Abstract
Background
The amyloid cascade hypothesis still dominates in Alzheimer's disease (AD), and the acceleration of the clearance efficiency of amyloid-β (Aβ) has been always considered as an effective treatment option to slow the occurrence and progression of AD.
Objective
This study aims to explore the role of zkscan3 and its related pathways in AD of the microglia-mediated pathogenesis, and whether the combined effect of drugs can exert neuroprotective function.
Methods
N9 mouse microglia and HT-22 mouse hippocampal neurons were randomly divided into 6 groups, qRT-PCR technique was used to detect the gene expression level of zkscan3 and the genes related to lysosome generation and function. Fourteen C57 mice were randomly divided into two groups, and drug intervention model mice were randomly selected to establish from the AD group. Transmission electron microscope was used to detect the cell status and lysosome function in the hippocampus together with the other two groups.
Results
Compared with the AD model group, the gene expression of zkscan3 in the drug intervention group was downregulated, and the degree of neuronal injury in the hippocampus was reduced, the structure and number of synapses were improved, and the function of intracellular lysosome was enhanced.
Conclusions
Zkscan3 and its related genes play a vital role in the development of AD. CGRP and CHIT-1, as a combined intervention, imparts effects through zkscan3-related pathways to improve lysosomal function and exert certain neuroprotective effects.
Introduction
Alzheimer's disease (AD) is the most common neurodegenerative disease. Regarding the molecular mechanism of AD pathological changes, the amyloid cascade hypothesis still dominates, and its pathological feature is the extracellular deposition of amyloid-β protein (Aβ) into senile plaques. In addition, various other hypotheses are involved in AD pathology, such as tau protein, oxidative stress, inflammation, and abnormal autophagy. 1 Nevertheless, revealing the interactions between these pathological aspects and determining the main causes of AD still requires further clarification and verification. But the acceleration of the clearance efficiency of Aβ has been always considered as an effective treatment option to slow the occurrence and progression of AD. 2 As an important player in the immune response of the central nervous system, microglia play a very crucial role in the phagocytosis and metabolism of Aβ in the central nervous system. 3 Lysosomes are important organelles for phagocytosis and autophagy, and an increase in lysosome activity helps cells remove pathological waste. 4 Therefore, promoting the lysosomal function of microglia and neurons contributes to the metabolism of Aβ, thereby exerting a certain neuroprotective effect.
Zkscan3 is expressed in many organs and tissues of the human body. Studies have shown that zkscan3 participates in cellular lysosome production and regulates intracellular lysosome function by acting as a transcriptional inhibitor of autophagy. 5 Furthermore, zkscan3 specifically recognizes and binds to a portion of gene sequences to regulate cell growth and migration, angiogenesis and protein hydrolysis. 6 zkscan3 silencing can effectively induce autophagy and increase the production of lysosomes. 7 However, it is still not clear whether this gene plays a corresponding role in Aβ metabolism.
Calcitonin gene-related peptide (CGRP) and chitinase 1 (CHIT-1) are associated with immune responses in the body and induce changes in lysosomal function. CHIT-1 is mainly produced by various types of macrophages, including microglia activated by immune responses, and its expression has been found to be different during the pathological process of a variety of diseases. The results of a previous study indicated that the level of CHIT-1 in the cerebrospinal fluid of AD patients was increased compared with that in the cerebrospinal fluid of a normal control group and patients with mild cognitive impairment. 8 In an AD mouse model constructed artificially in the laboratory, the expression of CHIT-1 was correlated with, to a certain extent, changes in cognitive function. 9 CGRP is widely distributed in various systems of the human body, and it is also expressed in the hippocampus of the brain (central nervous system). After CGRP binds to its corresponding receptor, it directly triggers an increase in intracellular cAMP expression, thereby exerting its related biological effects. 10 Studies have confirmed that increasing the level of cAMP reacidifies lysosomes in fibroblasts. 11 However, the specific functions and corresponding mechanisms by which CHIT-1 and CGRP participate in AD remain unclear. In a previous study by our group, an increase in CHIT-1 alone could not completely offset the nerve damage caused by AD pathology. Therefore, in this study, CHIT-1 was combined with CGRP for a dual-drug intervention.
This study was to investigate the role of zkscan3 and its related pathways in the pathogenesis of microglia-mediated AD and whether the combined effect of CHIT-1 and CGRP drugs exert neuroprotective effects through zkscan3-related pathways.
Methods
Preparation and storage of the main reagents
Preparation of Aβ1−42 oligomer solution
Aβ1−42 powder (Abcam, Cambridge, MA, USA, ab120959) was dissolved in a sterile PBS solution to prepare a solution with a concentration of 1 mg/mL. Subsequently, it was placed in a constant-temperature incubator at 37°C for aging and incubation for 7 days. After high-speed centrifugation at 5000 rpm for 10 min. And the supernatant was packaged and stored at −80°C.
Preparation of CHIT-1 solution
CHIT-1 powder (R&D Systems, USA) was dissolved in a sterile DMSO solution to prepare a 1-mg/mL solution, which was then stored at −20°C.
Preparation of CGRP solution
CGRP powder (Med Chem Express, USA) was dissolved in sterile water to prepare a 1-nM solution, which was then stored at −80°C.
Experimental grouping and model establishment
Cell culture and model establishment
Murine N9 microglia cells and mouse hippocampal HT-22 neurons were cultured in complete culture medium at 37°C and 5% CO2, respectively. They were uniformly seeded into plates and randomly divided into six groups: AD model group (serum-free medium + 10-μM Aβ1−42), drug intervention group (serum-free medium + 1-nM CGRP + 100-ng/mL CHIT-1), AD model + drug intervention group (serum-free medium + 10-μM Aβ1−42 + 1-nM CGRP + 100-ng/mL CHIT-1), zkscan3 silencing group (serum-free medium + 2-μg si-RNA-zkscan3 plasmid + 5-μL lipo3000), gene silencing control group (serum-free medium + 2-μg si-RNA blank control plasmid + 5-μL lipo3000), and normal control group (serum-free medium) (DMEM/F12; Hyclone, USA).
The cells in each group were treated for 24 h. After 24 h, the cells in the zkscan3 silencing and gene silencing control groups were washed thoroughly with PBS solution and then placed in complete culture medium containing 10 μg/mL of puromycin for selective culture for 24 h.
Animal feeding and model establishment
C57BL/6 mice were fed in the SPF laboratory of the Experimental Animal Center of Chongqing Medical University. On animal experiments, this experiment got the permission of the Ethics Committee of Chongqing Medical University (Chongqing, China).
Establishment of an AD animal model
The mice were anesthetized and fixed on a brain stereotactic injection instrument device. Then, 3 μL of Aβ1−42 solution or 3 μL of PBS solution was injected into the lateral ventricle (0.25 mm posterior from the anterior fontanel, 1 mm left to the midline, and depth of 2.5 mm) with a micro syringe. Mouse behavioral experiments were conducted 30 days after model establishment.
Establishment of a drug intervention model
The mice with successful AD model establishment were randomly selected, anesthetized, and fixed on the brain stereotactic injection instrument device. Subsequently, 1 μL of the CGRP solution and 1 μL of the CHIT-1 solution were injected into the lateral ventricle using a micro syringe, followed by continuous feeding for 15 days.
Morris water maze
Preparation before experiment
Before the experiment, it was necessary to clean the feces of experimental animals in the pool. Throughout the testing process, the ambient temperature was maintained at approximately 25°C.
Experimental procedures
Training and learning stage: The mice were placed at the center point of each quadrant of the pool successively, and their movement trajectory within 60 s was recorded using software. Training and learning were continued for 4 days.
Spatial probe test
The mice were placed at the center point of a random quadrant in the pool, and their movement trajectory in the pool within 60 s was recorded using software. At each interval of two animal experiments, the feces of experimental animals in the pool needed to be cleaned.
Open-field experiment
Preparation before experiment
Before the experiment, the tank was sprayed with alcohol and wiped thoroughly to remove odor. Throughout the testing process, the ambient temperature was maintained at approximately 25°C.
Experimental procedures
The experimental animals were placed in the central grid successively, and their activities within 5 min were recorded using software. At each interval of two animal experiments, the tank needed to be sprayed with alcohol and wiped thoroughly, and the urine and feces of the experimental animals were cleaned.
Elevated plus-maze
Preparation before experiment
Before the experiment, the maze was sprayed with alcohol and wiped thoroughly to remove odor. During the entire testing process, the ambient temperature was maintained at approximately 25°C.
Experimental procedures
The experimental animals were successively placed in the central grid of the maze facing the closed arm, and their activities within 5 min were recorded using software. At each interval of two animal experiments, the maze was sprayed with alcohol and wiped thoroughly, and the urine and feces of the experimental animals were cleaned.
Sampling of brain tissues
The mice were using 0.9% normal saline for transcardial perfusion after anesthesia. Subsequently, the brain tissues were removed to separate the hippocampus and cortex on ice, which were then stored at −80°C.
As for the brain tissues used for electron microscopic observation, the blood vessels were flushed transcardial perfusion with normal saline after anesthesia, and the mice were perfused with 4% paraformaldehyde until the limbs became stiff. Subsequently, the mouse brains were prepared for dehydration.
Western blotting
SDS-PAGE
Each well contained 20 μg of protein samples, with 4 μL of prestained marker. Electrophoresis was performed at 80 V until the proteins were fully separated, followed by electroporation at 4°C and 250 mA for 70 min. The bands were immersed in a sealing solution at 37°C for 2 h and then incubated overnight in a primary antibody (anti-Zkscan3 Ab, Abcam, Cambridge, MA, USA, ab223477; anti-Gapdh Ab, Hangzhou Goodhere Biotechnology, China) solution at 4°C. After washing with PBST, incubation was performed in a secondary antibody (Boster, Wuhan, China) solution at 37°C for 2 h, followed by PBST washing. Development was conducted using an ECL reagent, and the images were collected and saved using a developer.
qRT-PCR
RNA was extracted with an RNA extraction kit (Takara Bio, Japan) and reversely transcribed by an RNA reverse transcription kit (Takara Bio, Japan). Subsequently, the target genes were amplified using a fluorescence quantitative PCR instrument, and the CT values of each group were obtained.
The amplification reaction system (Takara Bio, Japan) included the following: SYBR Green Master Mix, 10 μL; PCR reverse primer, 0.8 μL; complementary deoxyribonucleic acid template, 1 μL; PCR forward primer, 0.8 μL; and RNase-freedH2O, 7.4 μL.
The reaction conditions were as follows: preheating at 95°C for 1 min and 40 cycles of 95°C for 10 s, 60°C for 5 s, and 72°C for 15 s.
The primer sequences were designed and synthesized by Tsingke Biotechnology Co., Ltd, as follows:
Upstream of Gapdh: 5 GATGGACACATTGGGGTT′3′ Downstream of Gapdh: 5′ AAAGCTGTGGCGTGATG 3′ Upstream of Zkscan3: 5′ GCTGGGGTAGAATGTGTCGAG3′ Downstream of Zkscan3: 5′ CCACTGTCAACCAGAACTACCAA3′ Upstream of Grb2: 5′CCCTGGCATCCTTCACT3′ Downstream of Grb2: 5′GACCCCACAATCCTGCT3′ Upstream of Lamp2: 5′TCAAGCGCCATCATACTG3′ Downstream of Lamp2: 5′ATCTCAAACTTCGGGGACT3′
Lysosome-targeted fluorescence probe detection
The cells were incubated in complete culture medium which containing 50-nM Lyso-Tracker Red (Beyotime, China, C1046) for 90 min. After being washed with PBS solution thoroughly, the cells were observed under a fluorescence microscope.
Ethical statement
The animal subject in this manuscript have been approved by the Ethics and Ethics Committee of The First Affiliated Hospital of Chongqing Medical University.
Results
There were significant changes in zkscan3 expression in the AD model group
In the cell experiments, the zkscan3 gene in the AD model group was downregulated compared with that in the normal control group (p < 0.05). The downregulation of zkscan3, a repressor protein, resulted in the significant upregulation of GRB2 (p < 0.05) and Lamp2, a downstream lysosomal production and function-related gene (p < 0.05) (Figure 1).
Fold change in expression of each gene (*p < 0.05).
Zkscan3 was associated with lysosome production and function
In the cell experiments, compared with the gene silencing control group, the zkscan3 gene expression in the zkscan3 gene silencing group was reduced by more than 70%; the gene silencing effect was good. Western blot results demonstrated that zkscan3 protein expression followed the same decreasing trend as that observed for gene expression (Figure 2). The expression of GRB2 was significantly upregulated (p < 0.05), and Lamp2 was also upregulated (p < 0.05), a finding that was consistent in comparisons between the AD model group and control group (Figure 3).
Level of zkscan3 protein expression in the gene silencing group and gene silencing control group (*p < 0.05).
Fold change in gene expression for the gene silencing group and gene silencing control group (*p < 0.05).
The above results indicated that the increased expression of lysosomal function-related genes in the pathological state of AD was correlated with the decreased expression of zkscan3.
Drugs affected zkscan3 expression
In the cell experiments, compared with that in the normal control group, zkscan3 gene expression was significantly downregulated in the drug intervention group (p < 0.05); the western blot results demonstrated that protein expression followed the same trend as that observed for gene expression.
In the animal model, zkscan3 gene expression in the drug intervention group and the AD model group was consistent with the expression observed in the cell experiment (Figure 4).
Level of zkscan3 expression in the control and drug intervention groups. (a, b) Western blot was used to detect zkscan3 protein in mouse N9 microglia. Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) was used as an internal control. (*p < 0.05). (c) zkscan3 mRNA levels in mouse N9 microglia and mouse HT-22 hippocampal neurons, as determined by qRT-PCR (*p < 0.05). (d) zkscan3 mRNA levels in mouse hippocampal brain tissue, as determined by qRT-PCR (*p < 0.05).
Drugs affected lysosomal function and apoptosis
In the cell experiments, the proportion of apoptotic cells in AD model drug intervention group was lower than that in the AD model group. Lysosomal fluorescence probe detection revealed that there was an increase in the activity of intracellular lysosomes in AD model drug intervention group compared with the number and activity of intracellular lysosomes in AD model group (Figure 5).
Apoptosis detection and fluorescence probe detection results. (a–d) Apoptosis detection results for the mouse N9 microglial control group (a), AD model group (b), and AD model drug intervention group (c), the statistical chart of apoptosis (d). (e, f) Lysosomal fluorescent probe detection in the mouse N9 microglial AD model group (e) and AD model drug intervention group (f).
Transmission electron microscopy revealed that in mouse N9 microglia, some cells in the AD model group had already undergone apoptosis or necrosis. The nuclei of the apoptotic cells were shrunken with more autophagy in the cytoplasm. Compared with that of cells in the AD model group, the morphology of the cells in the AD model drug intervention group was more robust, i.e., the nuclear membrane was intact, the chromatin was evenly distributed, organelles such as rough endoplasmic reticulum and ribosomes were intact in the cytoplasm, and only small amounts of autophagy and primary lysosomes were observed. Mouse HT-22 hippocampal neurons of the 3 groups of cells also showed similar manifestations under electron microscopy (Figure 6).
Electron microscopy of mouse N9 microglial cells (top 3 panels) and mouse HT-22 hippocampal neurons (bottom 3 panels). (a) Control group: cells with normal morphology; nuclei, rough endoplasmic reticulum (RER). (b) AD group: necrotic cells; autophagy, discontinued cell membrane, expansion of RER, vacuole. (c) Drug intervention group: cells with small amounts of autophagy in the cytoplasm; primary lysosomes. (d) Control group: cells with normal morphology; nuclei, RER. (e) AD group: cells with expanded RER; autophagy. (f) Drug intervention group: cells with expanded RER; autophagy.
Drugs were associated with neuroprotection
In the AD animal model, the results of the Morris water maze (MWM) test indicated that there was no significant decrease in the escape latency of AD model mice during the training phase. In the space exploration experiment, the number of crossings in the target area decreased for the AD model mice, and the time to first arrival was prolonged. The results from the open field experiment showed that the desire to explore by the AD model mice was significantly reduced. The results of the elevated plus-maze test indicated similar behavior. Comprehensive behavioral experiments showed that the cognitive function of mice in the AD model group was impaired (Figure 7).
Behavioral experiment results. (a–c) Results of the MWM test: (a) escape latency for mice in the training and learning phases, (b) number of times the mice crossed the target area in the space exploration experiment, and (c) time when the mice first arrived at the target area in the space exploration experiment. (d) Representative trajectories of mice in the open field experiment. (e) Representative trajectories of mice in the elevated plus-maze test.
Under electron microscopy, in the animal model group, neuronal cells in the AD model group had already undergone apoptosis, with nuclei shrinkage, chromatin aggregation, and a large amount of secondary lysosomes and autophagy. The morphology and structure of neurons in the drug intervention group were relatively intact, but most of the rough endoplasmic reticulum in the cytoplasm was expanded, with a cystic shape (Figure 8).
Electron microscopy results for the animal model. (a) Control group: neurons with normal structure; nuclei, RER. (b) AD model group: apoptotic neurons; secondary lysosomes, autophagy. (c) Drug intervention group: most RER had expanded neurons.
The above results indicate that CHIT-1 and CGRP regulate the production and function of lysosomes in AD model mice through the zkscan3-related pathway and further play a protective role in reducing apoptosis.
Discussion
Aβ deposition was associated with the occurrence of AD
The etiology of AD is still unknown. One of the more widely accepted proposal with regard to the pathogenesis of AD is a disruption in the balance between the production and decomposition of Aβ in the brain. 12 Studies have shown that soluble Aβ is more toxic to the nervous system than is aggregated Aβ. 13 Even a slight reduction in Aβ metabolic efficiency can directly lead to the aggregation of Aβ. 14 Currently, the widely recognized drugs for the treatment of AD are cholinesterase inhibitors and NMDA receptor antagonists, both of which are symptomatic treatments. However, for drugs that affect the production and decomposition of Aβ in the brain, there is currently no uniformly approved drug in the world. Studies have reported that downregulation of certain autophagy-related proteins leads to the accumulation of immature autophagosomes in the brains of AD patients. 15 In addition, studies have shown that the failure of autophagosome maturation in brain cells occurs earlier than the formation of AD amyloid plaques. 16 Therefore, improving the autophagy process may be an effective way to treat AD.
Changes in lysosomal function can regulate Aβ metabolism
Studies have shown that microglia play an important role in the endocytosis and degradation of Aβ, 17 but the specific regulatory mechanism remains unclear. Microglia have strong Aβ metabolism and can rapidly phagocytose large amounts of Aβ through the pinocytotic pathway. After Aβ is engulfed into microglia, autophagosomes can form and bind to lysosomes to be degraded, 18 indicating that the enhancement of lysosome function helps to improve Aβ metabolic efficiency. 19 In this study, we found that the expression of genes related to cellular lysosomal production in various types of AD models were enhanced to different degrees, which supports that observation.
Zkscan3 regulates lysosomal function
The regulation of lysosomal number and lysosomal function is essential during Aβ degradation. The regulation of lysosomal function by zkscan3 involves the co-regulation of multiple genes. 20 In addition to regulating the expression of proteins essential for autophagy, zkscan3 also inhibits the expression of genes related to autophagy regulation. 21 Studies have shown that under continuous starvation conditions, zkscan3 actively migrates out of the nucleus, thereby reducing its inhibitory function and further activating the autophagy response. 22 In this study, when zkscan3 was actively silenced, the expression of genes related to cell and lysosome functions significantly increased; the fluorescence staining results indicated that the number and activity of lysosomes were significantly enhanced. These findings indicate that in the central nervous system, lysosomal function can also be directly regulated through zkscan3-related pathways and affect cellular phagocytosis and autophagy.
CHIT-1 was associated with changes in microglial function and Aβ metabolism
CHIT-1 can be secreted by activated microglia. Studies have shown that the expression of this enzyme is increased in the cerebrospinal fluid of AD patients. 8 Our previous study showed that CHIT1 provides a potential neuroprotective effect in a D-gal and AlCl3-induced cognitive impairment rat model through microglial polarization and Aβ oligomer reduction and that CHIT-1 synergizes with transforming growth factor β1 (TGFβ1) to enhance Aβ phagocytosis by microglia. 23 Additionally, CHIT-1 reduces the expression of Aβ oligomers in the brain tissues of AD model rats, thereby improving their cognitive function; this effect may be related to the consumption of chitin. 24 Combined with the above conclusions, reducing Aβ production while improving cell autophagy can effectively reduce the proportion of cell apoptosis, which may play a neuroprotective role and effectively block the pathological progression of AD.
CGRP and lysosomal function
CGRP is widely distributed in various systems and in the hippocampus of the central nervous system. After binding to its receptor, CGRP activates adenylate cyclase to increase intracellular cAMP, thereby exerting its biological effects. 10 Increasing the level of cAMP can reacidify lysosomes in fibroblasts. In contrast, the inhibition or knockout of cAMP-producing adenylate cyclase leads to lysosomal alkalization. 11 Although the exact mechanism of cAMP reacidification of lysosomes has not been determined, one study showed that cAMP has an important impact on the function of the main hydrogen ion pump in lysosomal membranes.
This study showed that the combined effect of CHIT-1 and CGRP contributes to the enhancement of cellular lysosomal function and that this effect can be achieved through the downregulation of zkscan3 gene expression. In addition, combined drug intervention decreased apoptosis in the central nervous system and reduced the neurotoxicity caused by Aβ to a certain extent, an effect that has potential value in the treatment of AD.
Conclusion
This study showed that zkscan3 and its related genes play important roles in the development of AD. The downregulation of zkscan3 expression increases the production and function of lysosomes, thereby delaying or reducing the pathology of AD to a certain extent. CGRP and CHIT-1, as a combined intervention, imparts effects through zkscan3-related pathways to improve lysosomal function and exert certain neuroprotective effects that may have a potential treatment function for patients with AD.
Footnotes
Acknowledgments
The authors have no acknowledgments to report.
Authors contributions
Wenkai Yang (Conceptualization; Funding acquisition; Methodology; Writing – original draft; Writing – review & editing); Weihua Yu (Formal analysis; Project administration; Resources; Writing – original draft); Yang Lv (Data curation; Investigation; Resources; Supervision; Writing – review & editing).
Funding
The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The research is supported by: General Project of Technological Innovation and Application Development of Chongqing Science & Technology Bureau (cstc2019jscx-msxmX0239).
Declaration of conflicting interests
The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Data availability
All data are included in the manuscript.