Effects of Lacticaseibacillus paracasei HP7 Against Helicobacter pylori -Induced Gastric Mucosal Inflammation and Mucosal Protection

Abstract

Helicobacter pylori (H. pylori) is a major pathogen that colonizes the human gastric surface and induces chronic inflammation and mucosal damage, leading to various gastric diseases. This study examined the gastroprotective effects of Lacticaseibacillus paracasei HP7 in an H. pylori-infected animal model. Male C57BL/6 mice were divided into four groups: normal control, H. pylori-infected control (HP), H. pylori-infected group treated with live L. paracasei HP7 for 4 weeks (L-HP7), and H. pylori-infected group treated with heat-killed L. paracasei HP7 for 4 weeks (HK-HP7). The results showed that serum histamine and gastrin levels, as well as gastric mucosal inflammatory cytokine mRNA levels, including interleukin (IL)-1β, IL-6, IL-8, IL-18, interferon gamma, and tumor necrosis factor alpha, were significantly reduced in both the L-HP7 and HK-HP7 groups. Histopathological scoring of hematoxylin & eosin-stained gastric mucosal tissues also showed significant improvements in both groups. Serum anti-H. pylori immunoglobulin G (IgG) and CCK2R mRNA levels decreased in the L-HP7 group, whereas MUC1 mRNA levels increased. Collectively, these findings indicate that L. paracasei HP7, in both live and heat-killed forms, protects gastric surface epithelial and mucosal cells and alleviates inflammatory status by reducing the expression of pro-inflammatory cytokines. L. paracasei HP7 may serve as a promising adjunct to antibiotics in the management of H. pylori-associated diseases.

Keywords

inflammation probiotics

INTRODUCTION

Helicobacter pylori (H. pylori) is a spiral-shaped, Gram-negative bacterium that secretes urease to neutralize gastric acidity and uses its flagella to attach to the gastric mucosa, thereby initiating infection.^1,2

More than 50% of the global population is infected with H. pylori, with particularly high prevalence in developing countries.³ Chronic infection commonly leads to gastritis and may progress to peptic ulcer disease or gastric cancer.⁴ The standard first-line therapy for H. pylori eradication is triple therapy comprising antibiotics, which remains the current standard regimen.⁵ Nevertheless, increasing antibiotic resistance has led to a decline in eradication rates, highlighting the urgent need for alternative strategies.⁶

By secreting urease to neutralize gastric acidity, H. pylori is able to survive and colonize the gastric mucosa.⁷ Surviving organisms then use their flagella to penetrate the mucus layer and reach the gastric epithelium, where they attach and establish infection.^8,9 Upon reaching the epithelial surface, H. pylori prevents host defense mechanisms involved in pathogen clearance, such as gastric peristalsis and mucus secretion, by utilizing adhesion proteins, including antigen-binding adhesin (BabA) and sialic acid-binding adhesin (SabA), to bind to receptors on the gastric mucosa.⁹ Subsequently, H. pylori secretes vacuolating cytotoxin A (VacA), which is internalized by host cells and induces cellular dysfunction and apoptosis through vacuole formation.¹⁰ In addition, expression of the H. pylori virulence factor cytotoxin-associated gene A (CagA) disrupts cell motility and induces cellular alterations, ultimately leading to inflammatory responses and tissue damage.^10,11

Probiotics are microorganisms that confer health benefits to the host, including enhancement of immune function and protection against pathogenic bacteria.¹² Recent studies have suggested that specific probiotic strains not only exhibit antibacterial activity against H. pylori but also inhibit colonization and improve the gastric mucosal barrier, contributing to suppression of infection.¹³ Live probiotics are sensitive to pH, oxygen, and moisture, and certain strains can inhibit H. pylori growth or modulate pH to create unfavorable conditions for the pathogen. In addition, they enhance host immune function and promote bacterial clearance.¹⁴

Although most studies to date have focused on live probiotics, heat-killed or inactivated probiotics, referred to as postbiotics, have recently gained attention as alternative therapeutic candidates.¹⁵ While anti-H. pylori activity has traditionally been attributed to live probiotics, emerging evidence indicates that heat-killed probiotics may exhibit comparable biological activity.

In this study, we aimed to investigate the immunological responses associated with H. pylori-induced gastric mucosal injury after administering live or heat-killed Lacticaseibacillus paracasei HP7 in a mouse model. Specifically, we evaluated the mucosal protective and anti-inflammatory effects of L. paracasei HP7 by examining changes in inflammatory cytokine expression.

MATERIALS AND METHODS

Bacterial strain

The freeze-dried L. paracasei HP7 strain used in this study was provided by hy Co., Ltd. (Yongin, Korea) and stored at −20°C. Prior to administration, the strain was resuspended in saline and adjusted to a final concentration of 1 × 10⁸ CFU/mL. The strain was prepared in two forms (live and heat-killed) and used accordingly in the experiments. Heat-killed L. paracasei HP7 was prepared by boiling the cultured suspension for 20 min and was subsequently administered orally to animals at the same dosage as the live L. paracasei HP7.

H. pylori (43504; American Type Culture Collection, Manassas, VA, USA) was grown for 48–72 h on Brucella agar supplemented with 10% horse serum under microaerobic conditions at 37°C with 10% CO₂. The harvested bacterial cells were suspended in phosphate-buffered saline before administration.

Animals

Four-week-old male C57BL/6 mice were purchased from Saeron Bio (Uiwang, Korea) and acclimated for 3 days under controlled environmental conditions (22 ± 2°C, 50 ± 10% relative humidity, 12-h light/dark cycle) with ad libitum access to standard chow and water. All experimental procedures involving animals were conducted in accordance with the guidelines approved by the Institutional Animal Care and Utilization Committee of the University of Suwon (USW-IACUC-2025-003). After acclimation, all mice except those assigned to the normal control group (NC, n = 10) were infected with H. pylori. Mice with confirmed and sustained infection were subsequently allocated into the following experimental groups: H. pylori infection control (HP), live L. paracasei HP7 treated group (L-HP7), and heat-killed L. paracasei HP7 treated group (HK-HP7). The L. paracasei HP7 suspension was administered orally at a dose of 1 × 10⁹ CFU/kg/day using a 200 µL gavage per mouse. The heat-killed L. paracasei HP7 suspension was prepared and administered at the same dose. The oral dosage of L. paracasei HP7 was determined based on previous studies.^15–18

H. pylori infection

H. pylori infection was induced in all groups except for the NC group. The H. pylori was cultured under microaerobic conditions on Brucella agar containing 10% horse serum and adjusted to 2 × 10⁹ CFU/mL. Infection was induced in mice by withholding feed for 12 h and orally administering 0.4 mL of the H. pylori suspension. This procedure was repeated three times over a 3-week period to establish infection. The NC group received an equal volume of saline using the same method. To confirm infection, blood samples were collected from all mice 3 weeks after the final inoculation. Serum was isolated, and anti-H. pylori IgG antibody levels were quantified using a mouse anti-H. pylori IgG enzyme-linked immunosorbent assay (ELISA) kit (Cusabio, Wuhan, China).

Serum H. pylori immunoglobulin G measurement

To measure H. pylori IgG antibody titers, blood samples were collected immediately after euthanasia via cardiac puncture. Blood was drawn using Microtainer blood collection tubes (BD Biosciences, San Jose, CA, USA) and allowed to clot at room temperature for 30 min. The samples were then centrifuged at 1500 g for 20 min to separate the serum. IgG antibody levels were quantified using a mouse ELISA kit (Cusabio Biotech Co., Houston, TX, USA), and all analyses were performed in accordance with the manufacturer’s protocol. Serum samples (100 µL) were added to the 96-well plate pre-coated with H. pylori antigen and incubated at 37°C for 30 min. After incubation, the wells were washed using the buffer provided by the manufacturer. Subsequently, 100 µL of horseradish peroxidase (HRP)-conjugated anti-mouse IgG was added and incubated again at 37°C for 30 min, followed by another washing step. The wells were then treated with 3,3′,5,5′-tetramethylbenzidine (TMB) substrate for approximately 10 min to allow color development, after which the reaction was stopped by adding H₂SO₄ solution. The absorbance was measured using an Epoch plate reader (BioTek Instruments, Winooski, VT, USA).

Hematoxylin and eosin staining and histopathological evaluation of gastric mucosa

After euthanasia, gastric tissues were collected, washed with saline, and sectioned to include both the antrum and corpus. The samples were placed in cassettes and fixed in 10% formaldehyde at room temperature. Fixed tissues were paraffin-embedded, sliced into 4 µm sections, and stained with hematoxylin and eosin (H&E). Histopathological evaluation was performed to assess H. pylori-induced lesions. Images of stained gastric mucosal tissues were obtained, and three regions were randomly selected from the glandular stomach. Surface epithelium damage, inflammatory cell infiltration, and submucosal edema were graded on a scale of 0 = no change, 1 = minimal, 2 = mild, 3 = moderate, and 4 = severe. In addition, a total histopathological lesion score (range: 0–12), calculated as the sum of these three parameters, was also determined.

Serum histamine measurement

To investigate the effect of L. paracasei on gastric acid secretion in H. pylori-infected mice, histamine (HIS) levels were measured using a Mouse HIS ELISA Kit (Assay Genie, Dublin, Ireland). For the histamine assay, 50 µL of serum and a biotin-labeled anti-histamine antibody were added to the assay plate pre-coated with a histamine antigen, mixed thoroughly, and incubated at 37°C for 1 h. After washing, HRP-streptavidin conjugate and TMB substrate were added for color development. The reaction was terminated by the addition of an acidic stop solution, and absorbance was measured using an Epoch microplate reader (BioTek Instruments, Winooski, VT, USA). Histamine concentrations were calculated from a standard curve generated using CurveExpert (Hyams Development).

Quantitative polymerase chain reaction (qPCR) assay

To assess the effects of H. pylori infection and L. paracasei HP7 administration on inflammatory cytokines and gastric protective factors at the mRNA level, real-time quantitative PCR (RT-qPCR) was performed. Total RNA was extracted from gastric tissue using RNAiso Plus (Takara Bio Inc., Shiga, Japan) after homogenization. The extracted RNA was synthesized to complementary DNA. Subsequently, RT-qPCR was performed using LightCycler 96 system (Roche, Mannheim, Germany). qPCR amplification was carried out under the following conditions: an initial preincubation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 sec, annealing at 55°C for 10 sec, and extension at 72°C for 10 sec. After amplification, a final denaturation was performed at 95°C for 5 sec and 65°C for 60 sec, followed by a cooling step at 37°C for 30 sec. All qPCR data were normalized to the expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase, and relative gene expression levels were calculated using the ΔΔCt method. Primer sequences used in the present study are listed in Table 1.

Table 1.

Oligonucleotide Primers Used for RT-qPCR

Gene	Forward (5′→3′)	Reverse (5′→3′)
Gapdh	TCAACGGCACAGTCAAGG	ACTCCACGACATACTCAGC
Il1b	TTGACGGACCCCAAAAGATG	AGAAGGTGCTCATGTCCTCAT
Tnf	ACTCCAGGCGGTGCCTATGT	AGTGTGAGGGTCTGGGCCAT
Il8 (Cxcl2)	ATTAGTTTCTGGGGAGAGGG	GACTGCATCTATTTGTCCCC
Ifng	CTCTTCCTCATGGCTGTTTC	CCAGTTCCTCCAGATATCCA
Il6	GTACTCCAGAAGACCAGAGG	TGCTGGTGACAACCACGGCC
Il18	CCCTCTCTGTGAAGGATAGT	CTCCATCTTGTTGTGTCCTG
Muc1	CAGTAACAGTTCACCCCAG	CTTGGTAGTAGTTGGAGCTG
Ptgs2	GAGTGGGAGGCACTTGCATT	TGGAGGCGAAGTGGGTTTTA
Ptges2	CTGTTCTGTGGGTAAAGGG	CCCTAGCAGAGTTGAAAAGG
Cckbr	CCCTGGTCTACTGTTTCATG	GATGGTGGTATAGCTTAGCC

RT-qPCR, real-time quantitative PCR.

Serum gastrin measurement

To evaluate the effect of L. paracasei HP7 on gastric acid-related factors, serum gastrin levels in H. pylori-infected mice were measured using an ELISA kit (Assay Genie, Dublin, Ireland). A 50 µL serum sample was added to a 96-well plate pre-coated with gastrin-specific capture antibodies, together with the biotinylated detection antibody. The plate was sealed and incubated at 37°C for 45 min. After incubation, unbound components were removed by washing, followed by the addition of HRP-streptavidin conjugate and a 30-min incubation at 37°C. The plate was then washed again, and TMB substrate was added. The reaction was allowed to develop in the dark until color developed. The reaction was stopped by adding sulfuric acid, and absorbance was measured using an Epoch microplate reader (BioTek Instruments). Gastrin concentrations were determined based on the standard curve.

Statistical analysis

Statistical analyses were performed using GraphPad Prism software (San Diego, CA, USA). All data were first tested for normality, after which group comparisons were conducted using one-way analysis of variance (ANOVA) or the Kruskal–Wallis test, as appropriate. Post hoc analyses were performed using Dunnett’s test or Dunn’s test. Statistical significance was defined as P < .05.

RESULTS

Effect of L. paracasei HP7 on H. pylori IgG antibody

To confirm H. pylori infection, serum H. pylori-specific IgG levels were measured using an ELISA (Fig. 1). IgG titers in the H. pylori–infected control (HP) group were significantly elevated, showing an approximately 49.93% increase compared with the NC group (P < .01). After 4 weeks of L. paracasei HP7 administration, IgG titers in the L-HP7 group were significantly reduced by 32.50% relative to the HP group (P < .05). In the HK-HP7 group, IgG titers decreased by 13.38% compared with the HP group, although this reduction was not statistically significant.

FIG. 1.

Effect of Lacticaseibacillus paracasei HP7 on serum anti-Helicobacter pylori IgG levels in mice.Serum anti-H. pylori IgG levels were quantified by ELISA at absorbance 450 nm. NC: no infection, HP: H. pylori-infection, L-HP7: H. pylori-infection + live L. paracasei HP7, HK-HP7: H. pylori-infection + heat-killed L. paracasei HP7. Data are presented as means ± SD. Statistical significance was determined by one-way ANOVA: ^#P < .05 vs. NC. *P < .05 vs. HP. ELISA, enzyme-linked immunosorbent assay; IgG, immunoglobulin G; NC, normal control.

Effects of L. paracasei HP7 on histopathological gastric changes

The effects of L. paracasei HP7 on gastric mucosal inflammation induced by H. pylori were examined through H&E staining of gastric tissues from each experimental group (Fig. 2A). The gastric mucosal epithelium of the NC group exhibited an intact and well-organized architecture, whereas the HP group showed epithelial disruption along with marked infiltration of inflammatory cells in the lamina propria and submucosa due to H. pylori infection. In contrast, both the L-HP7 and HK-HP7 groups displayed attenuated epithelial damage and reduced inflammatory cell infiltration, indicating an improvement in inflammation-associated lesions.

FIG. 2.

Effect of Lacticaseibacillus paracasei HP7 on gastric mucosal histology in H. pylori-infected mice. (A) Representative H&E-stained gastric sections. Red arrows: surface epithelium damage, black arrows: inflammatory cell infiltration, blue arrows: submucosal edema. magnification 20×, scale bar 100 µm. (B) Total histopathological lesion score was calculated as the sum of the surface epithelium score, inflammatory cell infiltration score, and submucosal edema score in the gastric tissue. NC: no infection, HP: H. pylori-infection, L-HP7: H. pylori-infection + live L. paracasei HP7, HK-HP7: H. pylori-infection + heat-killed L. paracasei HP7. Data are presented as means ± SD. Statistical significance was determined by one-way ANOVA: ^###P < .001 vs. NC, *P < .05, and **P < .01 vs. HP. H&E, hematoxylin and eosin.

Figure 2B presents the histopathological scores of gastric mucosal inflammation assessed across three parameters. Surface epithelial damage in the HP group increased more than threefold compared with the NC group (P < .001). In contrast, administration of L. paracasei HP7 significantly reduced surface epithelial damage by 47.06% in both the L-HP7 and HK-HP7 groups (P < .05). Inflammatory cell infiltration and submucosal edema were also elevated in the HP group relative to the NC group but showed a decreasing trend in the L-HP7 and HK-HP7 groups, although these changes were not statistically significant. The total histopathological score, the sum of all three parameters, was approximately 2.77-fold higher in the HP group than in the NC group. Compared with the HP group, the L-HP7 and HK-HP7 groups exhibited significant reductions of 46.88% and 56.25%, respectively.

Effects of L. paracasei HP7 on gastric mucosal cytokines

Figure 3 shows the effects of L. paracasei HP7 on the expression of inflammatory cytokines in the gastric mucosa of H. pylori-infected mice. The mRNA expression levels of the pro-inflammatory cytokines Il1b, Il6, Cxcl2(Il8), Il18, Ifng, and Tnf were analyzed using real-time qPCR. As shown in Figure 3A–F, the mRNA levels of Il1b, Il6, Cxcl2, Il18, Ifng, and Tnf were markedly elevated in the HP group compared with the NC group. Notably, the expression of Ifng exhibited the greatest increase among the pro-inflammatory cytokines following H. pylori infection, showing an approximately 2.4-fold elevation relative to the NC group (P < .001).

FIG. 3.

Effect of Lacticaseibacillus paracasei HP7 on inflammatory cytokine mRNA expressions in H. pylori — infected mice. (A–F) Il1b, Il6, Cxcl2, Il18, Ifng, and Tnf mRNA levels in gastric tissues were analyzed using RT-qPCR. GAPDH was used as the reference gene. Data are presented as means ± SD. Statistical significance was determined by one-way ANOVA: ^#P < .05, ^##P < .01, and ^###P < .001 vs. NC, *P < .05, **P < .01, and ***P < .001 vs. HP. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-qPCR, real-time quantitative PCR.

In contrast, administering L. paracasei HP7 to H. pylori-infected mice significantly reduced the mRNA levels of Il1b, Il6, Cxcl2, Il18, Ifng, and Tnf compared with the HP group. Among these, Ifng showed the greatest reduction, decreasing by 71.56% in the L-HP7 group and 65.73% in the HK-HP7 group relative to the HP group (P < .001).

Taken together, these results indicate that pro-inflammatory cytokines upregulated by H. pylori infection were effectively reduced by L. paracasei HP7 treatment.

Effects of L. paracasei HP7 on gastric mucosal protective factors

MUC1 is a membrane-bound mucin expressed on the surface of gastric epithelial cells and is known to suppress inflammation.¹⁹ Prostaglandin E₂ (PGE₂) regulates various functions of the gastrointestinal (GI) tract and protects the gastric mucosa by promoting mucus and bicarbonate secretion and enhancing mucosal blood flow under physiological conditions.²⁰ However, under inflammatory stimuli, cyclooxygenase-2 (COX-2) is upregulated and promotes excessive PGE₂ production, contributing to the formation of a pro-inflammatory microenvironment.²¹ Prostaglandin E synthase-2 is known to be the terminal enzyme in the PGE₂ biosynthetic pathway and directly contributes to PGE₂ production.²²

To determine whether administration of L. paracasei HP7 contributes to the improvement and protection of the gastric mucosal environment in H. pylori-infected mice, the mRNA expression levels of Muc1, Ptgs2, and Ptges2 were assessed. As shown in Figure 4A, Muc1 expression in the HP group was reduced by 46.29% compared with the NC group (P < .001). In contrast, Muc1 expression was markedly increased in both L. paracasei HP7-treated groups, showing increases of 78.46% in the L-HP7 group and 92.38% in the HK-HP7 group (P < .001).

FIG. 4.

Effect of Lacticaseibacillus paracasei HP7 on Muc1, Ptgs2 and Ptges2 mRNA expression levels in H. pylori-infected mice. (A) Muc1, (B) Ptgs2 and (C) Ptges2 mRNA levels in gastric tissues were quantified by RT-qPCR. Gene expression was normalized to GAPDH. Data are presented as means ± SD. Statistical significance was determined by one-way ANOVA: ^#P < .05, and ^###P < .001 vs. NC, **P < .01, and ***P < .001 vs. HP.

The mRNA expression level of Ptgs2 was dramatically and significantly increased by 3.9-fold in the HP group compared with the NC group (Fig. 4B). However, compared with the HP group, all L. paracasei HP7–treated groups showed significant reductions (P < .001). Specifically, the L-HP7 and HK-HP7 groups exhibited significant decreases of 79.40% and 65.36%, respectively (P < .001).

Analysis of Ptges2 mRNA expression revealed a significant 69.20% increase in the HP group compared with the NC group (Fig. 4C). However, administration of L. paracasei HP7 resulted in reductions of more than 40% in both treatment groups. Specifically, Ptges2 expression decreased by 48.11% in the L-HP7 group (P < .01) and by 45.98% in the HK-HP7 group (P < .001).

Effects of L. paracasei HP7 on factors regulating gastric acid secretion

The CCK2 receptor binds to gastrin in parietal cells and stimulates gastric acid secretion, while gastrin and histamine are known to modulate acid secretion and mucosal cell proliferation during H. pylori infection.^23,24 To investigate whether administration of L. paracasei HP7 alters gastric acid-related factors in H. pylori-infected mice, we measured serum gastrin and histamine levels, as well as Cckbr mRNA expression.

Figure 5A shows the serum histamine levels in H. pylori-infected mice. Compared with the NC group, histamine levels in the HP group increased significantly by 29.56% (P < .01). In contrast, administration of L. paracasei HP7 significantly reduced serum histamine levels, showing decreases of 19.01% (P < .05) and 34.17% (P < .001) in the L-HP7 and HK-HP7 groups, respectively.

FIG. 5.

Effects of Lacticaseibacillus paracasei HP7 on histamine, gastrin and Cckbr levels in H. pylori-infected mice. Serum (A) histamine and (B) gastrin levels were measured by ELISA. The (C) Cckbr mRNA levels were measured by RT-qPCR, using GAPDH as the internal control. Data are presented as means ± SD. Statistical significance was determined by one-way ANOVA: ^##P < .01, and ^###P < .001 vs. NC, *P < .05, **P < .01, and ***P < .001 vs. HP.

Next, serum gastrin levels were measured (Fig. 5B). Both HP7-treated groups exhibited an approximately 50% reduction compared with the HP group, with levels of 1.59 pg/mL in the L-HP7 group and 1.45 pg/mL in the HK-HP7 group, corresponding to decreases of 49.15% (P < .05) and 53.84% (P < .01), respectively.

Cckbr expression was assessed at the mRNA level (Fig. 5C). Compared with the NC group, Cckbr expression increased by 62.14% in the HP group (P < .001). However, the L-HP7 group showed a significant 42.69% reduction relative to the HP group (P < .001). In the HK-HP7 group, Cckbr expression decreased by 23.60% compared with the HP group, although this decrease was not statistically significant.

DISCUSSION

H. pylori is a representative pathogenic bacterium that adheres to the gastric epithelial surface, modulates host immune responses, and induces chronic inflammation. Upon infection, the H. pylori lipopolysaccharide (LPS) stimulates Toll-like receptor 2 (TLR2) and activates NF-κB signaling pathway, thereby increasing the expression of multiple pro-inflammatory cytokines such as IL-8, TNF-α, and IFN-γ.^25,26 Simultaneously, the bacterium releases virulence factors, including VacA and CagA, which induce epithelial cell apoptosis, cause mucosal damage, and impair functional MUC1 via shedding despite transcriptional upregulation.²⁷ These chronic inflammatory responses lead to gastric mucosal atrophy and tissue damage and can progress to peptic ulcer disease or gastric cancer.²⁸ Although eradication therapy is currently the primary strategy for treating H. pylori infection, its efficacy is increasingly being limited by rising antibiotic resistance. Consequently, probiotics that can prevent dysbiosis and enhance mucosal defense mechanisms are attracting considerable attention.²⁹

L. paracasei HP7 is a probiotic strain isolated from Kimchi, a traditional Korean fermented food.³⁰ L. paracasei HP7 has been shown to reduce H. pylori-induced gastric mucosal inflammation and enhance mucosal protection.¹⁶ While previous studies have primarily focused on the effects of live probiotics, attention is shifting toward heat-killed probiotics, which exhibit similar biological activities despite undergoing thermal or other inactivation processes.³¹ These nonviable bacterial postbiotics exert their effects through bacterial metabolites and possess various functional properties, including modulation of gut microbial balance, inhibition of pathogen adhesion and invasion, and immune regulation.¹⁵ Particularly, similar to live bacteria, heat-killed probiotics stimulate immune receptors such as TLR2 through cell wall components or extracellular polysaccharides, thereby increasing the secretion of anti-inflammatory cytokines such as IL-10.¹⁵ They can also inhibit H. pylori adhesion and suppress NF-κB signaling, resulting in reduced expression of inflammatory cytokines such as TNF-α and IL-6.³² Unlike live probiotics, heat-killed forms offer higher stability and eliminate the risk of infection, making them a promising next-generation option that provides stability while retaining biological activity comparable with that of live strains.³³

In this study, we evaluated the anti-inflammatory and mucosal protective effects of live and heat-killed L. paracasei HP7 in H. pylori-infected C57BL/6 mice. Serum analysis revealed that the anti-H. pylori IgG levels were highest in the HP group, whereas the L-HP7 group showed a significant reduction, suggesting that L. paracasei HP7 attenuated antigenic stimulation induced by H. pylori infection and consequently suppressed humoral immune responses.³⁴ Although the HK-HP7 group did not show a statistically significant reduction in anti-H. pylori IgG levels compared with the HP group, a decreasing trend was observed. While heat-killed probiotics lack active metabolic activity compared with live strains, they offer advantages in terms of safety and stability.¹⁵ Notably, heat-killed L. paracasei HP7 still exerted an IgG-suppressive effect against H. pylori infection at a level comparable with that of the live form, suggesting that HK-HP7 may provide similar immunomodulatory benefits with enhanced safety.

Histological examination of gastric mucosa using H&E staining demonstrated epithelial damage and inflammatory cell infiltration in the HP group. Analysis of histopathological scores, including surface epithelial damage, inflammatory cell infiltration, and submucosal edema, revealed that these pathological changes were alleviated in the L. paracasei HP7-treated groups, indicating partial restoration of gastric mucosal integrity. These findings are consistent with those of the in vivo study by Hong, which reported that L. paracasei HP7 reduced histopathological lesion scores in the gastric mucosal tissues of H. pylori-infected C57BL/6 mice.¹⁶

Recognition of H. pylori LPS by TLR2 activates host immune signaling, promoting nuclear translocation and transcriptional activation of NF-κB.³⁵ This leads to the upregulation of pro-inflammatory cytokines such as TNF-α, IL-1β, IL-8, and IFN-γ, thereby amplifying the inflammatory response.^36,37 In this study, the gastric mucosal tissues of H. pylori-infected mice exhibited increased expression of the pro-inflammatory cytokine genes Il1b, Il6, Cxcl2, Ifng, Tnf, and Il18, whereas administration of L. paracasei HP7 markedly reduced their expression levels. Probiotics are known to exert immunomodulatory effects by suppressing pro-inflammatory cytokine release, indirectly contributing to pathogen inhibition.^38,39 Previous studies using L. paracasei HP7 have reported reduced Cxcl2 and Tnf gene expressions along with decreased H. pylori colonization in infected animals.^14,16 A clinical study also demonstrated that fermented milk containing L. paracasei alleviated chronic inflammation and reduced H. pylori density in infected patients. Collectively, these findings suggest that L. paracasei HP7 attenuates H. pylori-induced inflammatory responses by suppressing the expression of pro-inflammatory cytokines activated by the host immune system.

We also evaluated the protective effects of L. paracasei HP7 on gastric mucosal integrity by examining the mRNA expression of Muc1 and prostaglandin biosynthesis-related genes. Muc1 expression, which was diminished by H. pylori infection, was significantly restored following L. paracasei HP7 administration. MUC1, a membrane-bound mucin expressed on the surface of gastric epithelial cells, physically blocks the adhesion of H. pylori and interferes with bacterial colonization.⁴⁰ Thus, restored Muc1 expression suggests that L. paracasei HP7 may inhibit H. pylori adherence and mitigate epithelial damage.⁴¹ PGE₂-related pathways are known to contribute to gastric mucosal protection. However, during H. pylori infection, these pathways are often upregulated through inflammation-associated induction of COX-2.^42,43 In this study, H. pylori infection increased the expression of Ptgs2 (COX-2) and Ptges2 (Prostaglandin E synthase-2), whereas L. paracasei HP7 significantly attenuated this induction. These changes were accompanied by improved epithelial morphology in histological analyses, suggesting that modulation of inflammation-associated prostaglandin biosynthesis may contribute to the restoration of gastric mucosal integrity.

It is well established that H. pylori reduces stomach acid production (hypochlorhydria), leading to compensatory increases in gastrin and CCK2R, which contribute to mucosal damage.⁴⁴ Gastric acid secretion is regulated by gastrin, which binds to CCK2R on enterochromaffin-like cells, triggering histamine release and subsequent stimulation of parietal cell H2 receptors to promote acid secretion.^23,45 In this study, L. paracasei HP7 significantly decreased the expression of gastrin, histamine, and Cckbr, suggesting that HP7 may modulate the dysregulated gastrin–CCK2R axis associated with H. pylori infection. Such modulation may contribute to the normalization of gastric acid regulatory pathways and protection against mucosal injury.⁴⁶

Overall, this study evaluated the effects of both live and heat-killed forms of L. paracasei HP7 in H. pylori-infected mice by examining changes in gastric inflammatory and protective factors. L. paracasei HP7 not only reduced serum anti-H. pylori IgG levels but also improved histopathological scores and decreased pro-inflammatory cytokine genes such as Il1b, Il6, Cxcl2 (Il8), Il18, Ifng, and Tnf. L. paracasei HP7 also modulated protective factors such as Muc1 and prostaglandin biosynthesis-related pathways and reduced gastric acid-related factors including gastrin, histamine, and Cckbr, thereby mitigating gastric mucosal damage.

In conclusion, L. paracasei HP7 effectively attenuates H. pylori-induced gastric mucosal inflammation and strengthens mucosal defense mechanisms, contributing to improved gastric health. Notably, the retention of anti-inflammatory and protective effects in the heat-killed form suggests that L. paracasei HP7 holds significant potential as a safe and stable functional probiotic. However, as this study was limited to an animal model, further research is needed to elucidate the detailed molecular mechanisms and assess the clinical applicability of L. paracasei HP7 in humans. In addition, future studies should determine whether L. paracasei HP7 directly inhibits H. pylori adhesion or survival through cellular-level mechanistic analyses.

CONCLUSION

In this study, we investigated the impact of live and heat-killed L. paracasei HP7 on H. pylori-infected mice by assessing alterations in gastric mucosal inflammatory markers and mucosal protective factors. Administration of L. paracasei HP7 led to a reduction in serum H. pylori IgG levels, improvements in histopathological lesions, and marked suppression of pro-inflammatory cytokine genes including Il1b, Il6, Cxcl2, Il18, Ifng, and Tnf. L. paracasei HP7 also restored protective factors such as Muc1 and prostaglandin biosynthesis-related pathways and lowered acid-related components (gastrin, histamine, and Cckbr), ultimately alleviating gastric mucosal injury. These findings suggest that HP7 may serve as a promising adjunct to antibiotics for the management of H. pylori-associated diseases.

AUTHORS’ CONTRIBUTIONS

Y.-H.L. oversaw conceptualization, project management, supervision, resourcing, funding acquisition, formal analysis, validation, visualization, writing, review, and editing. H.L. and J.Y.L. were responsible for data organization, formal analysis, methodology, and writing. J.-H.L. (hy Co., Ltd.), J.-Y.K. (hy Co., Ltd.), I.-D.C. (hy Co., Ltd.), J.-J.S. (hy Co., Ltd.), and J.-H.L. (hy Co., Ltd.) provided resources (L. paracasei HP7 strain and related materials) and contributed to review and editing.

Footnotes

AUTHOR DISCLOSURE STATEMENT

The authors declare that this study received support from hy Co., Ltd., which provided research funding. Jae-Ho Lee, Ju-Yeon Kim, Il-Dong Choi, Jae-Jung Shim, and Jae-Hwan Lee are employees of hy Co., Ltd. and coauthors of this study. They supplied the L. paracasei HP7 strain used in the experiments, reviewed the article, and offered comments. However, all experimental procedures, data analysis, and interpretation of results were carried out solely by the other authors. The article’s content and final conclusions were determined exclusively by the independent authors, without any involvement or influence from the funding organization.

FUNDING INFORMATION

This work was supported by hy Co. Ltd (2025-0062).

References

Ernst

, Gold

. The disease spectrum of Helicobacter pylori: The immunopathogenesis of gastroduodenal ulcer and gastric cancer. Annu Rev Microbiol, 2000; 54:615–640; doi: 10.1146/annurev.micro.54.1.615

Scott

, Marcus

, Wen

, et al. Cytoplasmic histidine kinase (HP0244)-regulated assembly of urease with UreI, a channel for urea and its metabolites, CO2, NH3, and NH4+, is necessary for acid survival of Helicobacter pylori. J Bacteriol, 2010; 192(1):94–103; doi: 10.1128/JB.00848-09

Lim

, Kwon

J-W

, Kim

, et al. Prevalence and risk factors of Helicobacter pylori infection in Korea: Nationwide multicenter study over 13 years. BMC Gastroenterol, 2013; 13:104; doi: 10.1186/1471-230X-13-104

Tempera

, Michael

, Tageldin

, et al. Gastric cancer due to chronic H. pylori infection: What we know and where we are going. Diseases, 2022; 10(3):57; doi: 10.3390/diseases10030057

Butt

, Epplein

. Helicobacter pylori and colorectal cancer—A bacterium going abroad? PLoS Pathog, 2019; 15(8):e1007861; doi: 10.1371/journal.ppat.1007861

Takashima

, Fujiwara

, Watanabe

, et al. High molecular protein of Helicobacter pylori responsible for inhibition of ornithine decarboxylase activity of human gastric cultured cells. Aliment Pharmacol Ther, 2002; 16(Suppl 2):167–173; doi: 10.1046/j.1365-2036.16.s2.20.x

Yoshiyama

, Nakazawa

. Unique mechanism of Helicobacter pylori for colonizing the gastric mucus. Microbes Infect, 2000; 2(1):55–60; doi: 10.1016/s1286-4579(00)00285-9

, Wu

, Sun

, et al. Effect of Lactobacillus plantarum ZFM4 in Helicobacter pylori-infected C57BL/6 mice: Prevention is better than cure. Front Cell Infect Microbiol, 2023; 13:1320819; doi: 10.3389/fcimb.2023.1320819

Dunne

, Dolan

, Clyne

. Factors that mediate colonization of the human stomach by Helicobacter pylori. World J Gastroenterol, 2014; 20(19):5610–5624; doi: 10.3748/wjg.v20.i19.5610

10.

Yuan

, Yang

, Han

, et al. Beyond antibiotics: Probiotics as a promising ally against Helicobacter pylori. Front Pharmacol, 2025; 16:1620870; doi: 10.3389/fphar.2025.1620870

11.

Sharndama

, Mba

. Helicobacter pylori: An up-to-date overview on the virulence and pathogenesis mechanisms. Braz J Microbiol, 2022; 53(1):33–50; doi: 10.1007/s42770-021-00675-0

12.

Chen

Y-H

, Tsai

W-H

, Wu

H-Y

, et al. Probiotic Lactobacillus spp. Act against Helicobacter pylori-induced inflammation. J Clin Med, 2019; 8(1):90; doi: 10.3390/jcm8010090

13.

Myllyluoma

, Ahonen

, Korpela

, et al. Effects of multispecies probiotic combination on Helicobacter pylori infection in vitro. Clin Vaccine Immunol, 2008; 15(9):1472–1482; doi: 10.1128/CVI.00080-08

14.

Lee

H-A

, Kim

. Synergistic effect of probiotic HP7 and the extracts of Perilla frutescens and Glycyrrhiza glabra to alleviate Helicobacter pylori-induced damages. J Biomed Transl Res, 2020; 21(3):101–108; doi: 10.12729/jbtr.2020.21.3.101

15.

Piqué

, Berlanga

, Miñana-Galbis

. Health benefits of heat-killed (Tyndallized) probiotics: An overview. Int J Mol Sci, 2019; 20(10):2534; doi: 10.3390/ijms20102534

16.

Hong

S-S

, Lee

H-A

, Kim

, et al. In vitro and in vivo inhibition of Helicobacter pylori by Lactobacilllus paracasei HP7. Lab Anim Res, 2018; 34(4):216–222; doi: 10.5625/lar.2018.34.4.216

17.

Lee

, Jeong

, Kim

, et al. Postbiotic potential of heat-killed Lacticaseibacillus paracasei HP7 in functional dyspepsia. J Microbiol Biotechnol, 2025; 35:e2508029; doi: 10.4014/jmb.2508.08029

18.

Jeong

, Lee

, Kim

, et al. Lacticaseibacillus paracasei HP7 improves gastric emptying by modulating digestive factors in a Loperamide-Induced functional dyspepsia mouse model. J Microbiol Biotechnol, 2025; 35:e2412035; doi: 10.4014/jmb.2412.12035

19.

Guang

, Twaddell

, Lillehoj

. Molecular interactions between MUC1 epithelial mucin, β-catenin, and CagA proteins. Front Immunol, 2012; 3:105; doi: 10.3389/fimmu.2012.00105

20.

Takeuchi

, Amagase

. Roles of cyclooxygenase, prostaglandin E2 and EP receptors in mucosal protection and ulcer healing in the gastrointestinal tract. Curr Pharm Des, 2018; 24(18):2002–2011; doi: 10.2174/1381612824666180629111227

21.

Echizen

, Hirose

, Maeda

, et al. Inflammation in gastric cancer: Interplay of the COX-2/prostaglandin E2 and Toll-like receptor/MyD88 pathways. Cancer Sci, 2016; 107(4):391–397; doi: 10.1111/cas.12901Erratum in: Cancer Sci. 2016 Jul;107(7):1059. doi: 10.1111/cas.12973

22.

Pomorski

, Meyer

, Naumann

. Helicobacter pylori-induced prostaglandin E(2) synthesis involves activation of cytosolic phospholipase A(2) in epithelial cells. J Biol Chem, 2001; 276(1):804–810; doi: 10.1074/jbc.M003819200

23.

Yao

, Smolka

. Gastric parietal cell physiology and Helicobacter pylori–induced disease. Gastroenterology, 2019; 156(8):2158–2173; doi: 10.1053/j.gastro.2019.02.036

24.

Konturek

, Konturek

, Hartwich

, et al. Helicobacter pylori infection and gastrin and cyclooxygenase expression in gastric and colorectal malignancies. Regul Pept, 2000; 93(1–3):13–19; doi: 10.1016/s0167-0115(00)00173-7

25.

Brandt

, Kwok

, Hartig

, et al. NF-kappaB activation and potentiation of proinflammatory responses by the Helicobacter pylori CagA protein. Proc Natl Acad Sci U S A, 2005; 102(26):9300–9305; doi: 10.1073/pnas.0409873102

26.

Smith

. Role of Toll-like receptors in Helicobacter pylori infection and immunity. World J Gastrointest Pathophysiol, 2014; 5(3):133–146; doi: 10.4291/wjgp.v5.i3.133

27.

Lindén

, Sheng

, Every

, et al. MUC1 limits Helicobacter pylori infection both by steric hindrance and by acting as a releasable decoy. PLoS Pathog, 2009; 5(10):e1000617; doi: 10.1371/journal.ppat.1000617

28.

Kuck

, Kolmerer

, Iking-Konert

, et al. Vacuolating cytotoxin of Helicobacter pylori induces apoptosis in the human gastric epithelial cell line AGS. Infect Immun, 2001; 69(8):5080–5087; doi: 10.1128/IAI.69.8.5080-5087.2001

29.

Goderska

, Agudo Pena

, Alarcon

. Helicobacter pylori treatment: Antibiotics or probiotics. Appl Microbiol Biotechnol, 2018; 102(1):1–7; doi: 10.1007/s00253-017-8535-7

30.

Alipour

, Mofarrah

, Alipour

. Probiotics for treatment of Helicobacter pylori infections and gastric cancer prevention. J Genet Resour, 2022; 8:244–254; doi: 10.22080/jgr.2022.23949.1324

31.

Shida

, Nanno

. Probiotics and immunology: Separating the wheat from the chaff. Trends Immunol, 2008; 29(11):565–573; doi: 10.1016/j.it.2008.07.011

32.

Aiba

, Ishikawa

, Tokunaga

, et al. Anti-Helicobacter pylori activity of non-living, heat-killed form of lactobacilli including Lactobacillus johnsonii No.1088. FEMS Microbiol Lett, 2017; 364(11); doi: 10.1093/femsle/fnx102

33.

Lahtinen

. Probiotic viability - does it matter? Microb Ecol Health Dis, 2012; 23; doi: 10.3402/mehd.v23i0.18567

34.

Sgouras

, Panayotopoulou

, Martinez-Gonzalez

, et al. Lactobacillus johnsonii La1 attenuates Helicobacter pylori-associated gastritis and reduces levels of proinflammatory chemokines in C57BL/6 mice. Clin Diagn Lab Immunol, 2005; 12(12):1378–1386; doi: 10.1128/CDLI.12.12.1378-1386.2005

35.

Zhou

, Zhu

, Ouyang

M-Z

, et al. Knockout of Toll-like receptor 4 improves survival and cardiac function in a murine model of severe sepsis. Mol Med Rep, 2018; 17(4):5368–5375; doi: 10.3892/mmr.2018.8495

36.

Teng

, Wang

, Dai

, et al. Let-7b is involved in the inflammation and immune responses associated with Helicobacter pylori infection by targeting toll-like receptor 4. PLoS One, 2013; 8(2):e56709; doi: 10.1371/journal.pone.0056709

37.

Noh

H-J

, Park

, Kwon

, et al. Immunostimulatory effect of heat-killed probiotics on RAW264.7 macrophages. J Microbiol Biotechnol, 2022; 32(5):638–644; doi: 10.4014/jmb.2201.01015

38.

Mazziotta

, Tognon

, Martini

, et al. Probiotics mechanism of action on immune cells and beneficial effects on human health. Cells, 2023; 12(1):184; doi: 10.3390/cells12010184

39.

Koh

Y-C

, Chang

Y-C

, Lin

W-S

, et al. Efficacy and mechanism of the action of live and heat-killed Bacillus coagulans BC198 as potential probiotic in ameliorating dextran sulfate sodium-induced colitis in mice. ACS Omega, 2024; 9(9):10253–10266; doi: 10.1021/acsomega.3c07529

40.

McGuckin

, Every

, Skene

, et al. Muc1 Mucin limits both Helicobacter pylori colonization of the murine gastric mucosa and associated gastritis. Gastroenterology, 2007; 133(4):1210–1218; doi: 10.1053/j.gastro.2007.07.003

41.

Sheng

, Ng

, Summers

, et al. Influence of the MUC1 cell surface mucin on gastric mucosal gene expression profiles in response to Helicobacter pylori infection in mice. Front Cell Infect Microbiol, 2020; 10:343; doi: 10.3389/fcimb.2020.00343

42.

Sierra

, Hobbs

, Chaturvedi

, et al. Induction of COX-2 expression by Helicobacter pylori is mediated by activation of epidermal growth factor receptor in gastric epithelial cells. Am J Physiol Gastrointest Liver Physiol, 2013; 305(2):G196–G203; doi: 10.1152/ajpgi.00495.2012

43.

Zhao

, Wen

, Wang

, et al. Helicobacter pylori modulates cyclooxygenase-2 and 15-hydroxy prostaglandin dehydrogenase in gastric cancer. Oncol Lett, 2017; 14(5):5519–5525; doi: 10.3892/ol.2017.6843

44.

Berna

, Jensen

. Role of CCK/gastrin receptors in gastrointestinal/metabolic diseases and results of human studies using gastrin/CCK receptor agonists/antagonists in these diseases. Curr Top Med Chem, 2007; 7(12):1211–1231; doi: 10.2174/156802607780960519

45.

Blandizzi

, Lazzeri

, Colucci

, et al. CCK1 and CCK2 receptors regulate gastric pepsinogen secretion. Eur J Pharmacol, 1999; 373(1):71–84; doi: 10.1016/S0014-2999(99)00212-5

46.

Zeng

, Ou

, Wang

, et al. Gastrin, Cholecystokinin, Signaling, and Biological Activities in Cellular Processes. Front Endocrinol (Lausanne), 2020; 11:112; doi: 10.3389/fendo.2020.00112