Necroptosis Driven by JAK/STAT-RIPK-MLKL Signaling Mediates Corneal Epithelial Erosion

Abstract

Purpose:

Recurrent corneal erosion (RCE) is an ocular surface disease with poor epithelial–stromal adhesion and limited therapies. This study aimed to elucidate the role of necroptosis, a pro-inflammatory form of programmed cell death, in the pathogenesis of corneal erosion.

Methods:

An in vitro UVB injury model was established in human corneal epithelial cells (HCEpiCs), followed by unbiased LC–MS/MS proteomics and pathway enrichment analysis. In parallel, a UVB-induced corneal erosion model was generated in C57BL/6 mice. To test therapeutic relevance, mice received a topical neutralizing anti-IFN-γ antibody or vehicle after injury. Corneal epithelial integrity and stromal architecture were assessed histologically, while activation of IFN-γ–JAK/STAT signaling, RIPK1/RIPK3/MLKL necroptosis, DAMP release, NLRP3 inflammasome assembly, and IL-1β maturation were examined using immunofluorescence, qRT-PCR, and Western blotting.

Results:

Proteomic profiling showed significant enrichment of necroptosis-related proteins following UVB exposure. UVB-treated corneal epithelium exhibited increased IFN-γ signaling and JAK/STAT activation, accompanied by elevated expression and activation of RIPK1, RIPK3, and MLKL. Necroptosis was associated with increased release of DAMPs, heightened NLRP3 inflammasome activation, and increased maturation/secretion of IL-1β. In vivo, topical anti-IFN-γ treatment reduced corneal epithelial defects, improved epithelial–stromal attachment, and decreased activation markers of the RIPK-MLKL and NLRP3–IL-1β pathways.

Conclusions:

Our findings unveil a novel and critical pathogenic axis in corneal erosion, where IFN-γ signaling drives a necroptotic-inflammatory loop. This work provides a new molecular framework for understanding corneal epithelial injury and identifies the IFN-γ-necroptosis axis as a promising therapeutic target for RCE.

Keywords

necroptosis recurrent corneal erosion (RCE)interferon-gamma (IFN-γ)JAK/STAT pathway RIPK-MLKL pathway NLRP3 inflammasome

Introduction

Recurrent corneal erosion (RCE) syndrome imposes a significant burden on patients, presenting with chronic, debilitating pain and intermittent vision loss due to a fundamental failure of epithelial–stromal adhesion.^1,2 The stable attachment of the corneal epithelium to the underlying stroma is critically dependent on the integrity of the epithelial basement membrane and its associated anchoring complexes.³ Despite a range of therapeutic interventions, from lubricants to surgical procedures, the high rate of recurrence highlights a critical gap in our understanding of the molecular pathogenesis of RCE and underscores the urgent need for mechanism-based therapies.⁴

The clinical manifestation of RCE, characterized by spontaneous epithelial breakdown and a robust, often sterile, inflammatory response, strongly suggests that a dysregulated form of programmed cell death is a central pathogenic driver.⁵ While apoptosis, or type I programmed cell death, is typically immunologically silent, the lytic and highly pro-inflammatory nature of necroptosis offers a more compelling explanation for the RCE phenotype.^6,7 Necroptosis is a regulated form of necrosis executed by the RIPK1-RIPK3-MLKL signaling axis, which culminates in plasma membrane rupture and the release of damage-associated molecular patterns (DAMPs), thereby triggering intense inflammation.^8,9 This raises a pivotal question: what is the upstream trigger that initiates this destructive necroptotic cascade within the corneal epithelium?

Interferon-gamma (IFN-γ), a pleiotropic cytokine, emerges as a primary candidate for this role. IFN-γ is a known pathogenic mediator in various ocular surface inflammatory diseases, where it can directly compromise epithelial barrier function.^10–12 Importantly, external insults relevant to corneal injury, such as ultraviolet B (UVB) radiation, have been shown to elicit a local IFN-γ response in epithelial tissues.¹³ The biological effects of IFN-γ are transduced via the canonical Janus Kinase/Signal Transducer and Activator of Transcription (JAK/STAT) pathway.¹⁴ Mechanistically, activation of the JAK/STAT pathway has been directly linked to the induction of necroptosis through the transcriptional upregulation of core components of the necroptotic machinery,¹⁵ providing a direct molecular link between IFN-γ signaling and necroptotic cell death.

The pathological consequences of necroptosis extend beyond cell lysis, creating a vicious cycle of inflammation and tissue damage. The DAMPs released from necroptotic cells are potent activators of innate immune sensors, such as the NLRP3 inflammasome.¹⁶ Once activated, the NLRP3 inflammasome recruits and activates caspase-1, which in turn processes pro-interleukin-1β (pro-IL-1β) into its mature, biologically active form.^17,18 Mature IL-1β is a powerful pro-inflammatory cytokine in the cornea.^19,20 In a mouse model with no corneal injury or infection, the use of an IL-1β blocker enhances wound healing. This effect may be the result of the reduction of collagen VII.²¹ The mechanism of traumatic RCE is mainly related to the degradation of collagen VII, which destroys the firm anchoring from the dense layer of the basement membrane to the anterior elastic layer, thus leading to poor adhesion of the persistent epithelium to the matrix.²²

Therefore, we hypothesize that a pathogenic signaling axis, initiated by IFN-γ, drives corneal epithelial erosion through a multi-step cascade: IFN-γ activates the JAK/STAT pathway, which upregulates the RIPK-MLKL necroptosis machinery, leading to necroptotic cell death. The subsequent release of DAMPs activates the NLRP3 inflammasome, resulting in IL-1β-mediated inflammation and tissue destruction. In this study, we sought to systematically validate this entire signaling pathway in a model of corneal injury and to assess the therapeutic potential of targeting its apex initiator, IFN-γ.

Methods

Experimental design and ethical approval

An overview of the experimental models and workflow is shown in Figure 1. Briefly, an in vitro UVB-induced injury model was established in Human Corneal Epithelial Cells (HCEpiCs) for proteomic profiling and mechanistic analyses (Fig. 1a). In parallel, a UVB-induced corneal epithelial erosion model was generated in C57BL/6 mice to validate epithelial phenotypes and pathway activation in vivo (Fig. 1b). For intervention experiments, mice received topical eye-drop treatment after UVB injury following the schedule in Figure 1c.

All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the Zhongshan Ophthalmic Center, Sun Yat-sen University [SYXK (Guangzhou) 2018-043] and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Healthy 6–8 weeks old male C57BL/6 mice were sourced from the Experimental Animal Center of Zhongshan Ophthalmic Center [animal production license number: SYXK (Guangzhou) 2015-0058] and housed in a specific-pathogen-free (SPF) facility with a 12-hour light/dark cycle and ad libitum access to food and water. The use of the commercially available Human Corneal Epithelial Cell (HCEpiC) line (Sciencell, #6510) does not require separate ethics approval.

Cell culture and in vitro UVB model for proteomics

HCEpiC were cultured in Dulbecco’s Modified Eagle Medium (DMEM) high glucose complete medium (ThermoFisher, C11995500CP) and maintained in a humidified incubator at 37°C with 5% CO₂. When cell density reached approximately 80%, they were used for experiments. For the proteomics study, HCEpiC monolayers were irradiated with 3000 J/m² of UVB radiation and subsequently cultured for 16 h. Nonirradiated cells served as the control group. Cell samples were then collected for proteomic analysis.

High-throughput proteomics and bioinformatic analysis

Cell pellets were subjected to proteomic analysis by LC–MS/MS. Briefly, proteins were extracted, digested with trypsin, and the resulting peptides were analyzed on an Orbitrap Fusion^TM Lumos coupled to an EASY-nLC 1200. Raw data were processed using MaxQuant software (version 1.6.2.10) and searched against the UniProt human protein database. Proteins with a fold change > 1.5 and a P-value < 0.05 were considered differentially expressed. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed on the upregulated proteins to identify key biological pathways.

Establishment of the murine corneal erosion model

Mice were anesthetized via intraperitoneal injection of 4.3% chloral hydrate (10 µL/g). The eyelids of the right eye were sutured open for exposure. The corneas were then irradiated using a UVB light source (Waldmann UV-100L, Germany) with a wavelength of 310–315 nm and a power density of 10.5 mW/cm². To establish an optimal model, initial experiments were performed with irradiation times of 3, 8, and 30 min, corresponding to energy doses of 0.04, 0.11, and 0.4 J/cm², respectively. Based on histological assessment of epithelial defects and inflammation, the 8-minute irradiation protocol (0.11 J/cm²) was selected for all subsequent experiments as it reliably induced a stable corneal erosion model. At 24 h postmodeling, mice were euthanized. The contralateral left eyes were used as uninjured controls.

Topical treatment with IFN-γ inhibitor

Following the establishment of the corneal erosion model (0.11 J/cm² UVB), mice were randomly divided into experimental groups. A neutralizing anti-IFN-γ antibody (Sigma-Aldrich, I9141) was reconstituted in sterile PBS (pH 7.4). Eye drops were treated at 1 h and 7 h postinjury. Corneal samples were collected 24 h later for HE staining, Western blot (WB) analysis, and Masson staining. The experimental groups included:

Blank group (Normal Control): No UVB irradiation; treated with PBS sterile buffer.

UVB + PBS group (Vehicle Control): Treated with PBS sterile buffer.

UVB + IFN-γ blocker group: Treated with anti-IFN-γ solution (1 μg/mL, 10 μg/mL, 100 μg/mL).

Histological analysis

Whole eyeballs were enucleated, fixed in 4% paraformaldehyde for 24 h, and embedded in paraffin. Sections (5 µm) were prepared for staining.

Hematoxylin and eosin staining

Sections were stained with hematoxylin and eosin (HE) to evaluate general corneal morphology, epithelial integrity, and inflammatory cell infiltration.

Masson’s trichrome staining

To assess collagen fiber structure and density in the stroma, sections were stained using a Masson’s Trichrome kit (Servicebio, G1006-100ML) according to the manufacturer’s protocol.

Images were captured using a light microscope (Zeiss, Germany) equipped with Axio Vision Rel 6.4 software.

Immunofluorescence staining

Paraffin sections underwent deparaffinization, rehydration, and heat-induced antigen retrieval in sodium citrate buffer (pH 6.0). After blocking endogenous peroxidase with 10% H₂O₂ and permeabilizing with 0.3% Triton X-100, sections were blocked with normal goat serum. Tissues were then incubated overnight at 4°C with the appropriate primary antibodies. After washing, sections were incubated for 1 h with a goat anti-rabbit fluorescent secondary antibody (Sigma, #4412 s, 1:1000 dilution). Slides were mounted with a 4’,6-diamidino-2-phenylindole (DAPI)-containing anti-fade medium (Abcam, ab104139) and imaged under a fluorescence microscope at 60× magnification. The mean optical density of the epithelial layer was quantified using ImageJ software to measure protein expression intensity. Detailed information, including catalog numbers and dilutions for all primary antibodies used in IF, is provided in Supplementary Table S1.

RNA extraction and quantitative real-time PCR

Total RNA was extracted from dissected corneal tissues using an animal total RNA isolation kit (FOREGENE, RE-03011). RNA concentration was measured using a Nanodrop spectrophotometer. cDNA was synthesized using the HiScript^® II Q RT SuperMix for qPCR (Vazyme, R223-01). Quantitative real-time PCR (qRT-PCR) was performed on a Roche lightCycler480 using a qPCR Master Mix (Vazyme, Q411-02). The relative expression of target genes was calculated using the 2^−ΔΔCt method, with GAPDH serving as the internal reference control. Primer sequences are listed in Table 1.

Table 1.

Primer Sequence of qRT-PCR

Gene	Forward (5′−3′)	Reverse (5′−3′)	Length
JAK1	AGTGCAGTATCTCTCCTCTCTG	GATTCGGTTCGGAGCGTACC	83
JAK2	GGAATGGCCTGCCTTACAATG	TGGCTCTATCTGCTTCACAGAAT	108
STAT1	TCACAGTGGTTCGAGCTTCAG	CGAGACATCATAGGCAGCGTG	150
STAT2	CTGAAGGACGAACAGGATGTC	CAGGGTGGTTAATCGGCCAA	186
RIPK1	AAGGCGAGAGAGGAAGTCACA	ACCTGCGAATGCACGTTGT	218
RIPK3	CAGTGGGACTTCGTGTCCG	CAAGCTGTGTAGGTAGCACATC	156
MLKL	TCGATTCTCCCAACATCTTGC	GGTGTAGCCTGTATAAGCCTCTG	195
ASC	ACTGTGCTTAGAGACATGGGC	TGGTCCACAAAGTGTCCTGTT	134
NLRP3	ATCAACAGGCGAGACCTCTG	GTCCTCCTGGCATACCATAGA	96
CASP1	CTTGGAGACATCCTGTCAGGG	AGTCACAAGACCAGGCATATTCT	81
IL1B	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG	138
GAPDH	TGAGCAAGAGAGAGGCCCTATC	AGGCCCCTCCTGTTATTATG	93

WB analysis

Corneal tissues were homogenized in protein lysis buffer on ice. Protein concentration was determined using a BCA kit (Bioharp, BL521A). Equal amounts of protein were mixed with 5× loading buffer, denatured at 100°C for 5 min, separated by Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to Polyvinylidene fluoride (PVDF) membranes. Membranes were blocked and incubated overnight at 4°C with the indicated primary antibodies. After incubation with an Horseradish peroxidase (HRP)-linked secondary antibody (1:10,000 dilution), protein bands were visualized using an Enhanced chemiluminescence (ECL) ECL (Enhanced chemiluminescence) kit (Bioharp, BL520A). Band intensity was quantified using ImageJ software and normalized to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Detailed information for all primary antibodies used in WB, including their respective dilutions, is listed in Supplementary Table S1.

Statistical analysis

We therefore used n = 5–6 per group for these experiments. For histological assessments, n = 3 per group was used. All quantitative data were expressed as mean ± standard deviation (Mean ± SD) from at least three independent experiments. Statistical analysis was performed using GraphPad Prism software. Student’s t-test was used for comparisons between two groups, and one-way analysis of variance followed by an appropriate post-hoc test was used for multiple group comparisons. A P-value < 0.05 was considered statistically significant.

Results

Proteomic analysis of UVB-irradiated corneal epithelial cells reveals a necroptotic signature

To identify the primary molecular pathways activated by corneal epithelial injury, we performed an unbiased high-throughput proteomic analysis on HCEpiCs following UVB irradiation. We identified 542 proteins that were differentially expressed, with 343 proteins being significantly upregulated and 199 downregulated (Fig. 2a, Table 2). To understand the functional significance of these changes, we conducted a KEGG pathway enrichment analysis on the upregulated proteins. Strikingly, the analysis revealed that necroptosis was one of the most significantly enriched pathways (Fig. 2b). Key proteins within this pathway, including the upstream signaling molecule STAT1 (fold change: 1.697; P = 2.56 × 10⁻⁴) and the core inflammasome adaptor ASC (PYCARD)(fold change: 3.439; P = 3.45 × 10⁻⁶), were prominently upregulated, providing a strong initial indication that necroptosis is a central cellular response to this form of injury (Fig. 2c). These proteomic cues led us to hypothesize that a complete JAK/STAT–necroptosis–inflammasome signaling axis drives this form of corneal injury, prompting our subsequent in vivo validation.

Table 2.

Key Differentially Expressed Proteins Associated with the Necroptosis Pathway Identified by Proteomic Analysis

Gene symbol	Protein description	Fold change	P value
ASC	Apoptosis-associated speck-like protein containing a CARD	3.439	3.45 × 10⁻⁶
STAT1	Signal transducer and activator of transcription 1	1.697	2.56 × 10⁻⁴

Proteomic analysis was performed on human corneal epithelial cells (HCEpiCs) 16 h after UVB irradiation (3000 J/m ²) versus nonirradiated controls. A threshold of fold change >1.5 and P < 0.05 was used to define significance. In total, 542 proteins were identified as differentially expressed, comprising 343 upregulated and 199 downregulated proteins. The table above highlights representative proteins enriched in the necroptosis signaling pathway. Fold change represents the ratio of protein expression intensity in the UVB group relative to the Control group.

A UVB-induced murine model faithfully recapitulates features of corneal erosion

RCE can be precipitated by various insults, including mechanical trauma and refractive surgeries like photorefractive keratectomy (PRK).²³ While PRK utilizes UVA, it is the UVB spectrum (280–320 nm) that is predominantly responsible for ultraviolet-induced ocular damage.²⁴ To specifically investigate the molecular mechanisms of poor epithelial–stromal adhesion without the confounding variable of mechanical injury, we sought to establish a robust model of corneal erosion using UVB irradiation.

We developed this model in mice by exposing their corneas to varying doses of UVB. A clear dose-dependent effect on corneal integrity was observed (Fig. 3a). While a 3-min exposure resulted in only minor superficial damage, an 8-min exposure (0.11 J/cm²) consistently produced a robust and reproducible pathology. This included widespread epithelial necrosis, significant detachment of the epithelial layer from the stroma, and marked inflammatory cell infiltration—all hallmarks of clinical corneal erosion. Given its stability and clinical relevance, this 8-min irradiation protocol was selected for all subsequent in vivo experiments.

The entire JAK/STAT-necroptosis–inflammasome axis is activated autonomously within the corneal epithelium

Having established a relevant in vivo model, we next sought to determine if the complete signaling cascade, hypothesized from our proteomic data, was activated in the injured cornea. We first assessed the transcriptional response. Quantitative RT-PCR analysis of corneal tissue from the injury model revealed a profound and coordinated upregulation of genes across the entire proposed pathway (Fig. 3b). This included upstream components of the IFN-γ pathway (Jak1, Jak2, Stat1, Stat2), core effectors of necroptosis (Ripk1, Ripk3, Mlkl), and downstream machinery of the inflammasome (Asc, Nlrp3, Casp1, Il1b).

To confirm if this transcriptional upregulation translated to the protein level, we performed WB analysis. Consistent with the mRNA data, the protein levels of JAK1, JAK2, STAT1, STAT2, RIPK1, RIPK3, MLKL, ASC, and NLRP3 were all significantly increased in the injured corneas (Fig. 3c). Importantly, we also detected a marked increase in the active form of IL-1β, indicating functional inflammasome activation. A critical question remained: was this cascade activated by infiltrating immune cells or by the corneal epithelial cells themselves? To answer this, we used immunofluorescence to map the spatial location of these key proteins. The results were unequivocal. Expression of the JAK/STAT components (Fig. 4a), the necroptosis effectors and the inflammasome proteins (Fig. 4b) was overwhelmingly concentrated within the damaged corneal epithelium itself. This spatial confinement strongly indicates a cell-autonomous mechanism, whereby corneal epithelial cells intrinsically execute this entire pathogenic program.

Pharmacological blockade of upstream IFN-γ prevents corneal erosion and tissue damage

Our findings thus far pointed to the JAK/STAT pathway as a key driver, strongly implicating its canonical activator, IFN-γ, as the upstream trigger. To directly test this hypothesis, we investigated whether blocking IFN-γ could prevent the downstream pathological consequences. We applied a topical IFN-γ neutralizing antibody to the eyes of mice immediately following UVB injury. The therapeutic effect was striking. Histological analysis showed that IFN-γ blockade, in a dose-dependent manner, dramatically preserved the structural integrity of the cornea. It prevented the severe epithelial necrosis and detachment observed in vehicle-treated control animals (Fig. 5a, b). To assess the impact on stromal integrity, which is crucial for epithelial adhesion, we performed Masson’s trichrome staining. The results showed that IFN-γ inhibition protected the underlying stromal collagen from degradation, maintaining the dense, organized collagen framework essential for a stable ocular surface (Fig. 5c).

IFN-γ blockade suppresses the entire downstream necroptotic and inflammatory Cascade

Finally, to provide a direct molecular link between the therapeutic effect of the IFN-γ blocker and our proposed pathway, we examined its impact on the key downstream signaling proteins. Given that histological analysis confirmed a dose-dependent therapeutic efficacy with optimal structural preservation at 100 µg/mL, we selected representative low (1 µg/mL) and high (100 µg/mL) concentration groups to characterize the dynamic range of molecular pathway inhibition. WB analysis of corneas from treated mice demonstrated that IFN-γ blockade (at 1 µg/mL) significantly reduced the UVB-induced proteins (Fig. 6). The expression of JAK/STAT proteins (JAK1, JAK2, STAT1, STAT2), necroptosis machinery (RIPK1, RIPK3, MLKL), and inflammasome components (ASC, NLRP3, IL-1β) were all significantly reduced in the 1 µg/mL IFN-γ blocker-treated group compared with the Vehicle group. This result provides strong mechanistic evidence that the protective effect of IFN-γ blockade is directly attributable to its ability to shut down this specific necroptotic and inflammatory signaling axis.

Discussion

This study delineates a novel and previously uncharacterized signaling cascade that drives corneal epithelial erosion, providing a cohesive molecular narrative for a clinically challenging condition. Our central finding is the identification of a linear, druggable pathogenic axis initiated by IFN-γ, which triggers necroptosis via the JAK/STAT–RIPK–MLKL pathway, culminating in NLRP3 inflammasome activation and IL-1β-mediated tissue injury.

The identification of IFN-γ as the apex regulator of this cascade is a key conceptual advance. While UVB radiation served as the initial physical insult in our model, our data strongly suggest that IFN-γ is the critical molecular switch that translates this non-specific damage into a highly specific, programmed inflammatory and cell death response. This crucial role positions IFN-γ not merely as a passive biomarker of inflammation, but as an active and upstream driver of pathology, a finding consistent with its detrimental roles in other ocular surface diseases.^25,26 The remarkable efficacy of a topical IFN-γ neutralizing antibody in preventing both the histological and molecular features of corneal erosion provides compelling evidence for its role as a high-value therapeutic target.²⁷

A pivotal finding of our study is that this entire pathogenic program, from IFN-γ sensing to necroptosis execution and inflammasome activation, occurs autonomously within the corneal epithelium itself. The distinct localization of all key signaling proteins to the epithelial layer (Fig. 4) strongly supports a cell-intrinsic mechanism, rather than one reliant on infiltrating immune cells.^28,29 This finding has important therapeutic implications, suggesting that treatments targeting the epithelial cells directly may be highly effective. The activation of necroptosis, as opposed to the immunologically quiescent apoptosis, is particularly significant. The lytic nature of necroptosis provides a direct and potent mechanism for the release of DAMPs, offering a more robust explanation for the intense inflammatory flare characteristic of RCE than apoptosis could provide.³⁰

Furthermore, our work establishes a critical functional bridge between necroptotic cell death and inflammasome activation in the cornea. We demonstrate that necroptosis acts upstream, providing the necessary signals (i.e., DAMPs) to trigger the assembly and activation of the NLRP3 inflammasome.³¹ This links the initial cell death event directly to the production of mature IL-1β, a key effector of downstream tissue damage.³² While the role of IL-1β in corneal pathology is well-documented,^19,20 our study is the first to delineate the complete upstream regulatory pathway that governs its production in this context of sterile injury.

We acknowledge the limitations inherent in our study. First, our acute UVB-induced injury model, while powerful for dissecting molecular mechanisms, does not fully recapitulate the chronic and relapsing nature of clinical RCE.³³ Future investigations using chronic mechanical debridement or genetic models of basement membrane defects are warranted.³⁴ Second, our claims are based on pharmacological inhibition. While effective, definitive validation of the necessity of these pathways would require genetic knockout mice (e.g., Mlkl⁻/⁻ or Ifng⁻/⁻).³⁵ Finally, the precise cellular source of the initial IFN-γ surge and the specific identity of the DAMPs released by necroptotic corneal epithelial cells remain to be elucidated. These unanswered questions lay the groundwork for exciting future research.

In conclusion, this study identifies a coherent and targetable pathogenic cascade—from IFN-γ to necroptosis to inflammasome activation—that drives corneal epithelial erosion (Fig. 7). This provides a new conceptual framework for understanding RCE pathogenesis and offers a promising, mechanism-based therapeutic strategy focused on the IFN-γ-necroptosis nexus.

Ethics Approval and Consent to Participate

All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the Experimental Animal Center of Zhongshan Ophthalmic Center, Sun Yat-sen University [SYXK (Guangzhou) 2018-043], all methods are reported in accordance with ARRIVE guidelines. The study involving HCEpiC, which were commercially purchased from Sciencell (Cat. No. #6510), did not require separate ethics approval as they are established and publicly available cell lines.

Availability of Data and Materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Authors’ Contributions

H.S., J.J., and J.Z. contributed equally to this work. Y.Z. and L.Z. designed the study and supervised the project. H.S., J.J., and J.Z. performed the experiments, collected, and analyzed the data. W.S. and Y.Y. participated in data analysis and interpretation. H.S. wrote the original draft. Y.Z. and L.Z. reviewed and edited the article. All authors read and approved the final article.

Supplemental Material

sj-docx-1-opt-10.1177_10807683261464756 — Supplemental material for Necroptosis Driven by JAK/STAT-RIPK-MLKL Signaling Mediates Corneal Epithelial Erosion

Supplemental material, sj-docx-1-opt-10.1177_10807683261464756 for Necroptosis Driven by JAK/STAT-RIPK-MLKL Signaling Mediates Corneal Epithelial Erosion by Hongyi Shen, Jiayi Jin, Jianqiang Zhang, Wanwen Shao, Jingyi Peng, Yan Yang, Yongxin Zheng, and Liuxueying Zhong

Supplemental Material

sj-docx-2-opt-10.1177_10807683261464756 — Supplemental material for Necroptosis Driven by JAK/STAT-RIPK-MLKL Signaling Mediates Corneal Epithelial Erosion

Supplemental material, sj-docx-2-opt-10.1177_10807683261464756 for Necroptosis Driven by JAK/STAT-RIPK-MLKL Signaling Mediates Corneal Epithelial Erosion by Hongyi Shen, Jiayi Jin, Jianqiang Zhang, Wanwen Shao, Jingyi Peng, Yan Yang, Yongxin Zheng, and Liuxueying Zhong

Supplemental Material

sj-docx-3-opt-10.1177_10807683261464756 — Supplemental material for Necroptosis Driven by JAK/STAT-RIPK-MLKL Signaling Mediates Corneal Epithelial Erosion

Supplemental material, sj-docx-3-opt-10.1177_10807683261464756 for Necroptosis Driven by JAK/STAT-RIPK-MLKL Signaling Mediates Corneal Epithelial Erosion by Hongyi Shen, Jiayi Jin, Jianqiang Zhang, Wanwen Shao, Jingyi Peng, Yan Yang, Yongxin Zheng, and Liuxueying Zhong

Footnotes

Author Disclosure Statement

The authors declare that they have no competing interests.

Funding Information

This work was supported by grants from the National Natural Science Foundation of China (81570839) to Yongxin Zheng.

References

Balal

, Ansari

, Sim

, et al. The incidence and prevalence of recurrent corneal erosion syndrome in London, UK. Eye (Lond), 2023; 37(15):3213–3216; doi: 10.1038/s41433-023-02490-3

Lin

, Aldave

, Chodosh

. Recurrent corneal erosion syndrome. Br J Ophthalmol, 2019; 103(9):1204–1208; doi: 10.1136/bjophthalmol-2019-313835

Ghafar

, Jalil

NAA

, Kamarudin

. Wound healing of the corneal epithelium: A review. Asian Biomed (Res Rev News), 2021; 15(5):199–212; doi: 10.2478/abm-2021-0026

Ahn

, Kim

, Seo

, et al. Efficacy and safety of secondary surgical treatment for refractory recurrent corneal erosion. Cornea, 2026; 45(1):51–55; doi: 10.1097/ico.0000000000003793

Sakimoto

, Sawa

. Metalloproteinases in corneal diseases: Degradation and processing. Cornea, 2012; 31 Suppl 1:S50–S56; doi: 10.1097/ICO.0b013e318269ccd0

Wang

, Kanneganti

. From pyroptosis, apoptosis and necroptosis to PANoptosis: A mechanistic compendium of programmed cell death pathways. Comput Struct Biotechnol J, 2021; 19:4641–4657; doi: 10.1016/j.csbj.2021.07.038

Liu

, Xie

, Ren

, et al. The role of necroptosis in disease and treatment. MedComm (2020), 2021; 2(4):730–755; doi: 10.1002/mco2.108

Yao

, Shi

, Zhao

, et al. RIPK1 in necroptosis and recent progress in related pharmaceutics. Front Immunol, 2025; 16:1480027; doi: 10.3389/fimmu.2025.1480027

, Wang

, Berleth

, et al. The autophagy-initiating kinase ULK1 controls RIPK1-mediated cell death. Cell Rep, 2020; 31(3):107547; doi: 10.1016/j.celrep.2020.107547

10.

D’Souza

, Nair

, Sahu

, et al. Keratoconus patients exhibit a distinct ocular surface immune cell and inflammatory profile. Sci Rep, 2021; 11(1):20891; doi: 10.1038/s41598-021-99805-9

11.

Kelagere

, Scholand

, DeJong

, et al. TNF is a critical cytokine in age-related dry eye disease. Ocul Surf, 2023; 30:119–128; doi: 10.1016/j.jtos.2023.08.004

12.

Fan

, Wang

, Ortiz

, et al. Autoreactive memory Th17 cells are principally derived from T-bet(+)RORγt(+) Th17/1 effectors. J Autoimmun, 2022; 129:102816; doi: 10.1016/j.jaut.2022.102816

13.

Klein

, Reynolds

, Xu

, et al. Epidermal ZBP1 stabilizes mitochondrial Z-DNA to drive UV-induced IFN signaling in autoimmune photosensitivity. Sci Immunol, 2025; 10(105):eado1710; doi: 10.1126/sciimmunol.ado1710

14.

Wang

, Wang

, Sun

, et al. Down-regulation of DNA key protein-FEN1 inhibits OSCC growth by affecting immunosuppressive phenotypes via IFN-γ/JAK/STAT-1. Int J Oral Sci, 2023; 15(1):17; doi: 10.1038/s41368-023-00221-8

15.

Sun

, Ding

, Jiang

, et al. Melittin inhibits ovarian cancer cell growth by downregulating MMP9 expression via the JAK2-STAT3 signaling pathway. Curr Med Chem, 2025; doi: 10.2174/0109298673355946250403071132

16.

Tran

, Kratina

, Coutansais

, et al. RIPK3 cleavage is dispensable for necroptosis inhibition but restricts NLRP3 inflammasome activation. Cell Death Differ, 2024; 31(5):662–671; doi: 10.1038/s41418-024-01281-x

17.

, Tao

, Chen

, et al. Mechanisms of NLRP3 inflammasome activation and the development of peptide inhibitors. Cytokine Growth Factor Rev, 2023; 74:1–13; doi: 10.1016/j.cytogfr.2023.09.007

18.

Sherif

, Al-Shaalan

. Alleviation of chemotherapy-induced acute lung injury via NLRP3/ASC/Caspase-1 signaling pathway. Toxicol Res (Camb), 2022; 11(3):417–425; doi: 10.1093/toxres/tfac021

19.

Lee

, Kim

, Jeong

, et al. Effect of gintonin on matrix metalloproteinase-9 concentration in tears during corneal wound healing in rabbits. Acta Vet Hung, 2021; 68(4):364–369; doi: 10.1556/004.2020.00062

20.

Heng

, Zihan

, Pingping

, et al. Luteolin ameliorates cornea stromal collagen degradation and inflammatory damage in rats with corneal alkali burn. Exp Eye Res, 2023; 231:109466; doi: 10.1016/j.exer.2023.109466

21.

Schultz

, Rijneveld

, Florquin

, et al. Role of interleukin-1 in the pulmonary immune response during Pseudomonas aeruginosa pneumonia. Am J Physiol Lung Cell Mol Physiol, 2002; 282(2):L285–L90; doi: 10.1152/ajplung.00461.2000

22.

Chen

, Huang

, et al. The cleavage plane of corneal epithelial adhesion complex in traumatic recurrent corneal erosion. Mol Vis, 2006; 12:196–204.

23.

Diez-Feijóo

, Grau

, Abusleme

, et al. Clinical presentation and causes of recurrent corneal erosion syndrome: Review of 100 patients. Cornea, 2014; 33(6):571–575; doi: 10.1097/ico.0000000000000111

24.

Pauloin

, Dutot

, Joly

, et al. High molecular weight hyaluronan decreases UVB-induced apoptosis and inflammation in human epithelial corneal cells. Mol Vis, 2009; 15:577–583.

25.

Lin

, Xu

, Lin

, et al. Advances in pathogenesis and treatment of ocular involvement in Behcet’s disease. Front Immunol, 2023; 14:1206959; doi: 10.3389/fimmu.2023.1206959

26.

Xie

, Li

, Chen

, et al. Necroptosis underlies neutrophilic inflammation associated with the Chronic Rhinosinusitis with Nasal Polyps (CRSwNP). J Inflamm Res, 2021; 14:3969–3983; doi: 10.2147/jir.S322875

27.

, Byun

, Choi

, et al. Neutralization of ocular surface TNF-α reduces ocular surface and lacrimal gland inflammation induced by in vivo dry eye. Invest Ophthalmol Vis Sci, 2013; 54(12):7557–7566; doi: 10.1167/iovs.12-11515

28.

Alam

, Yaman

, de Paiva

, et al. Changes in conjunctival mononuclear phagocytes and suppressive activity of regulatory macrophages in desiccation induced dry eye. Ocul Surf, 2024; 34:348–362; doi: 10.1016/j.jtos.2024.09.003

29.

Gurumurthy

, Srinivasan

, Agarwal

, et al. Unique cytokine signature in ocular Stevens-Johnson syndrome non-responders. Ocul Surf, 2024; 32:173–181; doi: 10.1016/j.jtos.2024.03.007

30.

Newton

, Strasser

, Kayagaki

, et al. Cell death. Cell, 2024; 187(2):235–256; doi: 10.1016/j.cell.2023.11.044

31.

Pandeya

, Kanneganti

. Therapeutic potential of PANoptosis: Innate sensors, inflammasomes, and RIPKs in PANoptosomes. Trends Mol Med, 2024; 30(1):74–88; doi: 10.1016/j.molmed.2023.10.001

32.

Chen

, Zhang

, Sakai

, et al. Neutrophil pyroptosis regulates corneal wound healing and post-injury neovascularisation. Clin Transl Med, 2024; 14(11):e1762; doi: 10.1002/ctm2.1762

33.

Tse

, Rizwan

, Rasmussen

, et al. Gelatin methacrylate as an enzyme-controlled release vehicle of hyaluronic acid for the treatment of recurrent corneal erosion. ACS Appl Bio Mater, 2020; 3(9):6214–6223; doi: 10.1021/acsabm.0c00750

34.

Pal-Ghosh

, Pajoohesh-Ganji

, Tadvalkar

, et al. Topical mitomycin-C enhances subbasal nerve regeneration and reduces erosion frequency in the debridement wounded mouse cornea. Exp Eye Res, 2016; 146:361–369; doi: 10.1016/j.exer.2015.08.023

35.

, Huang

, Zhang

, et al. Hydrogen Sulfide (H(2)S) mitigates sepsis-induced adrenal dysfunction via inhibition of TNFα-mediated necroptosis. Pathogens, 2025; 14(5):439; doi: 10.3390/pathogens14050439

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.02 MB

0.94 MB

0.92 MB