significantly damaged, and the cell membrane integrity was destroyed, confirming that CRNDE downregulation is associated with alleviated hypoxia-induced structural damage in cardiomyocytes by reducing NLRP3 inflammasome activity, protecting mitochondrial function, and maintaining cell membrane integrity.

Silencing CRNDE alleviates cell cycle arrest and promotes proliferation of H9c2 cardiomyocytes linked to the NLRP3/ASC pathway

To further characterize the changes associated with sh-lncRNA CRNDE in hypoxia-induced H9c2 cells, we performed flow cytometry analysis (Fig. 6). The results showed that with CRNDE knockdown, the apoptotic rate was sharply decreased, and the proportion of PI-positive cells was reduced. Moreover, the G1/S phase arrest was relieved, suggesting cell cycle recovery. In contrast, after activating NLRP3 with nigericin (NLRP3 agonist), these effects were completely reversed: the apoptotic rate was increased, the number of G1 phase cells was significantly increased, cell cycle progression was restricted, and cell viability was severely impaired. These results indicate that sh-lncRNA CRNDE can alleviate hypoxia-induced apoptotic response and cell cycle arrest by inhibiting NLRP3/ASC inflammasome activation, thereby regulating the cell proliferation process.

Discussion

Myocardial hypoxia-induced injury represents the core pathological process in cardiovascular diseases such as acute myocardial infarction and myocardial ischemia-reperfusion injury, characterized by excessive cardiomyocyte death (including pyroptosis and apoptosis) and dysregulated oxidative stress responses (Zhao et al., 2025). Chemoresistance and refractory injury remain major challenges impeding the efficacy of clinical interventions against these cardiovascular disorders, making the exploration of underlying regulatory mechanisms urgently warranted.

lncRNAs constitute a diverse set of noncoding transcripts that play fundamental roles in pathological processes related to cardiomyocyte injury, inflammation, and oxidative stress in cardiovascular diseases (Lin et al., 2020). lncRNA CRNDE is dysregulated in multiple disease models and verified to be a promoter in myocardial hypoxic injury (Chen et al., 2024; Zhu et al., 2021). Overexpression of CRNDE promotes pyroptosis and apoptosis of cardiomyocytes through specific signaling transduction, while targeted silencing of CRNDE has been reported to alleviate cellular damage in certain pathological contexts (Liu et al., 2023). Nevertheless, reports on the role of CRNDE in myocardial hypoxic injury and its specific regulatory targets remain limited, and the molecular mechanism by which CRNDE modulates pyroptosis and oxidative stress via the NLRP3/ASC pathway has not been fully elucidated.

In the present study, CRNDE expression was confirmed to be significantly upregulated in H9c2 cardiomyocytes exposed to hypoxic conditions, which is consistent with the dysregulated pattern of CRNDE in other pathological models. Targeted silencing of CRNDE alleviated hypoxia-induced pyroptosis, apoptosis, and oxidative stress injury, and multiple lines of evidence supported a functional link between these effects and the NLRP3/ASC pathway. First, after CRNDE knockdown, the expression of core components of the NLRP3 inflammasome (NLRP3, ASC, GSDMD, caspase-1) was significantly decreased at both transcriptional and translational levels, while the expression of the antiapoptotic protein Bcl-2 was partially recovered, indicating that the assembly of the NLRP3-ASC inflammasome was inhibited and the cellular apoptotic program was blocked. Second, the secretion of downstream proinflammatory cytokines (IL-1β, IL-18) was significantly reduced, indicating blunted inflammasome activation. Furthermore, the results of RNA FISH showed that CRNDE fluorescence signals were concentrated in the cytoplasm, where the assembly and activation of the NLRP3/ASC inflammasome precisely occur, providing a basis for their functional association. Importantly, exogenous addition of an NLRP3 agonist reversed the protective effect of CRNDE knockdown on cardiomyocytes, supporting that the impact of CRNDE on hypoxic injury is closely associated with NLRP3 activity.

Notably, the functional link between CRNDE and the NLRP3/ASC pathway is directly associated with the maintenance of cellular structural homeostasis under hypoxia. Previous results showed that mitochondrial damage, such as swelling and cristae disruption, was significantly ameliorated and cell membrane integrity was restored after CRNDE knockdown, which is closely related to mitochondrial dysfunction induced by NLRP3 inflammasome activation. Overactivation of NLRP3 impairs the mitochondrial electron transport chain and enhances ROS leakage, while the accumulation of ROS further damages mitochondrial structure and cell membrane stability. These observations support the involvement of the CRNDE-NLRP3/ASC axis in maintaining cellular structural and functional integrity during hypoxic stress.

Furthermore, oxidative stress exhibits a close association with NLRP3 inflammasome activation in myocardial hypoxic injury. Excessive ROS can trigger the assembly of the NLRP3 inflammasome by inducing mitochondrial damage and lysosomal rupture. The present study found that CRNDE silencing reduces ROS production, decreases the level of lipid peroxidation product (MDA), restores the activity of antioxidant enzyme (SOD), and inhibits the release of cell membrane damage marker (LDH); these effects can also be reversed by an NLRP3 agonist. This result implies the existence of a positive feedback loop wherein hypoxia induces CRNDE upregulation, which in turn activates the NLRP3/ASC pathway, promotes ROS overproduction, and further amplifies inflammasome activation and cell death. CRNDE may therefore represent a critical molecule to interrupt this vicious cycle in myocardial hypoxic injury.

The functional involvement of CRNDE in myocardial hypoxic injury extends beyond direct modulation of cell death and oxidative stress, encompassing the restoration of cellular proliferative capacity and cycle homeostasis. Our flow cytometry results demonstrated that CRNDE knockdown relieved G1/S phase arrest and promoted cell cycle progression, which is functionally linked to the inhibition of NLRP3/ASC pathway activation. NLRP3 inflammasome overactivation has been shown to disrupt cell cycle regulation by inducing oxidative stress and inflammatory cytokine release, and CRNDE silencing may attenuate this effect by suppressing NLRP3/ASC-mediated cascade reactions. This multifaceted expression pattern indicates that CRNDE acts as a key mediator integrating inflammatory responses, cell death pathways, and cell cycle progression, with the NLRP3/ASC pathway as its major functionally related. Such a coordinated functional mechanism supports the important role of CRNDE in maintaining myocardial cell homeostasis under hypoxic stress and provides a more holistic understanding of the molecular networks underlying hypoxic myocardial injury.

From a translational perspective, our findings highlight the potential of CRNDE as a promising target for the development of novel therapeutic strategies against hypoxia-related cardiovascular diseases. The significant upregulation of CRNDE in hypoxic cardiomyocytes, coupled with its close correlation with NLRP3/ASC activation and key injury markers, underscores its potential as a specific molecular target for intervention. Targeted silencing of CRNDE effectively alleviated multiple injury phenotypes in vitro, including pyroptosis, apoptosis, oxidative stress, and mitochondrial damage, which supports the feasibility of lncRNA-based therapeutic approaches such as siRNA or shRNA delivery systems. Moreover, the functionally linked CRNDE-NLRP3/ASC axis provides a precise molecular target, which may help reduce off-target effects and improve therapeutic efficacy. Further exploration of CRNDE-targeted interventions may open new avenues for the treatment of myocardial ischemia and related diseases, addressing the unmet clinical need for effective and specific therapies.

In conclusion, in hypoxia-induced H9c2 cardiomyocytes, lncRNA CRNDE functions as a proinflammatory and pro-apoptotic mediator, and its effects on pyroptosis, apoptosis, and oxidative stress are closely associated with the activation of the NLRP3/ASC signaling pathway. Although H9c2 cells represent a classic and widely used in vitro model in cardiovascular research, their inherent characteristics cannot fully recapitulate the structure and function of mature cardiomyocytes. All experiments in this study were performed exclusively in the H9c2 cardiomyocyte cell line, which somewhat limits the clinical translational potential of the present findings. These findings provide new insights into the molecular mechanisms underlying hypoxia-related myocardial injury and suggest CRNDE as a potential therapeutic target for the treatment of cardiovascular diseases associated with hypoxia.

Footnotes

Authors’ Contributions

Z.X. and J.Z.: Performed most of experiments, collected data and wrote the manuscript; Y.H., Z.Y., Y.H., and H.C.: Participated in experiments and maintenance of the experiments; Z.X.: Supervised all stages of project and manuscript development. All authors have approved the final article.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

These works were supported by the Fujian Provincial Natural Science Foundation (2023J011782).

Supplemental Material

References

Chen

, Ye

, Dong

. Long term exercise-derived exosomal LncRNA CRNDE mitigates myocardial infarction injury through miR-489-3p/Nrf2 signaling axis. Nanomedicine 2024;55:102717; doi: 10.1016/j.nano.2023.102717

Jiang

, Zhang

, Yuan

, et al. LncRNA GSCAR promotes glioma stem cell maintenance via stabilizing SOX2 expression. Int J Biol Sci 2023;19(6):1681–1697; doi: 10.7150/ijbs.80873

, Cheng

, Gao

, et al. Pyroptosis: A spoiler of peaceful coexistence between cells in degenerative bone and joint diseases. J Adv Res 2025;71:227–262; doi: 10.1016/j.jare.2024.06.010

Liang

, Wang

, Huang

, et al. Silenced SOX2‐OT alleviates ventricular arrhythmia associated with heart failure by inhibiting NLRP3 expression via regulating miR‐2355‐3p. Immun Inflamm Dis 2021;9(1):255–264; doi: 10.1002/iid3.388

Lin

, Zhou

, Wang

C-Q

, et al. LncRNAs regulate metabolism in cancer. Int J Biol Sci 2020;16(7):1194–1206; doi: 10.7150/ijbs.40769

Lin

, Wang

, Gao

, et al. Oscillating lncRNA Platr4 regulates NLRP3 inflammasome to ameliorate nonalcoholic steatohepatitis in mice. Theranostics 2021;11(1):426–444; doi: 10.7150/thno.50281

Lindsey

, Bolli

, Canty

Jr , et al. Guidelines for experimental models of myocardial ischemia and infarction. Am J Physiol Heart Circ Physiol 2018;314(4):H812–H838; doi: 10.1152/ajpheart.00335.2017

Liu

, Wang

, Zhang

, et al. Enhanced cardiomyocyte NLRP3 inflammasome‐mediated pyroptosis promotes d‐galactose–induced cardiac aging. JAHA 2024;13(14); doi: 10.1161/jaha.123.032904

Liu

, Bian

, Pang

. LncRNA CRNDE binds hnRNPA1 to facilitate carbon monoxide poisoning-induced delayed encephalopathy via inhibiting UCHL5-mediated SMO deubiquitination. Metab Brain Dis 2023;38(3):1097–1113; doi: 10.1007/s11011-022-01157-4

10.

Pagliaro

, Cannata

, Stefanini

, et al. Myocardial ischemia and coronary disease in heart failure. Heart Fail Rev 2020;25(1):53–65; doi: 10.1007/s10741-019-09831-z

11.

, Yan

, Wang

, et al. Ginsenoside Rh2 inhibits NLRP3 inflammasome activation and improves exosomes to alleviate hypoxia-induced myocardial injury. Front Immunol 2022;13:883946; doi: 10.3389/fimmu.2022.883946

12.

Qiu

, Lei

, Zhao

, et al. NLRP3 inflammasome activation‐mediated pyroptosis aggravates myocardial ischemia/reperfusion injury in diabetic rats. Oxid Med Cell Longev 2017;2017(1):9743280; doi: 10.1155/2017/9743280

13.

Song

, Zhang

, Gong

, et al. Long noncoding RNA LINC00339 promotes renal tubular epithelial pyroptosis by regulating the miR‐22‐3p/NLRP3 axis in calcium oxalate–induced kidney stone. J Cell Biochem 2019;120(6):10452–10462; doi: 10.1002/jcb.28330

14.

Sun

, Ma

, Gao

, et al. Propofol directly induces caspase-1-dependent macrophage pyroptosis through the NLRP3-ASC inflammasome. Cell Death Dis 2019;10(8):542; doi: 10.1038/s41419-019-1761-4

15.

Sun

T-T

, Li

X-M

, Zhu

J-Y

, et al. Regulatory effect of long-stranded non-coding RNA-CRNDE on neurodegeneration during retinal ischemia-reperfusion. Heliyon 2022;8(10):e10994; doi: 10.1016/j.heliyon.2022.e10994

16.

Wang

, Wu

, Zhu

, et al. ROS induced pyroptosis in inflammatory disease and cancer. Front Immunol 2024;15:1378990; doi: 10.3389/fimmu.2024.1378990

17.

, Cao

, Zou

, et al. Panax notoginseng saponins inhibits NLRP3 inflammasome-mediated pyroptosis by downregulating lncRNA-ANRIL in cardiorenal syndrome type 4. Chin Med 2023;18(1):50; doi: 10.1186/s13020-023-00756-2

18.

Yue

, He

, Teng

, et al. Long non-coding RNA metastasis-related lung adenocarcinoma transcript 1 (MALAT1) forms a negative feedback loop with long non-coding RNA colorectal neoplasia differentially expressed (CRNDE) in sepsis to regulate lung cell apoptosis. Bioengineered 2022;13(4):8201–8207; doi: 10.1080/21655979.2021.2023727

19.

Zhao

, Fu

, Zhang

, et al. Chronic hypoxia-induced upregulation of hsa_circ_0005255 attenuates myocardial injury via targeting hsa-miR-3916/FTO/m6A axis. Int J Biol Macromol 2025;310(Pt 2):143228; doi: 10.1016/j.ijbiomac.2025.143228

20.

Zheng

, Yan

, Ren

, et al. Mechanism of hypoxia‐induced HMGB1 regulating NLRP3 inflammasome/caspase‐1 pathway‐mediated pyroptosis in myocardial ischemia reperfusion injury through the Nrf2/HO‐1 pathway. CNS Neurosci Ther 2025;31(12); doi: 10.1111/cns.70661

21.

Zhou

, Yazdi

, Menu

, et al. A role for mitochondria in NLRP3 inflammasome activation. Nature 2011;469(7329):221–225; doi: 10.1038/nature09663

22.

Zhu

, Li

, Huang

, et al. LncRNA CRNDE inhibits cardiomyocytes apoptosis by YAP1 in myocardial ischaemia/reperfusion injury. Autoimmunity 2021;54(4):204–212; doi: 10.1080/08916934.2021.1913580

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

1.14 MB