Carbapenem-Resistant Enterobacterales in Indian ICU Patients: Molecular Insights,Risk Factors,and Clinical Impact

Abstract

Carbapenem-resistant Enterobacterales (CRE) pose a critical threat in intensive care units (ICUs) due to rapid transmission potential and limited treatment options. The study aimed to determine the incidence of intestinal CRE colonization among ICU patients, characterize the isolates phenotypically and genotypically and identify associated risk factors. This cross-sectional study was conducted in a tertiary care hospital in North India and included 236 ICU patients. Clinical, demographic, lifestyle, and dietary data were collected through standardizedv questionnaires and medical records. CRE isolates were identified using standard microbiological techniques and characterized for resistance genes. CRE colonization was detected in 69.07% of patients. Escherichia coli (74.15%) and Klebsiella pneumoniae (21.61%) were the predominant species, with a significant rise in K. pneumoniae colonization during ICU stays (p = 0.049), suggesting nosocomial transmission. Asthma emerged as a novel independent risk factor (p = 0.023, 100% colonization). Other significant associations included non-vegetarian diet (p = 0.02), prolonged ICU stay (p = 0.010), and prior broad-spectrum antibiotic use (p = 0.028). Molecular analysis showed 84% of CRE isolates harbored the bla_NDM-1 gene, while bla_IMP was absent. CRE colonization was significantly associated with higher mortality (38.0% vs. 23.3%, p = 0.026). The study reveals a high prevalence of intestinal CRE colonization among ICU patients and highlights key modifiable risk factors and regional resistance patterns. Routine rectal screening, stringent infection control, and robust antimicrobial stewardship are urgently needed to limit CRE spread. A deeper understanding of colonization dynamics is essential to improving outcomes in critically ill patients.

Introduction

Carbapenem-resistant Enterobacterales (CRE) have rapidly become a significant public health concern on a global scale, particularly in intensive care units (ICUs) where critically ill patients are at an increased risk of colonization and subsequent infections. The World Health Organization has identified CRE as a top-priority pathogen, emphasizing the pressing necessity for infection control interventions because of their widespread antibiotic resistance and restricted treatment options.¹ The rapid dissemination of resistance genes via horizontal gene transfer due to high antibiotic consumption, poor adherence to antimicrobial stewardship, and suboptimal infection prevention strategies, all of which have been associated with the increasing burden of CRE in hospital settings.² The colonization of the gastrointestinal tract with CRE is a critical precursor to severe clinical infections, such as bloodstream infections, ventilator-associated pneumonia, and catheter-associated urinary tract infections. This contributes to high morbidity, mortality, prolonged hospitalization and increased healthcare costs.³ Research suggests that the incidence of rectal CRE colonization varies significantly, with a range of 15–65% across various ICU settings in both high-burden regions like South Asia and parts of the Middle East, as well as in tertiary care hospitals in Europe and the United States. This variation is indicative of regional disparities in antimicrobial stewardship practices and infection prevention protocols.⁴ The prevalence of CRE in India has been increasing at a rapid pace due to the rampant overuse of antibiotics, the lack of adequate screening policies, and the limited enforcement of infection control guidelines.⁵ It is imperative to identify high-risk patients and employ early detection strategies in order to mitigate the transmission of CRE in healthcare environments. Prior antibiotic exposure (particularly carbapenems and third-generation cephalosporins), extended ICU stays, mechanical ventilation, central venous catheterization and immunosuppression are among the numerous well-established risk factors that contribute to CRE colonization.⁶ In order to implement targeted infection control measures, such as patient cohorting, contact precautions, and decontamination strategies, it is imperative to conduct routine rectal screening for CRE in ICU patients, as recommended by international guidelines.¹ Nevertheless, in numerous Indian hospitals, systematic CRE screening is not a component of standard infection control protocols, resulting in the presence of unidentified reservoirs of multidrug-resistant bacteria in critical care units. Despite the increasing hazard of CRE in Indian ICUs, there is a lack of comprehensive epidemiological data on the dynamics of colonization the associated risk factors, and potential clinical outcomes. The objective of the present study was to ascertain the incidence of intestinal CRE colonization among ICU patients in a tertiary care hospital, characterize the isolates using phenotypic and genotypic approaches, and identify the primary risk factors associated with colonization. The outcomes will be essential in guiding policy recommendations for CRE containment in high-risk ICU settings, strengthening antimicrobial stewardship programs, and informing infection control strategies.

Material and Methods

Study setting and design

This hospital-based prospective observational study was carried out at the Postgraduate Department of Microbiology and Critical Care Units of a tertiary care hospital in northern India. This study spanned 1 year (January to December 2022).

Ethical considerations

Ethical permission has been obtained from King George's Medical University's Institutional Ethics Committee (Registration No. ECR/262/Inst/UP/2013/RR-19). Prior to enrolment, all participants or their legal guardians provided written informed consent, ensuring ethical compliance and patient confidentiality.

Study population and sample size

The study focused on adult ICU patients (≥18 years) hospitalized in the study period. Patients with conditions that limited rectal swab collection or who refused consent were excluded. Based on an estimated CRE colonization prevalence of 18% (±5%), the final sample size was 236 patients, with a 95% confidence level and 25% non-response rate. The computation was done with OpenEpi version 3.

Data collection

Clinical and demographic data were collected using standardized questionnaires and medical record inspections. The factors included age, gender, previous hospitalization history, ICU stay duration, usage of invasive equipment (e.g., mechanical ventilation, central line, and Foley catheter), antibiotic exposure (pre-admission and in-hospital), and primary admission diagnosis. In addition, personal habits such as smoking, tobacco use, and alcohol consumption were recorded. Dietary preferences (vegetarian or non-vegetarian) were also documented to assess their potential association with CRE colonization.

Microbiological methods

Sample collection

Rectal swabs were taken from ICU patients on the first, third, and fifth days of admission to monitor colonization dynamics. Patients were put in the left lateral decubitus position, with a sterile flocked swab inserted 3–5 cm into the rectum and gently rotated for 5–10 seconds to ensure sufficient sample. Swabs were promptly transported to the microbiology laboratory and processed within 2 hours.

Culture and identification

Swabs were added to MacConkey Agar and Sheep Blood Agar and incubated at 37°C for 24 hours. The isolates were identified using Matrix-Assisted Laser Desorption/ionization Time-of-Flight Mass Spectrometry.

Antimicrobial susceptibility testing

The Kirby–Bauer method for disc diffusion was used for antimicrobial susceptibility testing (AST), which was done in line with Clinical and Laboratory Standards Institute (CLSI) M100 (32nd edition, 2022).⁷ Antibiotics tested included aminoglycosides such as amikacin, gentamicin, and tobramycin; β-lactam/β-lactamase inhibitor combinations such as piperacillin-tazobactam; cephalosporins such as cefepime, ceftriaxone, cefoxitin, and cefazolin; fluoroquinolones such as ciprofloxacin and levofloxacin; monobactam aztreonam; folate pathway inhibitor cotrimoxazole; tetracycline; and penicillins such as amoxicillin and ampicillin. In addition, we evaluated the efficacy of last-resort medicines colistin and tigecycline. The interpretations were based on CLSI M100 (2022) breakpoints. Quality control was maintained by using E. coli ATCC 25922 and K. pneumoniae ATCC BAA-1705 as reference strains. We stored all detected isolates at −80°C in 20% glycerol, ready for future research.

Carbapenemase detection

Initially, carbapenem discs (10 μg each of ertapenem, meropenem, and imipenem) were used for disc diffusion screening. Isolates with zone diameters less than 21 mm were considered resistant. To validate carbapenemase activity, we used the modified carbapenem inactivation method (mCIM). Meropenem discs were incubated in tryptic soy broth containing the test organism for 2 hours before being transferred to Mueller–Hinton agar plates pre-inoculated with Escherichia coli ATCC 25922. The presence of growth inhibition surrounding the disc suggested carbapenemase activity. To identify metallo-β-lactamases, we used the EDTA (ethylenediaminetetraacetic acid)-mCIM (eCIM). This approach is similar to the mCIM but incorporates 5 μL of 0.5 M EDTA into the broth to chelate metal ions required for Metallo-β-lactamase (MBL) activity. An increase of ≥5 mm in the zone diameter for eCIM compared with mCIM indicates MBL generation. Quality control was carried out using Klebsiella pneumoniae ATCC BAA-1705 (carbapenemase-positive) and ATCC BAA-1706 (carbapenemase-negative) as reference strains.

Molecular analysis for carbapenemase genes

We used the boiling technique for DNA extraction and polymerase chain reaction (PCR).⁸ The presence of bla_NDM-1 and bla_IMP genes was detected using PCR with specified primers (Table 1). The 25 μL PCR reaction mix included 2 μL of extracted DNA, 10X PCR buffer, 1.5 mM MgCl₂, 0.2 mM Deoxyribonucleotide Triphosphates, 0.5 μM primers, 1 U of Taq polymerase, and nuclease-free water. Thermal cycling conditions included an initial denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 52–58°C (depending on primer specificity) for 30 seconds, and extension at 72°C for 1 minute, with a final extension at 72°C for 7 minutes. Amplified PCR products were analyzed by 1.5% agarose gel electrophoresis in 1X TAE buffer at 100 V for 45 minutes, stained with ethidium bromide, and visualized by UV transillumination.

Table 1.

Primer Sequences Used for the Detection of Carbapenemase Genes

S.N.	Gene	Primer sequence (5′→3′)	Amplicon size	Reference
1.	NDM-1	F: GGCGGAAGGCTCATCACGA R: CGCAACACAGCCTGACTTTC	287 bp	¹⁹
2.	IMP	F: GGAATAGAGTGGCTTAAYTCTC R: GGTTTAAYAAAACAACCACC	232 bp	¹⁹

Statistical analysis

The statistical analysis was carried out using SPSS Version 29.0. Demographic and clinical data were summarized using descriptive statistics such as mean, median, and standard deviation. The chi-square test was used for categorical data, while the Student's t-test and ANOVA were employed for continuous variables after determining normality using the Shapiro–Wilk test. The Mann–Whitney U and Kruskal–Wallis tests were employed to analyze data that was not regularly distributed. A p value of <0.05 was judged statistically significant. Logistic regression analyses were used to determine independent risk variables for CRE colonization.

Results

Demographic profile of ICU patients

The study included 236 ICU patients colonized with Enterobacterales isolates, with a mean age of 41.35 ± 17.11 years (range: 18–85 years). There was a slight male predominance (54.2%) compared to females (45.8%). Among personal habits, smoking (33.9%), tobacco use (34.7%), and alcohol consumption (28%) were prevalent. Dietary analysis revealed that 48.7% of patients followed a non-vegetarian diet, which was significantly associated with CRE colonization (p = 0.02).

Risk factors for CRE colonization

Several factors were assessed for their association with CRE colonization. Recent hospital admissions within the last three months showed a high colonization rate of 81.5% by Day 5, but this association was not statistically significant (p = 0.638). Prior antibiotic use, particularly with broad-spectrum antibiotics, was significantly linked to increased colonization rates, with prevalence rising from 60.7% on Day 1 to 73.2% by Day 5 (p = 0.028). Patients requiring ventilator support and central line placement also exhibited higher colonization rates; however, statistical significance was not achieved. Additionally, patients with nasogastric tube insertion (82.4% colonization by Day 5, p = 0.351) and Foley's catheterization (74.5% colonization, p = 0.248) had a greater tendency for colonization (Table 2).

Table 2.

Risk Factors Associated with Rectal Colonization of Carbapenem-Resistant Enterobacterales in ICU Patients: A Comparative Analysis with Non-CRE Cases

		Day-1			Day-3			Day-5
S.N.	Risk factor	Total	CRE	Non-CRE	Total	CRE	Non-CRE	Total	CRE	Non-CRE	Chi-Square (χ²); p value
1	Admission to hospital within 3 months (n = 129)	42	31 (73.8%)	11 (26.2%)	33	26 (78.8%)	7 (21.2%)	54	44 (81.5%)	10 (18.5%)	χ² = 0.898; p = 0.638
2	Any past history of hospital admission within 1 year (n = 105)	30	22 (73.3%)	8 (26.7%)	31	24 (77.4%)	7 (22.6%)	44	37 (84.1%)	7 (15.9%)	χ² = 1.317; p = 0.518
3	Prior use of antibiotics before admission (n = 92)	28	17 (60.7%)	11 (39.3%)	23	9 (39.1%)	14 (60.9%)	41	30 (73.2%)	11 (26.8%)	χ² = 7.168; p = 0.028
4	Ventilator support (n = 157)	43	31 (72.1%)	12 (27.9%)	50	35 (70%)	15 (30%)	64	49 (76.6%)	15 (23.4%)	χ² = 1.209; p = 0.546
5	Central line support (n = 143)	39	27 (69.2%)	12 (30.8%)	44	31 (70.5%)	13 (29.5%)	60	47 (78.3%)	13 (21.7%)	χ² = 1.671; p = 0.433
6	Nasogastric tube (n = 86)	20	14 (70%)	6 (30%)	32	23 (71.9%)	9 (28.1%)	34	28 (82.4%)	6 (17.6%)	χ² = 2.095; p = 0.351
7	Foley's catheter (n = 229)	61	40 (65.6%)	21 (34.4%)	74	48 (64.9%)	26 (35.1%)	94	70 (74.5%)	24 (25.5%)	χ² = 2.786; p = 0.248

CRE, carbapenem-resistant Enterobacterales; ICU, intensive care unit.

Statistically significant of p-values are represented in bold data.

ICU stay duration and CRE colonization

A statistically significant correlation was observed between ICU stay duration and CRE colonization (χ² = 9.284; p = 0.010). Patients with ICU stays shorter than 7 days had a colonization rate of 57.3%, which increased to 75.9% in those hospitalized for 7–21 days and 77.4% for patients with ICU stays beyond 21 days.

Comorbidities and CRE colonization

Analysis of comorbidities revealed that asthma was significantly associated with CRE colonization (p = 0.023), with all asthmatic patients (100%) showing colonization. However, other comorbid conditions, such as type 2 diabetes mellitus, urinary diseases, and postoperative complications, did not show statistically significant differences between CRE and non-CRE groups (Table 3).

Table 3.

Association of Comorbidities with Rectal Colonization of Carbapenem-Resistant Enterobacterales in ICU Patients: A Risk Factor Analysis

S.N.	Comorbidity	Total (n = 236)	CRE (n = 163)	Non-CRE (n = 73)	Chi-square (χ²) and p value	Odds ratio (95% CI)
1	Blunt trauma abdomen	52	36 (69.2%)	16 (30.8%)	χ² = 0.001; p = 0.977	0.99 (0.49–2.00)
2	Type 2 diabetes mellitus	43	31 (72.1%)	12 (27.9%)	χ² = 0.225; p = 0.635	1.09 (0.51–2.34)
3	Hypertension	28	20 (71.4%)	8 (28.6%)	χ² = 0.083; p = 0.773	1.06 (0.41–2.75)
4	Thyroid disease	13	9 (69.2%)	4 (30.8%)	χ² = 0.000; p = 0.990	1.00 (0.26–3.86)
5	Anemia	9	5 (55.6%)	4 (44.4%)	χ² = 0.800; p = 0.371	0.57 (0.14–2.22)
6	COPD	10	7 (70.0%)	3 (30.0%)	χ² = 0.004; p = 0.948	1.02 (0.23–4.62)
7	Asthma	11	11 (100%)	0 (0.0%)	χ² = 5.167; p = 0.023	Undefined (high association)
8	Septic shock	12	8 (66.7%)	4 (33.3%)	χ² = 0.034; p = 0.853	0.91 (0.24–3.49)
9	Respiratory infection	5	3 (60.0%)	2 (40.0%)	χ² = 0.197; p = 0.657	0.75 (0.11–5.14)
10	Pancreatitis	2	2 (100%)	0 (0.0%)	χ² = 0.903; p = 0.342	Undefined (small sample)
11	Gastrointestinal disease	13	6 (46.2%)	7 (53.8%)	χ² = 3.381; p = 0.066	0.43 (0.14–1.34)
12	Hepato-biliary disease	12	8 (66.7%)	4 (33.3%)	χ² = 0.034; p = 0.853	0.91 (0.24–3.49)
13	Neurological disease	22	18 (81.8%)	4 (18.2%)	χ² = 1.846; p = 0.174	2.06 (0.66–6.43)
14	Cardiovascular disease	7	5 (71.4%)	2 (28.6%)	χ² = 0.019; p = 0.891	1.05 (0.17–6.54)
15	Female genital tract disease	4	4 (100%)	0 (0.0%)	χ² = 1.822; p = 0.177	Undefined (small sample)
16	Pregnancy with complications	18	14 (77.8%)	4 (22.2%)	χ² = 0.692; p = 0.406	1.73 (0.53–5.70)
17	Postoperative complications	31	19 (61.3%)	12 (38.7%)	χ² = 1.010; p = 0.315	0.62 (0.27–1.42)
18	Urinary system disease	39	29 (74.4%)	10 (25.6%)	χ² = 0.612; p = 0.434	1.50 (0.64–3.52)
19	Other diseases	9	5 (55.6%)	4 (44.4%)	χ² = 0.800; p = 0.371	0.57 (0.14–2.22)
20	Pacemaker implant	1	0 (0.0%)	1 (100%)	χ² = 2.242; p = 0.134 (small sample size, interpret cautiously)	Undefined (small sample)

CI, confidence interval; COPD, Chronic Obstructive Pulmonary Disease.

Statistically significant of p-values are represented in bold data.

Microbiological profile of enterobacterales isolates

Among the 236 rectal swab samples, Enterobacterales were identified in 93.7% of cases. The most frequently isolated species were Escherichia coli (74.15%), followed by Klebsiella pneumoniae (21.61%), Enterobacter cloacae (3.39%), and Citrobacter koseri (0.85%). The proportion of CRE isolates among Klebsiella pneumoniae cases significantly increased over time (p = 0.049), rising from 15.78% on Day 1 to 44.73% by Day 5 (Table 4).

Table 4.

Temporal Trends and Distribution of Carbapenem-Resistant Enterobacterales Isolates in ICU Patients: A Day-Wise Analysis

S.N.	Isolated organism	Total isolates (n = 236)	CRE isolates (n = 163)	Day-1 (n = 65)	Day-3 (n = 76)	Day-5 (n = 95)	Statistical significance (χ², p value)	Odds ratio (95% CI)
1	Escherichia coli	175 (74.15%)	116 (71.2%)	35 (30.17%)	30 (25.86%)	51 (43.96%)	χ² = 1.814, p = 0.404	1.16 (0.72–1.88)
2	Klebsiella pneumoniae	51 (21.61%)	38 (74.5%)	6 (15.78%)	15 (39.47%)	17 (44.73%)	χ² = 6.038, p = 0.049 (significant) *	2.78 (1.08–7.16)
3	Enterobacter cloacae	8 (3.39%)	7 (87.5%)	2 (28.57%)	3 (42.86%)	2 (28.57%)	χ² = 1.905, p = 0.386	1.49 (0.22–10.03)
4	Citrobacter koseri	2 (0.85%)	2 (100%)	0 (0.0%)	2 (100%)	0 (0.0%)	N/A (small sample size)	Undefined

p-value is statistically significant.

Antimicrobial susceptibility and carbapenem resistance

AST demonstrated high resistance rates to carbapenems, with 68.2% resistance to ertapenem, 69.1% to meropenem, and 68.6% to imipenem. CRE isolates exhibited high resistance across multiple antibiotic classes, including cefepime (92.6%), aztreonam (85.6%), ciprofloxacin (82.8%), and cotrimoxazole (80.4%) (Table 5).

Table 5.

Antibiotic Resistance Patterns in CRE and Non-CRE Isolates from ICU Patients

Antibiotic class	Antibiotic	Total samples (n = 236)	CRE resistant (n = 163)	% Resistant (CRE)	Non-CRE resistant (n = 73)	% Resistant (non-CRE)	p value
Aminoglycosides	Amikacin	236	112	68.7%	48	65.8%	0.68
	Gentamicin	236	93	57.1%	41	56.2%	0.89
	Tobramycin	236	105	64.4%	47	64.4%	1.00
Beta-lactams	Amoxicillin	236	131	80.4%	61	83.6%	0.56
	Ampicillin	236	146	89.6%	67	91.8%	0.58
	Cefepime	234	216	92.3%	59	83.1%	0.03*
	Cefazolin	236	148	90.8%	68	93.2%	0.55
	Ceftriaxone	236	145	89.0%	56	76.7%	0.02*
	Cefoxitin	236	127	77.9%	57	78.1%	0.97
	Aztreonam	234	200	85.5%	55	75.3%	0.05
	Piperacillin-Tazobactam	236	106	65.0%	42	57.5%	0.26
Fluoroquinolones	Ciprofloxacin	236	135	82.8%	56	76.7%	0.27
	Levofloxacin	236	122	74.8%	44	60.3%	0.03*
Sulfonamides	Cotrimoxazole	236	131	80.4%	54	74.0%	0.27
Tetracyclines	Tetracycline	236	109	66.9%	41	56.2%	0.11
Polymyxins	Colistin	236	2	1.2%	0	0%	0.38
Glycylcyclines	Tigecycline	236	0	0%	0	0%	N/A

p-value is statistically significant.

Phenotypic and genotypic detection of carbapenemases

Among the 236 ICU patients screened, 163 CRE isolates were recovered from rectal swabs of colonized individuals. Phenotypic testing revealed carbapenemase production in 82.2% of isolates using the mCIM and in 80.36% using the eCIM. Genotypic testing identified NDM-1 as the predominant carbapenemase gene, with 84% positivity. The highest NDM-1 positivity was found in Klebsiella pneumoniae (97.4%), followed by Escherichia coli (81.9%). The IMP gene was absent in all tested isolate.

Clinical outcomes of CRE and Non-CRE colonization

Patients colonized with CRE had significantly worse clinical outcomes. Mortality was significantly higher among CRE-colonized patients (38.0%) compared to non-CRE colonized patients (23.3%) (χ² = 4.925; p = 0.026). The discharge rate was lower in the CRE group (54.6%) compared to the non-CRE group (64.4%), though this was not statistically significant (p = 0.160). The proportion of patients leaving against medical advice (LAMA) was comparable between CRE and non-CRE groups (7.4% vs. 12.3%, p = 0.467).

Discussion

CRE colonization in ICU patients is a serious public health concern because of the high morbidity and death rates and restricted treatment options. This study found a high frequency of CRE colonization (69.07%) among ICU patients, with Escherichia coli (74.15%) and Klebsiella pneumoniae (21.61%) being the most common species. Notably, K. pneumoniae colonization increased considerably over the screening period (p = 0.049), indicating that it persists in the hospital setting and can spread nosocomially. These findings are consistent with earlier reports of K. pneumoniae being the predominant CRE species in ICUs.^9,10

Risk factors for CRE colonization

Several well-established risk variables were shown to be strongly linked with CRE colonization, including prior antibiotic exposure (p = 0.028), longer ICU stay (p = 0.010), and the presence of invasive equipment such as ventilators, central lines, and Foley catheters. These findings support previous research indicating the effect of antibiotic pressure and hospital-acquired exposures on enhanced CRE colonization.^11,12 Prior carbapenem and cephalosporin usage has been significantly associated with an elevated risk of CRE colonization due to selection pressure favoring the persistence of resistant strains.¹³ A statistically significant link was detected between extended ICU stay and CRE colonization (χ² = 9.284; p = 0.010). Colonization rates increased from 57.3% in patients hospitalized for less than 7 days to 77.4% in those for a period exceeding 21 days. Studies reported similar patterns^14,15 emphasize the cumulative threat caused by long-term ICU hospitalizations due to prolonged antibiotic exposure and nosocomial transmission.

Interestingly, asthma was identified as a unique and statistically significant risk factor for CRE colonization (p = 0.023), with 100% of asthmatic individuals colonized. While the finding has not been widely reported, it is consistent with earlier ideas that chronic lung problems may enhance vulnerability to multidrug-resistant infections as a result of recurring antibiotic usage and healthcare exposure.¹⁶ Other concomitant disorders, such as diabetes and urinary tract infections, had no significant relationship with CRE colonization, consistent with previous findings.^17,18

Carbapenemase production and antimicrobial resistance trends

A substantial proportion (82.2%) of CRE isolates produced carbapenemase using the m-CIM, whereas 80.36% were positive using the e-CIM. Genotypic testing revealed that NDM-1 was the main carbapenemase gene in 84% of isolates, with K. pneumoniae (97.4%) and E. coli (81.9%) serving as the major reservoirs. These findings are consistent with publications from India, which indicate NDM-1 as the primary carbapenemase mechanism, while KPC and OXA-48 prevail in Europe and North America.^19,20 AST found worrisome rates of resistance among CRE isolates, including 92.6% to cefepime, 85.6% to aztreonam, and 82.8% to ciprofloxacin. Although aminoglycosides had modest activity, with amikacin (63.6%) and gentamicin (57.1%) remaining effective, their usage is limited due to nephrotoxicity concerns. Notably, colistin and tigecycline resistance remained low, but new reports of plasmid-mediated colistin resistance (Mobile Colistin Resistance genes) raise concerns.²¹ Alternative treatment options, including new β-lactam/β-lactamase inhibitors such as ceftazidime–avibactam and meropenem–vaborbactam, should be investigated for CRE infections.²²

Infection vs. Colonization

Clinical Outcomes CRE-colonized patients had a considerably higher fatality rate (38.0%) than non-CRE-colonized patients (23.3%, p = 0.026), indicating that CRE colonization may predispose critically ill patients to invasive infections and poor outcomes.²³ However, our study did not assess the progression from colonization to clinical infection, which remains an important area for future investigation. Previous research suggests that up to 40% of CRE-colonized ICU patients acquire invasive infections, with increased risks in immunocompromised patients and those requiring extended mechanical ventilation.²⁴ The CRE group had a lower discharge rate (54.6%) than the non-CRE group (64.4%), although the difference was not statistically significant (p = 0.160). The comparable percentages of patients LAMA in both groups (7.4% vs. 12.3%, p = 0.467) indicate that socioeconomic and healthcare accessibility determinants are more important in LAMA decisions than CRE colonization status alone.

Infection control and public health implications

Given the high incidence of CRE colonization, regular rectal screening during ICU admission should be instituted for high-risk patients, as recommended by the Centers for Disease Control and Prevention and the World Health Organization.²⁵ Early diagnosis enables infection management strategies such as patient cohorting, improved hand cleanliness, and contact restrictions, therefore lowering nosocomial spread.²⁶ Furthermore, establishing antimicrobial stewardship programs is crucial for preventing the abuse of broad-spectrum antibiotics, which promotes resistance. Antibiotic de-escalation, therapeutic medication monitoring, and antimicrobial cycling have all been demonstrated to minimize CRE development while improving patient outcomes. Furthermore, infection prevention measures should be included in hospital-wide surveillance systems. The incorporation of CRE surveillance data in antibiograms can help optimize empirical therapy decisions, avoid incorrect carbapenem usage, and delay the establishment of pandrug-resistant strains.^27,28

Conclusion

CRE have rapidly become a significant public health concern on a global scale, particularly in ICUs where critically ill patients are at an increased risk of colonization and subsequent infections. Our findings highlight the high prevalence of CRE colonization in ICU patients and its association with poor clinical outcomes. The substantial link between past antibiotic exposure, extended ICU stay, and invasive device usage emphasizes the importance of effective antimicrobial stewardship and infection control strategies. Given the scarcity of treatment alternatives, future research should investigate innovative therapeutic techniques and analyze the long-term effects of CRE colonization on patients’ health.

Footnotes

Acknowledgments

Special thanks to all the ICU patients and their families for their participation. The authors also acknowledge the technical support provided by the laboratory staff and the contributions of all those involved in data collection and analysis.

Authors’ Contributions

M.K.P.: Investigation, data curation, formal analysis. S.V.: Validation, writing—original draft, writing—review and editing, visualization, supervision. V.V.: Conceptualization, methodology, supervision, validation, review and editing. S.K.: Methodology, formal analysis, software, visualization. Mohit: Review and editing; Z.A.: Resources, supervision, review and editing. Each author has made significant contributions to the article and has given their final approval for submission.

Ethical Considerations

Ethical approval was obtained from the Institutional Ethics Committee of King George's Medical University, Lucknow (Registration No. ECR/262/Inst/UP/2013/RR-19). Written informed consent was obtained from all participants or their legal guardians before enrollment, ensuring compliance with ethical guidelines and patient confidentiality.

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

Author Disclosure Statement

The authors declare no competing interests.

Funding Information

This study was conducted without any external funding support. All research activities were carried out with institutional resources.

References

World Health Organization. WHO updates list of drug-resistant bacteria most threatening to human health. May 17, 2024. Available from: https://www.who.int/news/item/17-05-2024-who-updates-list-of-drug-resistant-bacteria-most-threatening-to-human-health [Last accessed: February 24, 2025].

Jean

, Harnod

, Hsueh

. Global threat of carbapenem-resistant gram-negative bacteria. Front Cell Infect Microbiol, 2022; 12:823684.

, Hu

, Wu

, et al. Prevalence and risk factors for colonisation and infection with carbapenem-resistant Enterobacterales in intensive care units: A prospective multicentre study. Intensive Crit Care Nurs, 2023; 79:103491.

Guo

, Guo

, Zhang

, et al. Prevalence and risk factors of carbapenem-resistant Enterobacterales positivity by active screening in intensive care units in the Henan Province of China: A multi-center cross-sectional study. Front Microbiol, 2022; 13:894341.

Mahapatra

, Nikitha

, Rath

, et al. Evaluation of HiCrome KPC agar for the screening of carbapenem-resistant enterobacterales colonization in the ICU setting of a tertiary care hospital. J Lab Physicians, 2021; 13(04):358–361.

, Kim

. Identification and infection control of carbapenem-resistant Enterobacterales in intensive care units. Acute Crit Care, 2021; 36(3):175–184.

Clinical and Laboratory Standards Institute (CLSI) . Performance Standards for Antimicrobial Susceptibility Testing. 32nd ed. CLSI supplement M100. Clinical and Laboratory Standards Institute; 2022.

Holmes

, Quigley

. A rapid boiling method for the preparation of bacterial plasmids. Anal Biochem, 1981; 114(1):193–197.

Han

, Goldstein

, Wise

, et al. Epidemiology of carbapenem-resistant Klebsiella pneumoniae in a network of long-term acute care hospitals. Clin Infect Dis, 2017; 64(7):839–844.

10.

Wang

, Liu

, Li

. Incidence and risk factors for subsequent infections among rectal carriers with carbapenem-resistant Klebsiella pneumoniae: A systematic review and meta-analysis. J Hosp Infect, 2024; 145:11–21.

11.

van Duin

, Doi

. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence, 2017; 8(4):460–469.

12.

Logan

, Weinstein

. The epidemiology of carbapenem-resistant Enterobacteriaceae: The impact and evolution of a global menace. J Infect Dis, 2017; 215(suppl_1):S28–S36.

13.

Sharma

, Grover

, Arora

, et al. Risk factors and outcomes of carbapenem-resistant Enterobacteriaceae colonization and infections in trauma patients. J Lab Physicians, 2023; 15:45–51.

14.

Rajni

, Gupta

, Kumar

, et al. Carbapenem-resistant Enterobacteriaceae colonization in intensive care units: Prevalence and risk factors. Indian J Crit Care Med, 2018; 22:632–637.

15.

Mohan

, Prasad

, Kaur

, et al. Risk factors, clinical presentation, and outcomes of infections due to carbapenem-resistant Enterobacteriaceae in a tertiary care hospital in North India. Indian J Crit Care Med, 2017; 21:573–578.

16.

Kumar

, Gupta

, Nag

. Risk factors for carbapenem-resistant Enterobacteriaceae colonization in hospitalized patients: A prospective study. Indian J Med Microbiol, 2018; 36:60–66.

17.

Bharadwaj

, Joshi

, Dohe

, et al. Incidence and risk factors for colonization with carbapenem-resistant Enterobacteriaceae among patients admitted to an intensive care unit in Pune, India. BMC Infect Dis, 2018; 18:504.

18.

Ramanathan

, Swaminathan

, Kumar

, et al. Risk factors for carbapenem-resistant Enterobacteriaceae acquisition among adults: A case-control study. Antimicrob Resist Infect Control, 2018; 7:57.

19.

Boyd

, Holmes

, Peck

, et al. OXA-48-like β-lactamases: Global epidemiology, treatment options, and development pipeline. Antimicrob Agents Chemother, 2022; 66(8):e0021622.

20.

Wang

, Zhang

, Yao

, et al. Risk factors and clinical outcomes for carbapenem-resistant Enterobacteriaceae nosocomial infections. Eur J Clin Microbiol Infect Dis, 2016; 35(10):1679–1689.

21.

Saseedharan

, Sahu

, Chaddha

, et al. Factors associated with carbapenem-resistant Enterobacteriaceae in patients admitted to a tertiary care hospital in Mumbai, India. J Assoc Physicians India, 2016; 64:14–18.

22.

Castanheira

, Doyle

, Deshpande

, et al. Activity of ceftazidime/avibactam, meropenem/vaborbactam and imipenem/relebactam against carbapenemase-negative carbapenem-resistant Enterobacterales isolates from US hospitals. Int J Antimicrob Agents, 2021; 58(5):106439.

23.

Mittal

, Gaind

, Kumar

, et al. Phenotypic and molecular characterization of carbapenem-resistant Enterobacteriaceae in a tertiary care hospital in Delhi, India. Indian J Med Microbiol, 2016; 34:32–37.

24.

Balaji

, Jeremiah

, Baliga

. Polymyxins: Antimicrobial susceptibility concerns and therapeutic options. Indian J Med Microbiol, 2019; 37:457–464.

25.

Yuan

, Li

, Wang

, et al. Emergence of colistin resistance and mcr genes in carbapenem-resistant Enterobacteriaceae in Henan Province. China. Front Microbiol, 2022; 13:812418.

26.

Dautzenberg

, Wekesa

, Gniadkowski

, et al.; Mastering hOSpital Antimicrobial Resistance in Europe Work Package 3 Study Team. The association between colonization with carbapenemase-producing Enterobacteriaceae and overall ICU mortality: An observational cohort study. Crit Care Med, 2015; 43(6):1170–1177.

27.

Papadimitriou-Olivgeris

, Marangos

, Fligou

, et al. Risk factors for infection with metallo-β-lactamase-producing Klebsiella pneumoniae after exposure to imipenem or colistin. Antimicrob Agents Chemother, 2013; 57:258–262.

28.

Ripabelli

, Sammarco

, Salzo

, et al. New Delhi metallo‐β‐lactamase (NDM‐1)‐producing Klebsiella pneumoniae of sequence type ST11: First identification in a hospital of central Italy. Lett Appl Microbiol, 2020; 71(6):652–659.