Virulence Profiling of Multidrug-Resistant Clinical Staphylococcus aureus Isolates

Abstract

Staphylococcus aureus

is a critical global health threat due to its multidrug resistance (MDR) and virulence. We examined the relationship between MDR and virulence in 250 clinical S. aureus isolates using the Galleria mellonella infection model. Alpha-hemolysin was the most prevalent toxin, with its gene, hla, present in the majority of hemolytic strains. Other virulence genes, including sigB, codY, fnbA, fnbB, clfA, saeS, sarA, arlS, yycG, spoVG, rot, and PVL, were widely distributed across methicillin-resistant S. aureus (MRSA) and methicillin-sensitive S. aureus (MSSA) isolates. The ica gene showed a notable increase in expression in hospital-acquired (HA-MRSA) and community-acquired (CA-MRSA) strains. In vivo infections revealed that HA-MRSA strains were more virulent than vancomycin intermediate S. aureus VISA, CA-MRSA, MSSA, and an agr mutant strain, while locally sourced CA-MRSA exhibited the highest virulence among tested strains. Despite differences in antibiotic resistance, MRSA and MSSA shared largely similar virulence gene profiles. These findings highlight the complex interplay between MDR and virulence in S. aureus and emphasize the need for further mechanistic studies.

Importance:

S. aureus remains a major clinical concern due to its increasing multidrug resistance (MDR) and virulence. Understanding the relationship between resistance mechanisms and virulence is essential for guiding effective treatment and infection control. This study assessed the virulence potential of 250 MDR S. aureus isolates using a clinically relevant invertebrate model (G. mellonella), revealing key virulence gene profiles. Notably, CA-MRSA strains exhibited hypervirulence, with alpha-hemolysin as the most prevalent toxin and significant upregulation of the ica gene in both CA- and HA-MRSA isolates. These findings emphasize the growing threat of CA-MRSA and the importance of integrated surveillance of both resistance and virulence in S. aureus populations.

Keywords

virulence factors MRSA MSSA

Introduction

Staphylococcus aureus ranks among the most prevalent opportunistic human pathogens, leading to a variety of complex infections, particularly in skin and other soft tissues. It is associated with multiple types of infections, including endocarditis and bacteremia, as well as osteoarticular, pleuropulmonary, and other device-related infections.¹ Increasingly, multidrug-resistant (MDR) strains of S. aureus are spreading globally, leading to high morbidity and mortality rates and posing a serious threat to healthcare systems and public health worldwide.² S. aureus produces several virulence factors that promote damage to host tissues and contribute to evasion from the host immune response.^3–5 The major S. aureus virulence factors are exotoxins, enterotoxins, and enzymes such as coagulase and hemolysin, which are involved in biofilm formation and bacterial quorum sensing.^6–10 The presence of these virulence factors contributes to pathogenesis. Fibronectin-binding proteins, clumping factors, and Panton–Valentine leukocidin (PVL) promote tissue adherence and soft tissue infections, whereas enterotoxins and exfoliative toxins are involved in severe invasive infections, food poisoning, and scalded skin syndrome.¹¹ Biofilm formation plays a critical role in pathogenesis, as the ica gene contributes to S. aureus virulence as well as biofilm formation.¹² Most notably, a major cytolysin known as α-toxin lyses many cells, including leukocytes.¹³ Surface-exposed proteins (MSCRAMMs—microbial surface components recognizing adhesive matrix molecules) bind to various extracellular matrix factors such as collagen, fibrinogen, elastin, laminin, and fibronectin.¹⁴ Control of these virulence factors in bacteria is linked to the accessory gene regulatory system (agr) gene and the ability of bacteria to evade autophagosomes, which leads to intracellular survival within phagocytes.¹⁵ In S. aureus, the Agr system has been shown to regulate a variety of virulence factors, as demonstrated in G. mellonella—the wax moth larvae.¹⁶

The larval stage of the G. mellonella is a valuable insect model since it survives at 37°C, which is essential for the demonstration of specific microbial virulence factors.¹⁷ The larvae are inexpensive to obtain and easy to maintain using basic equipment.¹⁸ The model does not require ethical approval and, coupled with its fast reproduction time, allows for high-throughput experimentation compared with mammalian systems. Hemocytes in the larvae constitute the primary cellular immune response, participating in phagocytosis, encapsulation, and clotting as part of the antimicrobial response.¹⁹ In addition, the humoral response consists of various antimicrobial peptides, opsonins, extracellular nucleic acid traps, and the phenol-oxidase pathway. G. mellonella has become a widely adopted model to study different bacterial human pathogens such as Pseudomonas,²⁰ Enterococcus,²¹ and S. aureus.²² Using this model, we attempted to (1) characterize virulence factors in clinical methicillin-resistant S. aureus (MRSA) and methicillin-sensitive S. aureus (MSSA) isolates, (2) assess the intracellular survival of Agr II and III subgroups in RAW 264.7 macrophages, and (3) evaluate the pathogenicity of selected local isolates using the G. mellonella infection model.

S. aureus is a highly adaptable microorganism that harbors various virulence factors, which contribute to its pathogenicity. In the current study, major virulence factors associated with MDR were screened, and their contribution to pathogenesis was investigated in isolated obtained from various clinical specimens.

Methods

Selection of MDR–S. aureus isolates

A total of 1528 clinical staphylococci isolates were collected from various clinical samples at the Microbiological Laboratory of Pakistan Institute of Medical Sciences (PIMS), Islamabad. The study isolates were obtained from different specimens, including blood, catheter tip, cerebrospinal fluid, Central Venous Pressure (CVP)Tip Culture, pus, sputum, the tip of the drain tracheal secretions, and urine from patients of both genders and varying ages. Isolates were collected during April 2015 to July 2016. Patient’s age, gender, ward, and clinical specimen were collected from the hospital database. Ethical approval (No. F. 1-1/2015/ERB/SZABMU) was obtained for the current study from the Ethics Review Board of PIMS, Islamabad. Standard microbiological procedures were applied to identify S. aureus²³ and 250 clinical isolates were selected in the current study.

Detection of hemolysis, virulence factors, and regulatory genes

The hemolysin assay was carried out for all selected isolates as described previously.²⁴ Screening of hemolysin genes (hla, hlb, hlg, hld) was conducted in isolates that were phenotypically hemolysin positive. Each experiment was performed in triplicate for each isolate, with three independent biological replicates. Other virulence and regulatory genes, including alternative sigma factor (sigB) and Gene expression regulator (codY)²⁵; fibronectin-binding protein A (fnbA) and fibronectin-binding protein B (fnbB)²⁶; Clumping factor A (clfA)²⁷; Biofilm-related staphylococcal accessory regulator (sarA)²⁸; cytotoxin PVL²⁹; two-component system of S. aureus positively controls autolytic activity and cell wall metabolism WalK/WalR (YycG/YycF) autolytic activity (yycG)³⁰; the stage V sporulation protein G (yabJ-spoVG operon, (spoVG)³¹; Surface and secreted protein for bacterial aggregation (spa)²⁵; two-component system has been shown to affect many cellular processes in S. aureus , including autolysis, biofilm formation etc (arls)³²; TCS (phosphorylated response regulators) (Histidine protein kinase) (seaS)³³; Transcriptional regulator (rot)³⁴; and enterotoxin genes such as sea, seb, and sec³⁵ were screened using single or multiplex polymerase chain reaction (PCR) as appropriate. Primer sequences used for PCR are listed in Table 1. Two multiplex PCRs were performed for virulence factors: (1) fnbB, sae, sarA, YycG, clfA, and sec gene and (2) rot, arls, codY, sigB, sae, and seb. Single-plex PCR was performed for PVL and spoVG gene, and the rest were screened through multiplex. To minimize fragmentation and ensure methodological clarity, all PCR assays were performed using a unified cycling protocol, except for gene-specific annealing adjustments required for hemolysins. All PCR assays, except those targeting hemolysin genes, were performed using a unified cycling protocol consisting of an initial denaturation at 95°C for 5 minutes, followed by 10 cycles of 95°C for 60 seconds, 51°C for 60 seconds, and 72°C for 60 seconds, then 20 additional cycles of 94°C for 60 seconds, 51°C for 60 seconds, and 72°C for 60 seconds, with a final extension at 72°C for 10 minutes. Hemolysin genes (hla, hlb, hlg, and hld) were amplified using the same cycling steps but with gene-specific annealing temperatures: 56°C for hla, 58°C for hlb, 58°C for hlg, and 47°C for hld. PCR products were resolved by gel electrophoresis on a 2% agarose gel (Sigma, St. Louis, MO, USA). Five microliters of each PCR sample were loaded on a 2% gel along with a 100 bp DNA marker (Vivantis, Malaysia) and electrophoresed for 45 minutes at 90 V in a horizontal gel electrophoresis apparatus (BioRad, CA, USA).

Table 1.

Primer Sequences of Virulence Genes

Gene	Amplicon length	Primers	Reference
PVL	151	F: CAGGAGGTAATGGTTCATTT	²⁹
		R: ATGTCCAGACATTTTACCTAA
hla	209	F: CTGATTACTATCCAAGAAATTCG	(Jarraud et al., 2002)
		R: CTTTCCAGCCTACTTTTTTATCT
hlb	833	F: GCC AAA GCC GAA TCT AAG	(Booth et al., 2001)
		R: GCG ATA TAC ATC CCA TGG C
hlg	535	F: GTCAYAGAGTCCATAATGCATTTAA	(Jarraud et al., 2002)
		R: CACCAAATGTATAGCCTAAAGTG
hld	444	F: ATGGCAGCAGATATCATTTC	(Rosec and Gigaud, 2002)
		R: CGTGAGCTTGGGAGAGAC
spa	Variable sizes	F: GCGCAACACGATGAAGCTCAACAA	²⁵
		R: ACGTTAGCACTTTGGCTTGGATCA
sigB	156	F: TCAGCGGTTAGTTCATCGCTCACT	²⁵
		R: GTCCTTTGAACGGAAGTTTGAAGCC
codY	120	F: AAAGAAGCGCGCGATAAAGCTG	²⁵
		R: TGCGATTAATAGGCCTTCCGTACC
fnbA	185	F: ACTTGATTTTGTGTAGCCTTTTT	²⁶
		R: GAAGAAGCACCAAAAGCAGTA
fnbB	118	F: CGTTATTTGTAGTTGTTTGTGTT	²⁶
		R: TGGAATGGGACAAGAAAAAGAA
clfA	151	F: CGGTTTTGGACTACTCAGCA	²⁷
		R: GCTACTGCCGATAAACTA
sarA	173	F: CCTCGCAACTGATAATCCTTATG	²⁸
		R: ACGAATTTCACTGCCTAATTTGA
arlS	103	F: TGGAATACCAATTCCATGATCT	³²
		R: TGCAATCAAATATGATGTGAAGAA
spoVG	51	F: TGTTCGTTGCAATGCCAAGT	³¹
		R: TGTCGCGGAATTCACCATC
saeS	110	F: ATCCGAACAACAAGAAAAAACAG	³³
		R: TGATTATACCATCACGTAGTCCTTCA
rot	126	F: AAGAGCGTCCTGTTGACGAT	³⁴
		R: TTTGCATTGCTGTTGCTCTA
sae	102	F: GGTTATCAATGTGCGGGTGG	³⁵
		R: CGGCACTTTTTTCTCTTCGG
seb	164	F: GTATGGTGGTGTAACTGAGC	³⁵
		R: CCAAATAGTGACGAGTTAGG
sec	451	F: AGATGAAGTAGTTGATGTGTATGG	³⁵
		R: CACACTTTTAGAATCAACCG
yycG	198	F: ACAATCCCTTCATACTAAACTTGTAATTG	³⁰
		R: TGCATTTACGGAGCCCTTTTCGTCATATAC

Real-time quantitative PCR assays

Agr is linked with autophagosome protection of bacterial cells that leads to intracellular survival within phagocytes and mainly controls a variety of virulence factors in S. aureus strains. This experiment was performed to check the expression of ica and agr genes in hospital-acquired (HA)-MRSA (SCCmec type III) and CA-MRSA (SCCmec type IV) without any stress. An overnight culture of clinical MRSA strain was grown in tryptic soy broth and inoculated into new Mueller Hinton Broth. The bacterial cells were harvested when the OD₆₀₀ reached 0.6. RNA isolation was done with the RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The Verso cDNA synthesis kit (Thermo Fisher Scientific, MA, USA) was used for cDNA synthesis. Real-time quantitative PCR (RT-qPCR) was performed in the iCycler iQ RT detection system (Bio-Rad, CA, USA) using the manufacturer’s instructions and previously reported primers.^25,36 No-RT control was included as a negative control. According to Mitchell et al., the relative expression ratios of the RT-qPCR products were calculated as follows: n-fold expression = 2 − ΔΔCt, ΔΔCt = ΔCt, where ΔCt represents the difference between the cycle threshold (Ct) of the gene studied and the Ct of the housekeeping 16S rRNA gene (internal control).³⁷ Primer sequence for the 16S rRNA gene used previously.³⁸ Three clinical isolates were selected for expression analysis: HA-MRSA, CA-MRSA, and S. aureus as a control. The isolates were characterized as HA-MRSA and CA-MRSA. Expression of agrA (Accessory Gene Regulator A, a quorum-sensing regulator)³⁶ and the ica locus involved in intercellular adhesion and essential for biofilm formation in S. aureus²⁵ was analyzed using primers based on published sequences through RT-PCR. RT-qPCR analyses included three biological isolates per group, each run in technical triplicate, with appropriate negative controls. Statistical significance was calculated using Student t test.

G. mellonella infection assay

Sixteen G. mellonella larvae (Vanderhorst Wholesale, St. Mary’s, OH, USA), selected randomly and weighing between 300 and 350 mg, were used for each group.²² Overnight cultures of previously characterized strains of HA-MRSA (SCCmec type III), VISA (8 mg/L), CA-MRSA (SCCmec type IV), a strain of MSSA, and agr mutant RN4220 cells were used. After incubation, the cells were washed and suspended in phosphate buffered saline (PBS) at an optical density of absorbance 600 (OD600) of 0.5. A 10-μL (2 × 10⁶ cells/mL) inoculum was injected into the last left proleg of each larva using a Hamilton syringe and incubated at 37°C. Seven test groups were included in the current study, and identical doses of bacteria were injected into the corresponding infection groups: (1) PBS alone (no bacteria control), (2) HA-MRSA cells, (3) VISA cells, (4) CA-MRSA cells, (5) no injection and no bacteria (quality control), (6) MSSA, and (7) agr mutant cells RN4220. G. mellonella survival was assessed up to 144 hours, with larvae considered dead if unresponsive to touch using sterile tips. Killing curves and differences in survival were analyzed by the Kaplan–Meier method using STATA software. Each experimental group included 16 larvae, and experiments were repeated three times independently. Larvae were randomly assigned to treatment groups to minimize bias. Statistical analysis was performed, and p < 0.05 was considered significant.¹⁶

Hemocyte assay

Hemolymph was collected from G. mellonella by cutting the base of the last proleg with a No. 10 scalpel and allowed to drip into a chilled 1.5 mL Eppendorf tube containing cold IPS. Not enough hemolymph was captured from a single larva for reliable counting. Therefore, G. mellonella hemolymph was pooled from groups of four larvae into a single tube on ice. An aliquot of 0.1 mL of the collected material was diluted 1:10 in a fresh Eppendorf microcentrifuge tube containing 0.9 mL of cold IPS. An aliquot of 0.01 mL of the diluted material was transferred to the hemocytometer to count the hemocytes. If the hemocyte number was too high, the hemocyte suspension was diluted further, and the number of hemocytes present per milliliter was calculated. As a control, the number of larvae infected in each treatment group was compared with those treated with PBS alone. This provided a baseline of the number of hemocytes present normally. Four replicates were used to generate the standard deviation and an average number of hemocytes for a treatment/infection. Greater hemocyte numbers equate to less virulent, while lower hemocyte numbers equate to more virulent.¹⁶ Hemolymph from four larvae was pooled per replicate, with four independent replicates per treatment group, providing robust estimates of hemocyte numbers.

Statistical analysis

Survival curves were analyzed using the Kaplan–Meier method. Differences between groups were assessed with the log-rank test. For continuous variables (e.g., RT-qPCR, hemocyte counts), Student t test was applied, with p < 0.05 considered statistically significant. The number of biological and technical replicates was chosen to provide sufficient statistical power.

Results

Detection of virulence and toxin genes

For this study, a total of 250 S. aureus isolates were selected from 1,528 isolates, comprising 200 MRSA and 50 MSSA strains. A preliminary hemolysis test was performed to assess the phenotypic activity of S. aureus hemolysins (Fig. 1A). Alpha-hemolysis (partial hemolysis with a greenish or brownish zone around the bacterial colony) was observed in 45% of isolates, followed by beta-hemolysis (complete hemolysis with a clear zone around the colony) in 28% and gamma-hemolysis (no hemolysis) in 27%. Phenotypically positive isolates were further screened for hemolysin genes by PCR, as shown in Figure 1B. Among phenotypically positive MRSA isolates, the alpha-hemolysin gene (hla) was detected in 80%, beta-hemolysin (hlb) in 65%, gamma-hemolysin (hlg) in 57.7%, and delta-hemolysin (hld) in 3.2%. For MSSA, the hla gene was detected in 80%, hlb in 71.42%, and hlg in 50% of isolates. Overall, alpha-hemolysin production was more prevalent than beta- and gamma-hemolysin (Fig. 1B). In addition to hemolysins, other virulence factor genes involved in host–pathogen interactions and S. aureus pathogenicity were detected in MRSA and MSSA isolates using multiplex PCR (Fig. 2). These included alternative sigma factor (sigB), gene expression regulator (codY), fnbA and fnbB, clumping factor A (clfA), biofilm-related staphylococcal accessory regulator (sarA), the WalK/WalR two-component system (yycG/yycF), autolytic activity gene (yycG), stage V sporulation protein G (spoVG), surface protein A (spa), and transcriptional regulator (rot). Approximately 24% of MRSA and 10% of MSSA isolates were positive for PVL (Table 2, Fig. 2). RT-PCR gene expression analysis showed that agr was downregulated by 0.5-fold in both HA-MRSA and CA-MRSA compared with control strains, whereas ica expression was upregulated 2.5-fold in both MRSA subtypes relative to controls (Fig. 3).

FIG. 1.

Hemolysis patterns and PCR detection of hemolysin genes in Staphylococcus aureus isolates. (A). A representative sheep blood agar plate with S. aureus growth shows the different types of hemolysis, a clear zone termed beta-hemolysis and partially used red blood cell alpha-hemolysis and lack of any change in the medium is termed no hemolysis (gamma hemolysis). (B). Representative gel images showing PCR amplification of the hemolysin gene. (A) Lane M shows the molecular weight marker of Gene Ruler 100 bp (Thermo Fisher Scientific). Lanes 6, 11, 12, and 14 show amplification of hla gene (209 bp), and lane 2 shows positive control for the hla gene. (B) Lane M shows the molecular weight marker of Gene Ruler 100 bp (Thermo Fisher Scientific). Lane 3 shows the amplification of the hlb gene (833 bp). (C) Lane M shows the molecular weight marker of Gene Ruler 100 bp (Thermo Fisher Scientific). Lane 5 shows the amplification of the hlg gene (535 bp). (D) Lane M shows the molecular weight marker of Gene Ruler 100 bp (Thermo Fisher Scientific). Lanes 13 and 14 show amplification of the hld gene (440 bp). PCR, polymerase chain reaction.

FIG. 2.

Virulence markers of clinical isolates. Representative gel images show PCR amplification of various virulence markers (M), which shows the molecular weight marker of 100 bp (Thermo Fisher Scientific). (A) Lanes 1–13 show the amplification of the codY gene (120 bp). (B) Lanes 1, 2, and 7–12 show amplification of the sigB gene (156 bp). (C) Lanes 1–8 show the amplification of the fnbB gene (118 bp), lanes 9–16 show the amplification of the rot gene (126 bp), and lanes 17–19 show the amplification of the fnbA gene (185 bp). (D) Lanes 1–5 show the amplification of the saeS gene (103 bp), and lanes 6–13 show the amplification of the spovG gene of variable sizes. (E) Lanes 1–5 show the amplification of arls gene (103 bp), lanes 6–9 show amplification of the sarA gene (173 bp), and lanes 17–19 show the amplification of the yyG gene (198 bp). (F) Lanes 1–7 show the amplification of clfA gene (151 bp). (G) Lanes 1, 3, and 6 show the amplification of PVL toxin (151 bp). (H) Lanes 1, 3, 6, 7, and 8 show amplification of the enterotoxin gene sae (102 bp). (I) Lanes 1–7 show the amplification of the seb gene (451 bp). (J) Lanes 1–7 show the amplification of the sec gene (164 bp).

FIG. 3.

Gene expression analysis of agrA and ica in HA-MRSA and CA-MRSA clinical isolates. Relative expression levels of the quorum-sensing regulator agrA and the intercellular adhesion locus ica were quantified in hospital-acquired (HA-MRSA) and community-acquired (CA-MRSA) clinical isolates using real-time PCR. Both HA-MRSA and CA-MRSA strains showed a significant upregulation of ica compared with the reference Staphylococcus aureus strain, indicating enhanced biofilm-forming potential. Data are represented as mean ± SD from three independent experiments. Statistical significance was determined using Student t test (p < 0.05). MRSA, methicillin-resistant S. aureus; SD, standard deviation.

Table 2.

The Percentages of a Virulence Factor of MRSA and MSSA

S. no.	Virulence genes	MRSA percentage	MSSA percentage
1	codY	86	84
2	sigB	58	62
3	fnbA	87	86
4	fnbB	86	82
5	clfA	55	52
6	sarA	52	50
7	arls	68	64
8	yycG	74	72
9	spovG	78	70
10	rot	79	76
11	sea	10	6
12	seb	5	4
13	sec	2	4
14	saeS	57	56

Prevalence of virulence factors in MRSA and MSSA isolates

The most prevalent virulence factors in MRSA isolates were fnbA, codY, and fnbB, detected in 87%, 86%, and 86% of strains, respectively. These were followed by rot, spoVG, and yycG, present in 79%, 78%, and 74% of isolates, respectively. In contrast, lower frequencies were observed for sae (10%), seb (5%), and sec (2%) (Table 2). For MSSA isolates, the dominant virulence factors were also fnbA (86%), codY (84%), and fnbB (82%), followed by rot (76%), spoVG (70%), and yycG (72%). Low frequencies were seen for sae (6%), seb (4%), and sec (4%) (Table 2). Overall, a similar distribution of virulence factors was observed between MRSA and MSSA isolates.

Comparative virulence of drug-resistant S. aureus strains in the G. mellonella infection model

First, we optimized the lethal dose of clinical S. aureus, determining that 1.0 × 10⁷ CFU was sufficient to cause 100% mortality in G. mellonella larvae compared with the control group (Fig. 4). PBS-injected larvae served as the control (Fig. 4A). A comparison between MRSA and VISA isolates revealed a statistically significant difference in mortality (p = 0.0001; Fig. 4B and D). Clinical S. aureus was injected into G. mellonella (n = 16) in a dose-dependent manner, and higher doses induced faster mortality (Fig. 4C). Specifically, 1.0 × 10⁷ CFU caused 100% mortality within 24 hours, whereas a lower dose (10⁶ CFU) resulted in slower progression of infection (Fig. 4C). Next, five representative isolates of S. aureus were selected for survival and hemocyte density assays, as described in the Methods section. These included MSSA (carrying the mecA gene), VISA, CA-MRSA (SCCmec type IV), HA-MRSA (SCCmec type III), and the agr mutant RN4220. A selected MRSA isolate induced 100% mortality in G. mellonella (Fig. 4E). In contrast, the selected VISA and CA-MRSA isolates showed 75% and 50% mortality, respectively, at 24 hours postinfection (Fig. 4D). However, both reached 100% mortality at 48 and 72 hours, respectively (Fig. 4D). MSSA-injected larvae exhibited a lower death rate (75%), while up to 90% of larvae injected with the agr mutant strain RN4220 survived (Fig. 4K). The uninfected control groups (PBS + PBS) demonstrated 100% survival (p = 0.00001; Fig. 4). A comparative graph illustrated that HA-MRSA, CA-MRSA, and VISA strains were more virulent than MSSA and the agr mutant RN4220 (Fig. 4E–K).

FIG. 4.

Kaplan–Meier plot of survival after infection with MRSA isolate. Galleria mellonella were infected with 1.0 × 10⁷ CFU/larvae with 16 larvae per group. In the control group, G. mellonella were injected with only PBS. Death of all G. mellonella was observed after 24 hours in case of MRSA isolate: (A) optimization of bacterial dose within 24 hours of infection, (B) comparison of MRSA isolate with PBS, (C) dose-dependent killing of MRSA isolates, (D) comparison of VISA isolate with PBS, (E) comparison of MRSA with MSSA, (F) comparison of MRSA with RN4220, (G) comparison of CA-MRSA with RN4220, (H) comparison of CA-MRSA with MSSA, (I) comparison of VISA with RN4220, (J) comparison of VISA with MSSA, and (K) survival assay of representative isolates. HA-MRSA kills all the G. mellonella within 24 hours, followed by VISA, CA-MRSA, MSSA, and agr mutant RN4220.

Finally, we evaluated the hemocyte density to determine the virulence profile of drug-resistant S. aureus. Hemocytes were collected from G. mellonella larvae 5 hours after infection with MRSA, MSSA, VISA, and agr-mutant S. aureus. Hemocyte counts, obtained using a hemocytometer, showed a decrease in the group injected with CA-MRSA, indicating that CA-MRSA is hypervirulent (Fig. 5A). However, a significantly greater reduction in hemocyte density was observed in larvae infected with HA-MRSA, MSSA, VISA, and agr mutant RN4220 compared with those infected with CA-MRSA (p = 0.001; Fig. 5B). PBS injection served as the control. Our local clinical CA-MRSA strain was found to be more virulent than the selected HA-MRSA, MSSA, VISA, and agr mutant RN4220 strains, as shown in Figure 5A and B. This experiment was evaluated both technically and biologically to ensure reliability and reproducibility.

FIG. 5.

Hemocyte density and comparative virulence of Staphylococcus aureus strains in Galleria mellonella. (A) Hemocyte density measured 5 hours postinfection in G. mellonella larvae. Larvae were injected with different S. aureus strains, and PBS was used as an uninfected control. A significant reduction in hemocyte count indicates immune suppression in infected groups. (B) Comparative virulence assessment shows that CA-MRSA exhibits greater pathogenicity than HA-MRSA, MSSA, VISA, and the agr mutant strain RN4220, based on larval survival and immune response parameters.

Discussion

S. aureus produces a variety of virulence factors.⁴² Our study demonstrated that most isolates were positive for alpha- and beta-hemolysis. However, there were differences in the expression of gamma hemolysin,⁴³ and even coagulase-negative S. aureus (CoNS) were found to contain the hlg gene.⁴⁴ Gamma hemolysin also has a role in staphylococcal virulence and is more frequently expressed in CoNS⁴⁵; however, in our study, only 4% of isolates were positive for the hld gene. The differences in toxin production, which may be influenced by various factors such as geographical regions, sample cource (animal, human, food), or the total number of isolates are included in the study. In the current analysis, alpha-hemolysin production was more prevalent than beta-hemolysin in clinical strains, supporting previous findings.^46–50

An important virulence factor, known as alpha toxin, is produced by most (95%) strains of S. aureus.⁵⁰ In our study, the hla gene was detected in 80% isolates, while hlb gene was found in 65%, consistent with similar reports.^51,52 A previous report from Egypt reported the presence of various virulence factors such as fnbA, icaA, hla, and sea in 13.6%, 49.2%, 37.3%, and 72.9% of S. aureus isolates.⁵³ A study from Iran reported the presence of various virulence factors in S. aureus isolates, with the most dominant being hla in 91%, followed by sea (88%), clfB (65%), fnbB (45%), tsst (27%), and hlb gene in 13% of isolates.⁵⁴ Virulence gene profile was also evaluated as described by Islam et al.⁵⁶ in S. aureus isolated from Bovine mastitis,⁵⁵ and sea, seb, and sec were found in 0%, 7.4%, and 0%, rest of the genes were hla in 3.57%, hlb in 10.71%, and pvl in 17.85% of isolates.⁵⁵ Previous studies, especially those focused on MRSA, have reported variations in the prevalence of hla and hlb genes, which may be attributed to differences in geographical location, sample size, sample source, or horizontal gene transfer of virulence factors. In our study, the coexistence of hla and pvl genes was found in 3% of isolates, in agreement with findings by Rosatto et al.⁵⁷

The prevalence of PVL was also examined and aligns with findings from the same geographical region (Pakistan), where 16.4% of study isolates were PVL-positive.⁴⁶ In the current study, PVL was detected in strains isolated from human subjects between 2 and 10 years of age. Other studies reporting the presence of PVL in S. aureus isolates from children^57,58 support our observations. Globally, the prevalence of PVL-positive S. aureus varies significantly. For example, a study from Saudi Arabia reported that 54% of S. aureus isolates carried the PVL gene, while a study from India reported an even higher prevalence of 70.8%.⁵⁹ In contrast, lower prevalence rates have also been reported: 18.2% in Nepal,⁶⁰ 16.4% in Iran.⁶¹ In the United States, both USA300 and USA400 strains of MRSA—commonly associated with community-acquired (CA) infections—harbor the PVL toxin and are considered major contributors to skin and soft tissue infections.⁶² PVL is regarded as a hallmark of CA-MRSA and is rarely detected in HA (nosocomial) MRSA strains.⁶³ Several studies report varying prevalence rates of PVL-positive S. aureus isolates, ranging from 2% to 12%^64,65 to as low as 3.95%.⁶⁶ Earlier study also showed 20% of MRSA strains isolated from nasal carriers expressing PVL toxin.⁶⁷

The accessory gene regulator (agr) system controls a variety of virulence factors in S. aureus.⁶⁸ The agr gene locus is associated with autophagosome protection and facilitates the intracellular survival of S. aureus within host phagocytes.⁶⁹ In S. aureus, agr regulates a diverse set of virulence factors, which can vary between strains. Conversely, the ica locus is known to significantly enhance biofilm formation in S. aureus isolates.⁷⁰ In the current study, a decrease in agr gene expression was observed in both HA-MRSA and CA-MRSA strains compared with the control. However, overall agr expression remained higher than ica expression across all three sample groups (control, HA-MRSA, and CA-MRSA). Notably, increased expression of ica genes was observed in both HA-MRSA and CA-MRSA strains. While Gill et al. (2005) reported that antibiotic-resistant strains of S. aureus exhibited reduced virulence due to the fitness cost associated with resistance, which is not consistent with the current findings. We observed that antibiotic-resistant strains expressed multiple virulence factors, as confirmed by multiplex PCR.⁷¹ We observed that antibiotic-resistant strains expressed multiple virulence factors, as confirmed by multiplex PCR.⁷²

The agr mutant strains have been reported to exhibit attenuated virulence in mammalian models and similarly showed reduced virulence in G. mellonella, as described by Peleg et al. This supports our observations using the agr mutant strain RN4220. In our study, clinical isolates of HA-MRSA, CA-MRSA, VISA, and MSSA effectively killed wax moth larvae, consistent with findings reported by Fuchs et al.⁷³ It is likely that S. aureus grows, divides, and expresses a broader range of virulence factors more efficiently at 37°C than at lower temperatures such as 30°C or 25°C, resulting in more rapid larval death following injection. Typically, hemocyte density in larvae is inversely proportional to microbial pathogenic load.⁷⁴ The wax moth larval model demonstrated physiological responses at 37°C, a temperature that mimics human body conditions and induces the expression of several virulence factors.⁷⁵ Accordingly, in our experiments, G. mellonella larvae were incubated at 37°C postinjection, a temperature that better mimics human physiological conditions compared with 25°C or 30°C. We also tested a broader spectrum of isolates, including HA-MRSA, VISA, CA-MRSA, MSSA, and the agr mutant RN4220 in our infection model to assess bacterial pathogenesis in wax moth larvae. Notably, we observed a 100% mortality rate in larvae infected with HA-MRSA within 24 hours, a significantly higher virulence compared with VISA, CA-MRSA, MSSA, and agr mutant RN4220 strains. These results are consistent with previous studies.^16,73

Our study highlights the diverse virulence profile of MDR–S. aureus clinical isolates, marked by a high prevalence of alpha- and beta-hemolysins and PVL genes, especially in pediatric cases. While gamma-hemolysin expression was limited, antibiotic-resistant strains such as HA-MRSA and CA-MRSA exhibited strong virulence, challenging the notion of reduced pathogenicity due to resistance. Variations in agr and ica gene expression underline the regulatory complexity of virulence. The G. mellonella model effectively demonstrated the heightened pathogenicity of HA-MRSA, supporting its utility in in vivo studies. Taken together, this study highlights the genetic diversity and virulence adaptability of MDR–S. aureus and reinforces the need for continuous surveillance and molecular characterization to guide effective infection control and therapeutic strategies.

Conclusion

This study provides, to our knowledge, the first comprehensive analysis of virulence-associated genes in clinical MRSA and MSSA isolates from Pakistan. Our findings demonstrate a high prevalence of MDR–S. aureus strains harboring diverse virulence determinants relevant to human infections. While CA-MRSA isolates carried a broad array of virulence genes, survival analyses in G. mellonella showed that HA-MRSA caused rapid early mortality (100% at 24 hours), whereas CA-MRSA resulted in delayed mortality. Quantitative comparisons of survival curves and hemocyte counts indicate that both HA-MRSA and CA-MRSA exhibit high virulence, but with distinct temporal dynamics. These results highlight the pathogenic potential of local MRSA strains and underscore the importance of further investigations to delineate the genetic and regulatory factors driving virulence, which may inform effective therapeutic and infection control strategies.

Authors’ Contributions

A.A.K., R.Z., and E.M. conceived the idea. A.A.K. performed the experiments (PCR for various virulence factors, G. mellonella experiments, RT-PCR) at Mylonakis Laboratory. H.S. performed the hemolysis experiments in Dr. Rabaab Zahra Laboratory, Quaid-i-Azam University, Islamabad, Pakistan. N.T. and E.M. provided chemicals. R.Z., N.T., and E.M. designed the experiments, prepared the article, and supervised the study.

Footnotes

Acknowledgments

The authors would like to thank Kalim Ullah, Research Specialist, Department of Anaesthesiology, Aga Khan University, Karachi, Pakistan, for his valuable assistance and support.

Ethical Statement

Ethical approval (No. F. 1-1/2015/ERB/SZABMU) was obtained from the Ethics Review Board of PIMS, Islamabad.

Disclosure Statement

No competing financial interests exist.

Funding Information

The study was supported by NIH grant P01 AI083214 to E.M. A.F.K. was supported by the International Research Support Initiative Program of Higher Education Commission, Pakistan and the NRPU grant to R.Z. (Project No. 2018).

References

Tong

, Davis

, Eichenberger

, Holland

, Fowler

. Staphylococcus aureus infections: Epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev, 2015; 28(3):603–661.

Wilson

, Garud

, Feder

, Assaf

, Pennings

. The population genetics of drug resistance evolution in natural populations of viral, bacterial and eukaryotic pathogens. Mol Ecol, 2016; 25(1):42–66.

Bhatty

, Cruz

, Frank

, et al. E nterococcus faecalis pCF 10‐encoded surface proteins PrgA, PrgB (aggregation substance) and PrgC contribute to plasmid transfer, biofilm formation and virulence. Mol Microbiol, 2015; 95(4):660–677.

Thammavongsa

, Kim

, Missiakas

, Schneewind

. Staphylococcal manipulation of host immune responses. Nat Rev Microbiol, 2015; 13(9):529–543.

Theilacker

, Diederich

A-K

, Otto

, et al. Enterococcus faecalis glycolipids modulate lipoprotein-content of the bacterial cell membrane and host immune response. PLoS One, 2015; 10(7):e0132949.

Otto

. Staphylococcus aureus toxins. Curr Opin Microbiol, 2014; 17:32–37.

Cheng

, McAdow

, Kim

, Bae

, Missiakas

, Schneewind

. Contribution of coagulases towards Staphylococcus aureus disease and protective immunity. PLoS Pathog, 2010; 6(8):e1001036.

Archer

, Mazaitis

, Costerton

, Leid

, Powers

, Shirtliff

. Staphylococcus aureus biofilms: Properties, regulation, and roles in human disease. Virulence, 2011; 2(5):445–459.

Liu

, Essex

, Buchanan

, et al. Staphylococcus aureus golden pigment impairs neutrophil killing and promotes virulence through its antioxidant activity. J Exp Med, 2005; 202(2):209–215.

10.

Novick

, Geisinger

. Quorum sensing in staphylococci. Annu Rev Genet, 2008; 42:541–564.

11.

Algammal

, Ibrahim

, Alfifi

, et al. A first report of molecular typing, virulence traits, and phenotypic and genotypic resistance patterns of newly emerging XDR and MDR Aeromonas veronii in Mugil seheli. Pathogens, 2022; 11(11):1262.

12.

Chen

, Betzer

, Fan

, et al. Multifunctional dendrimer-entrapped gold nanoparticles for labeling and tracking T cells via dual-Modal computed tomography and fluorescence imaging. Biomacromolecules, 2020; 21(4):1587–1595.

13.

Liu

, Archer

, Dillen

, et al. Staphylococcus aureus epicutaneous exposure drives skin inflammation via IL-36-mediated T cell responses. Cell Host Microbe, 2017; 22(5):653–666.e5.

14.

Moormeier

, Bayles

. Staphylococcus aureus biofilm: A complex developmental organism. Mol Microbiol, 2017; 104(3):365–376.

15.

O’Keeffe

, Wilk

, Leech

, et al. Manipulation of autophagy in phagocytes facilitates Staphylococcus aureus bloodstream infection. Infect Immun, 2015; 83(9):3445–3457.

16.

Peleg

, Monga

, Pillai

, Mylonakis

, Moellering

Jr , Eliopoulos

. Reduced susceptibility to vancomycin influences pathogenicity in Staphylococcus aureus infection. J Infect Dis, 2009; 199(4):532–536.

17.

Smoot

, Smoot

, Graham

, et al. Global differential gene expression in response to growth temperature alteration in group A Streptococcus. Proc Natl Acad Sci USA, 2001; 98(18):10416–10421.

18.

Ramarao

, Nielsen-Leroux

, Lereclus

. The insect Galleria mellonella as a powerful infection model to investigate bacterial pathogenesis. J Vis Exp, 2012(70):e4392.

19.

Tojo

, Naganuma

, Arakawa

, Yokoo

. Involvement of both granular cells and plasmatocytes in phagocytic reactions in the greater wax moth, Galleria mellonella. J Insect Physiol, 2000; 46(7):1129–1135.

20.

Benthall

, Touzel

, Hind

, et al. Evaluation of antibiotic efficacy against infections caused by planktonic or biofilm cultures of Pseudomonas aeruginosa and Klebsiella pneumoniae in Galleria mellonella. Int J Antimicrob Agents, 2015; 46(5):538–545.

21.

Lebreton

, Le Bras

, Reffuveille

, et al. Galleria mellonella as a model for studying Enterococcus faecium host persistence. J Mol Microbiol Biotechnol, 2011; 21(3–4):191–196.

22.

Gibreel

, Upton

. Synthetic epidermicin NI01 can protect Galleria mellonella larvae from infection with Staphylococcus aureus. J Antimicrob Chemother, 2013; 68(10):2269–2273.

23.

Kateete

, Kimani

, Katabazi

, et al. Identification of Staphylococcus aureus: DNase and Mannitol salt agar improve the efficiency of the tube coagulase test. Ann Clin Microbiol Antimicrob, 2010; 9(1):23.

24.

Quinn

. Clinical veterinary microbiology. (No Title). 1994.

25.

, Xu

, Yestrepsky

, et al. Novel inhibitors of Staphylococcus aureus virulence gene expression and biofilm formation. PLoS One, 2012; 7(10):e47255.

26.

Ferreira

, Souza

, de Sousa Moraes

, et al. Impact of agr dysfunction on virulence profiles and infections associated with a novel methicillin-resistant Staphylococcus aureus (MRSA) variant of the lineage ST1-SCCmec IV. BMC Microbiol, 2013; 13(1):93.

27.

Xue

, You

, Shang

, Sun

. Rot and Agr system modulate fibrinogen-binding ability mainly by regulating clfB expression in Staphylococcus aureus NCTC8325. Med Microbiol Immunol, 2012; 201(1):81–92.

28.

White

, Boyd

, Horswill

, Nauseef

. Phosphatidylinositol-specific phospholipase C contributes to survival of Staphylococcus aureus USA300 in human blood and neutrophils. Infect Immun, 2014; 82(4):1559–1571.

29.

Al-Talib

, Yean

, Al-Khateeb

, et al. A pentaplex PCR assay for the rapid detection of methicillin-resistant Staphylococcus aureus and Panton-Valentine Leucocidin. BMC Microbiol, 2009; 9(1):113.

30.

Dubrac

, Boneca

, Poupel

, Msadek

. New insights into the WalK/WalR (YycG/YycF) essential signal transduction pathway reveal a major role in controlling cell wall metabolism and biofilm formation in Staphylococcus aureus. J Bacteriol, 2007; 189(22):8257–8269.

31.

Bischoff

, Brelle

, Minatelli

, Molle

. Stk1-mediated phosphorylation stimulates the DNA-binding properties of the Staphylococcus aureus SpoVG transcriptional factor. Biochem Biophys Res Commun, 2016; 473(4):1223–1228.

32.

Truong-Bolduc

, Dunman

, Eidem

, Hooper

. Transcriptional profiling analysis of the global regulator NorG, a GntR-like protein of Staphylococcus aureus. J Bacteriol, 2011; 193(22):6207–6214.

33.

Wozniak

, Tiwari

, Soufan

, Jayaswal

. The mcsB gene of the clpC operon is required for stress tolerance and virulence in Staphylococcus aureus. Microbiology (Reading), 2012; 158(Pt 10):2568–2576.

34.

Mootz

, Benson

, Heim

, et al. Rot is a key regulator of Staphylococcus aureus biofilm formation. Mol Microbiol, 2015; 96(2):388–404.

35.

Mehrotra

, Wang

, Johnson

. Multiplex PCR for detection of genes forStaphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol, 2000; 38(3):1032–1035.

36.

Qiu

, Feng

, Lu

, et al. Eugenol reduces the expression of virulence-related exoproteins in Staphylococcus aureus. Appl Environ Microbiol, 2010; 76(17):5846–5851.

37.

Mitchell

, Lafrance

, Boulanger

, et al. Tomatidine acts in synergy with aminoglycoside antibiotics against multiresistant Staphylococcus aureus and prevents virulence gene expression. J Antimicrob Chemother, 2012; 67(3):559–568.

38.

Atshan

, Shamsudin

, Karunanidhi

, et al. Quantitative PCR analysis of genes expressed during biofilm development of methicillin resistant Staphylococcus aureus (MRSA). Infect Genet Evol, 2013; 18:106–112.

39.

Jarraud

, Mougel

, Thioulouse

, Lina

, Meugnier

, Forey

, Nesme

, Etienne

, Vandenesch

. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (Alleles), and human disease. Infect Immun, 2002; 70(2):631–641; doi: 10.1128/IAI.70.2.631-641.2002

40.

Booth

, Pence

, Mahasreshti

, Callegan

, Gilmore

. Clonal associations among Staphylococcus aureus isolates from various sites of infection. Infect Immun, 2001; 69(1):345–352; doi: 10.1128/IAI.69.1.345-352.2001

41.

Rosec

, Gigaud

. Staphylococcal enterotoxin genes of classical and new types detected by PCR in France. Int J Food Microbiol, 2002; 77(1–2):61–70; doi: 10.1016/s0168-1605(02)00044-2

42.

Monecke

, Müller

, Büchler

, Stieber

, Ehricht

. Staphylococcus aureus in vitro secretion of alpha toxin (hla) correlates with the affiliation to clonal complexes. PLoS One, 2014; 9(6):e100427.

43.

Dings

, Orwin

, Schlievert

. Exotoxins of Staphyloccocus aureus. Clin Microbiol Rev, 2000; 13:16–34.

44.

Haslinger‐Löffler

, Kahl

, Grundmeier

, et al. Multiple virulence factors are required for Staphylococcus aureus‐induced apoptosis in endothelial cells. Cell Microbiol, 2005; 7(8):1087–1097.

45.

Pinheiro

, Brito

, De Oliveira

, Martins

PYF

, Pereira

, Da Cunha

. Staphylococcus epidermidis and Staphylococcus haemolyticus: Molecular detection of cytotoxin and enterotoxin genes. Toxins (Basel), 2015; 7(9):3688–3699.

46.

Haque

, Haque

, Saeed

, et al. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR. Pak J Med Sci, 2017; 33(5):1095–1100.

47.

Todar

. Todar online textbook of bacteriology. Staphylococcus. Department of Bacteriology, University of Wincosin-Madison. www.textbookofbacteriology.net/staph.html; 2005.

48.

Silva

, Cardoso

. The production of hemolysin by Staphylococcus aureus isolated from bovine mastitis. Veterinária Notícias, 2000; 6(2):63–67.

49.

Larsen

, Aarestrup

, Jensen

. Geographical variation in the presence of genes encoding superantigenic exotoxins and β-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA. Vet Microbiol, 2002; 85(1):61–67.

50.

Grumann

, Nübel

, Bröker

. Staphylococcus aureus toxins–their functions and genetics. Infect Genet Evol, 2014; 21:583–592.

51.

Degaim

, Shani

, Hamim

. Virulence factors of Methicillin Resistant Staphylococcus aureus (MRSA) isolated from burn patients. Int J Curr Microbiol App Sci, 2015; 4(7):898–906.

52.

Shahzad

, Yousaf

, Ahsan

, et al. Virulence and resistance profiling of Staphylococcus aureus isolated from subclinical bovine mastitis in the Pakistani Pothohar region. Sci Rep, 2024; 14(1):14569.

53.

Kateete

, Namazzi

, Okee

, et al. High prevalence of methicillin resistant Staphylococcus aureus in the surgical units of Mulago hospital in Kampala, Uganda. BMC Res Notes, 2011; 4(1):326.

54.

Rasmi

, Ahmed

, Darwish

AMA

, Gad

GFM

. Virulence genes distributed among Staphylococcus aureus causing wound infections and their correlation to antibiotic resistance. BMC Infect Dis, 2022; 22(1):652.

55.

Aubais Aljelehawy

, Hadi Alshaibah

, Abbas Al-Khafaji

. Evaluation of virulence factors among Staphylococcus aureus strains isolated from patients with urinary tract infection in Al-Najaf Al-Ashraf teaching hospital. Cell Mol Biomed Rep, 2021; 1(2):78–87.

56.

Islam

, Hossain

, Islam

, Azam

, Sultana

. Prevalence, antibiotic resistance patterns, and virulence factors of Staphylococcus aureus isolates associated with bovine mastitis in northern Bangladesh. Heliyon, 2025; 11(3):e42107.

57.

Rossato

, Reiter

, d’Azevedo

. Coexistence of virulence genes in methicillin-resistant Staphylococcus aureus clinical isolates. Rev Soc Bras Med Trop, 2018; 51(3):361–363.

58.

Gillet

, Issartel

, Vanhems

, et al. Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet, 2002; 359(9308):753–759.

59.

Lina

, Piémont

, Godail-Gamot

, et al. Involvement of Panton-Valentine leukocidin—producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis, 1999; 29(5):1128–1132.

60.

Syangtan

, Khanal

, Bista

, Chand

, Maharajhan

, Dawadi

, Tuladhar

, Rai

, Joshi

. Panton-Valentine leucocidin gene in methicillin resistant Staphylococcus aureus isolated from tertiary care hospital in Nepal. J Infect Dev Ctries, 2024; 18(7):1010–1019; doi: 10.3855/jidc.17743

61.

Thakar

, Kumar

, Modak

, et al. Prevalence and outcome of infections caused by Staphylococcus aureus strains harboring the Panton-Valentine leukocidin gene. Cureus, 2025; 17(4):e81687.

62.

Udo

, Al-Lawati

B-H

, Al-Muharmi

, Thukral

. Genotyping of methicillin-resistant Staphylococcus aureus in the Sultan Qaboos University Hospital, Oman reveals the dominance of Panton–Valentine leucocidin-negative ST6-IV/t304 clone. New Microbes New Infect, 2014; 2(4):100–105.

63.

Chua

, Howden

, Jiang

J-H

, Stinear

, Peleg

. Population genetics and the evolution of virulence in Staphylococcus aureus. Infect Genet Evol, 2014; 21:554–562.

64.

Bukharie

. A review of community-acquired methicillin-resistant Staphylococcus aureus for primary care physicians. J Family Community Med, 2010; 17(3):117–120.

65.

Adedeji

, Weller

, Gray

. MRSA in children presenting to hospitals in Birmingham, UK. J Hosp Infect, 2007; 65(1):29–34.

66.

Rasheed

, Hussein

. Staphylococcus aureus: an overview of discovery, characteristics, epidemiology, virulence factors and antimicrobial sensitivity. Eur J Molec Clin Med, 2021; 8(3):1160–1183.

67.

Habeeb

, Hussein

, Assafi

, Al-Dabbagh

. Methicillin resistant Staphylococcus aureus nasal colonization among secondary school students at Duhok City-Iraq. Jmid, 2014; 4(2):59–63.

68.

Rossi

, Bonsaglia

ECR

, Pantoja

JCF

, Santos

, Gonçalves

, Fernandes Júnior

, Rall

VLM

. Association between the accessory gene regulator (agr) group and the severity of bovine mastitis caused by Staphylococcus aureus. J Dairy Sci, 2021; 104(3):3564–3568; doi: 10.3168/jds.2020-19275

69.

Wang

, Fan

, Han

. Autophagy in Staphylococcus aureus infection. Front Cell Infect Microbiol, 2021; 11:750222; doi: 10.3389/fcimb.2021.750222

70.

Kuehnert

, Kruszon-Moran

, Hill

, et al. Prevalence of Staphylococcus aureus nasal colonization in the United States, 2001–2002. J Infect Dis, 2006; 193(2):172–179.

71.

Cramton

, Gerke

, Schnell

, Nichols

, Götz

. The Intercellular Adhesion (ica) Locus Is Present in Staphylococcus aureus and Is Required for Biofilm Formation. Infect Immun, 1999; 67(10):5427–5433.

72.

Gill

, Fouts

, Archer

, et al. Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J Bacteriol, 2005; 187(7):2426–2438.

73.

Fuchs

, O’Brien

, El Khoury

, Mylonakis

EJV

. Methods for using Galleria mellonella as a model host to study fungal pathogenesis. Virulence, 2010; 1(6):475–482.

74.

Desbois

, Coote

. Wax moth larva (Galleria mellonella): an in vivo model for assessing the efficacy of antistaphylococcal agents. J Antimicrob Chemother, 2011; 66(8):1785–1790.

75.

Bergin

, Brennan

, Kavanagh

. Fluctuations in haemocyte density and microbial load may be used as indicators of fungal pathogenicity in larvae of Galleria mellonella. Microbes Infect, 2003; 5(15):1389–1395.