p53 SUMOylation promotes neurogenesis defects in APP/PS1 mice

Abstract

Background

p53 is a transcriptional factor that regulates numerous cellular processes, the stability and activity of p53 is essential to maintain its function. Post-translational modifications (PTMs), particularly SUMOylation, play a vital role in regulating p53 activity.

Objective

To investigate the neurogenesis related genes that downregulated by p53 SUMOylation in APP/PS1 mice, and the protected effect by overexpressing non-SUMOylated p53 (p53 K386R). Furthermore, to provide new clues for the mechanisms of Alzheimer's disease (AD).

Methods

Co-immunoprecipitation was used to detect the p53 SUMOylation levels in neuro2a (N2a) cells and APP/PS1 mice overexpressing wild-type p53 (p53 WT) or p53 K386R. In addition, RNA sequencing (RNA-seq) was used to detect the p53 SUMOylation regulated genes. Then we used qPCR, western blot, and immunofluorescence to measure the expression of neuroglobin (ngb) and the effect of neurogenesis defects induced by p53 SUMOylation.

Results

We verified that overexpression of p53 WT promoted p53 SUMOylation and p53 K386R decreased p53 SUMOylation in N2a cells and APP/PS1 mice. Ngb was related to neurogenesis which dramatically downregulated by p53 SUMOylation. In addition, we found p53 SUMOylation caused neuron reduction and impairment of neurogenesis.

Conclusions

Our data support that p53 SUMOylation may lead to neurogenesis defects by downregulating ngb in AD, suggesting that inhibition of p53 SUMOylation may be served as a therapeutic strategy for preventing AD and provide a new target for future researches and interventions.

Keywords

Alzheimer's disease neurogenesis neuroglobin (ngb)p53 SUMOylation

Introduction

Alzheimer's disease (AD), a leading cause of dementia, is a progressive neurodegenerative disease that primarily affects older people. The number of people with AD is on the rise globally which is primarily due to the aging population. Neurofibrillary tangles (NFTs) and senile plaques are two main pathological features of AD.^1,2 NFTs are caused by abnormal phosphorylation of tau, whereas senile plaques are formed by abnormal extracellular deposition of amyloid-β protein (Aβ).^1,3

SUMOylation is one of the post-translational modifications (PTMs). It is the covalent binding of small ubiquitin-like modifier (SUMO) to the lysine of the target proteins by a series of enzymes.⁴ SUMO-1 is one of the isoforms of SUMO and it has the ability to modify proteins.^5,6 SUMOylation changes the stability and activity of the proteins.^7,8 An increasing number of studies have shown that SUMOylation may play an important role in AD. SUMOylation of tau can promote phosphorylation of tau to affect tau function.⁹ In addition, SUMOylation may compete with ubiquitination to prevent Tau from degradation.⁹ Beta-site APP cleaving enzyme 1 (BACE1) can be stabilized by SUMOylation, which increases amyloid-β protein precursor (AβPP) shearing and Aβ deposition in AD.¹⁰ SET is the inhibitor of protein phosphatase 2A (PP2A) which can also be SUMOylated, SUMOylation of SET cause SET to remain in the cytoplasm inhibiting PP2A activity, and this will lead to hyperphosphorylation of tau and impairment of synaptic function.³ Accordingly, abnormal SUMOylation of proteins may accelerate the AD progression.

p53, a key transcription factor, is primarily regulated by the ubiquitin-proteasome degradation pathway, which maintains its cellular level at a stable state.¹¹ However, DNA damage, hypoxia, and UV radiation prevent p53 from degradation, which increases p53 stability and activity.¹² It has been demonstrated that p53 has a role in neurodegeneration, particularly in AD.^13,14 p53 is significantly elevated in AD, it may involve in apoptosis of neuroglial cells, and also may be associated with abnormal accumulation of Aβ and tau in AD patients’ brains.¹⁵ The stability and activity of p53 are mainly affected by PTMs. p53 can be SUMOylated and the only SUMOylation site of p53 is located at K386 in the C terminus, and mutating this site to arginine can effectively prevent p53 from being SUMOylated.^11,16 In addition, SUMOylation and ubiquitination do not compete for the same lysine site in p53.¹¹ It has been reported that SUMOylation of the p53 K386 site can play a role in mediating endothelial senescence and apoptosis escape.¹⁷ Furthermore, we have been reported that p53 SUMOylation is remarkably increased in AD patients’ brain and then accelerates senescence which provide a novel pathogenic link between aging and AD.¹⁸

Neuroglobin (Ngb), a recently discovered globin in vertebrate brain, resists neuroinflammation and performs neuroprotection.¹⁹ Ngb is predominantly expressed in neurons and has been reported to be declined in the severe stage of AD.^20,21 Overexpression of ngb can attenuate Aβ neurotoxicity, tau hyperphosphorylation, and AD phenotype.^21–24 Furthermore, ngb is able to reduce apoptosis through activating PI3K/Akt signaling pathway in AD.²⁵ In addition, studies have shown the role of ngb in neurogenesis and raised the possibility that overexpression of ngb could prevent neurodegenerative diseases like AD and stroke.²⁶ Our work found that overexpressing SUMOylated p53 significantly increased the transcription level of ngb in APP/PS1 mice through RNA sequencing (RNA-seq). Therefore, we verified the effect of SUMO-1 on p53 and confirmed the effect of SUMOylated p53 on expression of ngb. These findings suggested that targeted ngb and SUMOylated p53 may be important in the treatment of AD.

Methods

Animals and treatments

March-old APP/PS1 mice were provided by the Animal Center of Tongji Medical College, Huazhong University of Science and Technology. The mice were housed in the SPF animal room (temperature: 24–27°C, humidity: 60–65%, light-dark cycle: 12 h) for one month, and the mice had free access to food and water during the rearing. APP/PS1 mice were randomly divided into three groups and respectively injected with 0.67 μL AAV-vector (AAV9, CMV-bGlobin-MCS-EGFP-3FLAG-WPRE-hGH polyA, 6 × 10¹² TU/mL), 2 μL AAV-p53 WT (AAV9, CMV-betaGlobin-MCS-SV40 polyA, 2 × 10¹² TU/mL) and 1 μL AAV-p53 K386R (AAV9, CMV-betaGlobin-MCS-SV40 polyA, 4 × 10¹² TU/mL) in the CA1 region of the hippocampus on both sides. The mice after injecting adeno-associated virus (AAV) were kept in the SPF animal room for one month and then they were executed for brain extraction. Mice from each treatment were randomly divided into two groups, one for hippocampal extraction and one for brain freezing section.

Cell culture and plasmid transfection

Immortalized mouse neuro2a (N2a) cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS) and incubated in 5% CO₂ at 37°C. N2a cells were cultured in six-well plates and transfected when cell growth reached 70%. 50 μL of DMEM without FBS was respectively mixed with 2 μL of vector plasmids, wild-type p53 (p53 WT) and non-SUMOylated p53 (p53 K386R) plasmids (solution A), and 50 μL of DMEM without FBS was mixed with 4 μL of highgene transfection reagent (solution B). Mix the solutions A and B and left for 5 min, 100 μL of the mixture was added to each well. 4 h later, the media was half changed. After 24 h, stimulating cells with Aβ_1–42 for 24 h. In addition, both p53 WT and p53 K386R plasmids were provided by Genechem company (Shanghai, China).

RNA extraction, reverse transcription, and qPCR

Total RNA was extracted from the hippocampus tissue and transfected cells using Trizol (Invitrogen). 500 μL of Trizol and 250 μL of chloroform were added to the hippocampus tissue and transfected cells, mixed upside down for 15 s, placed on ice for 10 min and then centrifuged at 12,000 g for 15 min at 4°C. Transferred 200 μL of supernatant to new EP tubes, added 200 μL of isopropanol, mixed upside down, placed on ice for 10 min, and centrifuged at 12,000 g for 10 min at 4°C. Removed the supernatant, added 1 mL of absolute ethanol, and centrifuged at 12,000 g for 2 min at 4°C. Removed the supernatant, added 1 mL of 75% ethanol, and centrifuged at 12,000 g for 2 min at 4°C. Removed the supernatant and centrifuged at 5000 g for 2 min at 4°C. Let stand at room temperature for 5 min to remove all remaining ethanol and dissolved the RNA with 20 μL of DEPC-treated water. RNA concentrations were determined using the microplate reader (Norcros, UK) and all samples were corrected to 1 μg/μL. Reverse transcription was performed using the HiScript@ III RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme, China). QPCR was performed using the ChamQ SYBR qPCR Master Mix kit (Vazyme, China). ngb primer sequences were “forward: GTCTCTCCTCGCCTGAGTTC, reverse: GACTCACCCACTGTCGAGAA”. The reactions were performed using the StepOne Plus Real-Time PCR System (StepOne Plus ABI, USA), and the relative expression levels of mRNA of target genes were examined by the 2^−ΔΔCt method.

Co-immunoprecipitation

Transfected cells and hippocampus tissue were lysed in RIPA buffer containing protease inhibitors. The concentrations of the extracted proteins were determined using the bicinchoninic acid (BCA) method. 1 μL of rabbit anti-SUMO1 polyclonal antibody (1:100, 4930S, Cell Signaling Technology, USA) was added to the proteins and incubated overnight at 4°C. Add 20 μL of Protein A + G to the proteins and incubate at 4°C overnight. Proteins were separated on 12% SDS-PAGE gels, transferred to nitrocellulose (NC) membranes, and closed with 5% skim milk for 1 h at room temperature. Detection was performed using an odyssey system (Gene Company Limited). The primary antibody used in this study was: mouse anti-p53 monoclonal antibody (1:1,000, 2524S, Cell Signaling Technology, USA). The secondary antibody used was horseradish peroxidase conjugated goat anti-mouse IgG (1:7,000, 926-32350, Licor, USA). Quantitative analysis was performed using image J.

Western blot

Transfected cells and hippocampus tissue were lysed in RIPA buffer containing protease inhibitors. The concentrations of the extracted proteins were determined using the BCA method. Proteins were separated on 12% SDS-PAGE gels, transferred to NC membranes, and closed with 5% skim milk for 1 h at room temperature. The NC membranes were then incubated with primary antibody overnight at 4°C, washed three times with TBST, and incubated with secondary antibody for 1 h at room temperature. Detection was performed using an odyssey system (Gene Company Limited). The primary antibodies used in this study were: mouse anti-ngb monoclonal antibody (1:500, 21457, BioVendor, USA), mouse anti-p53 monoclonal antibody (1:1,000, 2524S, Cell Signaling Technology, USA), rabbit anti-SUMO1 polyclonal antibody (1:1,000, 4930S, Cell Signaling Technology, USA), mouse anti-flag monoclonal antibody (1:1,000, 390002, Zenbio, China), and mouse anti-β-actin monoclonal antibody (1:5,000, AC004. Abclonal, China). The secondary antibody used were horseradish peroxidase conjugated goat anti-mouse IgG (1:7,000, 926-32350, Licor, USA) and goat anti-rabbit IgG (1:7,000, 926-32211, Licor, USA). Quantitative analysis was performed using image J.

Immunofluorescence

Brain slices were washed with phosphate buffered saline (PBS), broken in 0.5% Triton X-100 containing 5% BSA for 5 min, and subsequently closed with 5% BSA for 1 h. Brain slices were incubated with primary antibody overnight at 4°C. After washing three times with PBS, brain slices were incubated with secondary antibody for 1 h at room temperature and re-stained with DAPI mounting medium at room temperature. The primary antibodies used were mouse anti-ngb monoclonal antibody (1:200, 21457, BioVendor, USA), rabbit anti-NeuN monoclonal antibody (1:800, 24307, Cell Signaling Technology, USA), rabbit anti-Dcx polyclonal antibody (1:150, 4604 s, Cell Signaling Technology, USA) and rabbit anti-Ki-67 polyclonal antibody (1:150, 27309-1-AP, Proteintech, China). The secondary antibodies used were Multi-rAb CoraLite® Plus 488-Goat Anti-Mouse Recombinant Secondary Antibody (H + L) (1:300, RGAM002, Proteintech, China) and CoraLite594-conjugated Goat Anti-Rabbit lgG (H + L) (1:300, SA0013-4, Proteintech, China). Images acquisition was performed using an inverted single photon laser scanning confocal microscope (ZEISS LSM780). To detect ngb expression in brain, the regions of dentate gyrus (DG) in hippocampus were observed, and the fluorescence intensity of ngb protein was counted using image J. In addition, the number of NeuN, Dcx and Ki67 positive cells in the brain region of DG in hippocampus were also counted using image J.

Statistical analysis

Data were analyzed using GraphPad prism (version 9.4). All quantitative data of the experiment were expressed as mean ± standard error of Mean (Mean ± SEM). Differences between groups were analyzed by one-way ANOVA Experimental data were considered statistically significant when p < 0.05.

Results

Overexpression of p53 WT promoted its SUMOylation

The previous study reported that p53 can be modified by SUMOylation, and the only SUMOylation site for p53 is the lysine 386.¹¹ Mutation of this site to arginine could effectively prevent p53 SUMOylation. To investigate whether p53 SUMOylation can be induced by overexpression of p53, we injected AAV-p53 WT or AAV-p53 K386R into the CA1 region of the hippocampus in APP/PS1 mice, AAV-vector injections serving as the control group. Co-immunoprecipitation assays were used to evaluate the SUMOylation of p53 in APP/PS1 mice. Results revealed that mice injected with AAV-p53 WT exhibited elevated levels of SUMOylated p53 compared to those injected with AAV-p53 K386R and the AAV-vector group (Figure 1(a) and (b)). Meanwhile, p53 was overexpressed in both the AAV-p53 WT and AAV-p53 K386R virus-injected groups, but not in the AAV-vector group, while SUMO1 expression remained approximately similar in all three groups (Figure 1(a), (c) and (d)). These findings substantiated that overexpression of p53 WT results in a marked increase in p53 SUMOylation in vivo but overexpression of p53 K386R results in a decrease in p53 SUMOylation.

Figure 1.

Overexpression of p53 WT promoted its SUMOylation in vivo and vitro. (a) Western blot and (b–d) quantitative analysis for p53-SUMO1, p53, and SUMO-1 in APP/PS1 mice respectively injected with AAV-vector, AAV-p53 WT, and AAV-p53 K386R. (e) Western blot and (f–h) quantitative analysis for p53-SUMO1, p53, and SUMO-1 in N2a cells respectively transfected with vector, p53 WT, and p53 K386R plasmids. Data are expressed as means ± SEM. n = 3 per group. *p < 0.05, ***p < 0.001.

Then, we utilized N2a cells to establish an in vitro model. The p53 WT plasmids or p53 K386R plasmids were transfected in N2a cells. The SUMOylation of p53 was assessed through Co-immunoprecipitation. Results indicated an increase in p53 SUMOylation in cells transfected with p53 WT plasmids compared to those transfected with vector plasmids. Conversely, a significant reduction in p53 SUMOylation was observed in cells transfected with p53 K386R plasmids (Figure 1(e) and (f)). p53 expression was increased in cells transfected with p53 WT or p53 K386R plasmids, while the levels of SUMO1 remained consistent (Figure 1(e), (g) and (h)). These findings demonstrated that the p53 WT enhances p53 SUMOylation in vitro.

p53 SUMOylation involved in neuronal activity and downregulated ngb

To investigate the downstream effects of p53 SUMOylation, we performed RNA-seq on brain tissue from APP/S1 mice injected with AAV-Vector, AAV-p53 WT, and AAV-p53 K386R. Differentially expressed genes (DEGs) were identified by comparing APP/PS1 mice injected with AAV-p53 WT, AAV-Vector or AAV-p53 K386R (Figure 2(a) and (b)). We identified 528 genes regulated by p53 SUMOylation in the hippocampus of APP/PS1 mice, including ngb (Figure 2(c)). Previous studies have demonstrated that overexpression of ngb plays a crucial role in promoting neurogenesis. Ngb is known to maintain the function of neural progenitor cells, promote neurite growth, mitigate Aβ toxicity, and reduce tau phosphorylation in AD, potentially contributing to neurogenesis via the Wnt signaling pathway.^26,27 Furthermore, KEGG pathway enrichment analysis of the 528 genes revealed significant enrichment in pathways related to neuronal activity, such as axon guidance and GABAergic synapse (Figure 2(d)). These findings suggested that p53 SUMOylation was involved in mediating neuronal activity by regulating downstream targets, including the ngb gene.

Figure 2.

p53 SUMOylation involved in neuronal activity through regulating ngb. (a) The DEGs in APP/PS1 mice injected with AAV-vector or AAV-p53 WT. (b) The DEGs in APP/PS1 mice injected with AAV-p53 WT or AAV-p53 K386R. (c) The Venn chart of the DEGs by comparing APP/PS1 mice injected with AAV-p53 WT versus APP/PS1 mice injected with AAV-vector and APP/PS1 mice injected with AAV-p53 K386R versus APP/PS1 mice injected with AAV-p53 WT. (d) KEGG pathway of the DEGs.

p53 SUMOylation downregulated ngb expression

To confirm the involvement of p53 SUMOylation in neurogenesis defects via the regulation of ngb, we analyzed the ngb expression in both in vivo and in vitro models. Quantitative PCR (qPCR) was employed to assess ngb mRNA levels in APP/PS1 mice injected with AAV-vector, AAV-p53 WT or AAV-p53 K386R. The qPCR results revealed a significant reduction in ngb mRNA levels in mice overexpressing p53 WT compared with the vector group, but not in the p53 K386R group, which was consistent with the RNA-seq results (Figure 3(a)). To further explore the ngb expression, Immunofluorescence was utilized to assess ngb expression in APP/PS1 mice. The analysis demonstrated a marked reduction in the number of ngb positive cells in the DG region of APP/PS1 mice injected with AAV-p53 WT compared to AAV-vector and AAV-p53 K386R injected group (Figure 3(b) and (c)). Collectively, these findings indicated that p53 SUMOylation downregulates ngb expression in APP/PS1 mice.

Figure 3.

p53 SUMOylation downregulated ngb in vivo and in vitro. (a) Quantitative analysis for the mRNA level of ngb in APP/PS1 mice respectively injected with AAV-vector, AAV-p53 WT, AAV-p53 K386R. (b) Immunofluorescence and (c) quantitative analysis for the protein level of ngb in APP/PS1 mice respectively injected with AAV-vector, AAV-p53 WT, AAV-p53 K386R. (d) Quantitative analysis for the mRNA level of ngb in N2a cells respectively transfected with plasmids contained vector, p53 WT, p53 K386R. (e) Western blot and (f–g) quantitative analysis for ngb and p53 in N2a cells transfected with plasmids contained vector, p53 WT, p53 K386R. Data are expressed as means ± SEM. n = 3 per group (a, d–g), n = 4 per group (b–c). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

We also assessed the expression levels of ngb in N2a cells using qPCR and western blot analyses. The qPCR results demonstrated a reduction in ngb mRNA levels in cells transfected with p53 WT plasmids compared with vector plasmids, but not in cells transfected with p53 K386R plasmids (Figure 3(d)). To further evaluate the protein expression of ngb, western blot analysis was conducted, and the results corroborated the qPCR findings. We observed that the protein levels of ngb was reduced in the p53 WT transfected group, but not in the vector and p53 K386R group (Figure 3(e)–(g)). Together, these findings indicated that ngb expression is regulated by p53 SUMOylation in N2a cells.

p53 SUMOylation caused neuron reduction in APP/PS1 mice

We investigated neurons changes in the DG region in APP/PS1 mice injected with AAV-vector, AAV-p53 WT or AAV-p53 K386R using Immunofluorescence. Neurons in the hippocampus were labeled with the NeuN antibody. The number of NeuN positive cells had a reduced tendency in the DG region of APP/PS1 mice injected with AAV-p53 WT compared to those injected with AAV-vector. Notably, the number of NeuN positive cells was significantly increased in mice injected with AAV-p53 K386R compared to those injected with AAV-p53 WT (Figure 4(a) and (b)). These findings suggested that neuron reduction was mediated by p53 SUMOylation, which can lead to a reduction in NeuN positive neurons.

Figure 4.

p53 SUMOylation decreased the number of NeuN positive cells. (a) Immunofluorescence and (b) quantitative analysis for the number of NeuN positive cells in APP/PS1 mice respectively injected with AAV-vector, AAV-p53, AAV-p53 K386R viruses. Data were expressed as means ± SEM. n = 4 per group. *p < 0.05, **p < 0.01.

p53 SUMOylation caused neurogenesis defects

Neurogenesis is defined as process by which functional neurons are generated from precursor cells. In adult brains, neurogenesis can occur under pathogenic conditions, and disruptions in this process may contribute to the development of neurodegenerative diseases.²⁶ Our research demonstrated that SUMOylated p53 had the capacity to reduce ngb expression that associated with neurogenesis. Then, we investigated the number of newborn neurons in APP/PS1 mice. We employed antibodies against doublecortin (Dcx) and Ki-67 to identify newborn neurons. Immunofluorescence analysis revealed a reduction in Ki-67 positive cells in mice injected with AAV-p53 WT compared to AAV-vector, whereas mice with AAV-p53 K386R injection exhibited increase levels of Ki-67 positive cells compared to AAV-P53 WT (Figure 5(a) and (b)). The similar results were observed in Dcx staining (Figure 5(c) and (d)). Collectively, these findings indicated that SUMOylation of p53 can decrease the number of newborn neurons. Overall, the data suggested that p53 SUMOylation may lead to neurogenesis defects, potentially through the downregulation of ngb.

Figure 5.

p53 SUMOylation decreased the number of Dcx and Ki-67 positive cells. (a) Immunofluorescence and (b) quantitative analysis for the number of Dcx positive cells in APP/PS1 mice respectively injected with AAV-vector, AAV-p53 WT, AAV-p53 K386R. (c) Immunofluorescence and (d) quantitative analysis for the number of Ki-67 positive cells in APP/PS1 mice respectively injected with AAV-vector, AAV-p53 WT, AAV-p53 K386R. Data are expressed as means ± SEM. n = 4 per group. **p < 0.01, ***p < 0.001, ****p < 0.0001.

Discussion

This study investigated the SUMOylation effect of p53 in APP/PS1 mice and N2a cells. Furthermore, the SUMOylation of p53 was found to significantly decrease the levels of ngb, thereby exacerbating neurogenesis defects. Our findings indicated that the SUMOylation of p53 can result in neurogenesis defects both in vivo and in vitro. Moreover, this research suggested that p53 SUMOylation may serve as potential therapeutic targets in AD, which downregulated ngb.

In this work, we only explained SUMOylation of p53 could downregulate the level of ngb but did not investigate the molecular mechanism behind. Some studies have shown that SUMOylation of p53 can accelerate the export of p53 from nuclear, while ngb is mainly located in the cytoplasm.^28,29 Therefore, SUMOylation of p53 may downregulate the level of ngb by promoting the export of p53 from nuclear. Furthermore, SUMOylation of p53 has been reported that can suppress target gene transcription through inhibiting p53 binding to DNA and chromatin, so SUMOylation of p53 may play a role in inhibiting the transcription of ngb through this way.³⁰ SUMOylation of p53 can also recruit transcriptional corepressors inhibiting the transcription of downstream genes.³¹ Our study linked the SUMOylation of p53 with neurogenesis by relating ngb, suggesting that the SUMOylation of p53 may act as the upstream signal of ngb to downregulate its expression.

Whether neurogenesis occurs in the adult brains is a controversy. Research by Eriksson showed that there are neonatal neurons in the DG of adults.³² However, the other research suggested that there are many neonatal neurons in the newborn hippocampal, but the number of neonatal neurons decreases dramatically with age, and in the adult hippocampus there is already no new neurons are produced in the adult hippocampus.³³ But then Maria revealed that neonatal neurons are still present in the adult brains after analyzing human tissues.³⁴ Subsequent single-cell nuclear RNA-seq revealed that adult hippocampus had not undergone neurogenesis.³⁵ The generation of these different results may be related to the level of technology such as the means of detection and the method of sample preservation. Opinions still remain divided about the possibility of neurogenesis in the adult brains.

Ngb has been shown to participate in neuroprotection and to promote axonal regeneration.^36,37 It has been reported that ngb is overexpressed in human arteriovenous malformation and intracerebral hemorrhage which may help to constrain brain injury.³⁸ In our study, we explained that SUMOylation of p53 downregulated ngb and caused neurogenesis defects but not verified the ability of ngb in neurogenesis. Research by Yu Z reported that pro-neurogenesis effect promoted by ngb overexpression might be mediated through Wnt signaling.²⁶ Since neurogenesis is a complex process, other pathways are also needed to be further investigate in the future. In addition, ngb may not be the only protein effected by SUMOylation of p53, so the effect of SUMOylated p53 on other proteins in AD can be further studied.

Studying PTMs of proteins is challenging since they occur only in a small portion of cells and have low levels. Furthermore, the research of PTMs in p53 is complex because PTMs behave differently in response to various cell types and the function of p53 depends on the cascade reactions of many PTMs. Therefore, further research is required to determine how PTMs of p53 act on target proteins and how the network formed by these PTMs acts in the process of disease. Our data indicate that SUMOylation of p53 may play a role as upstream signal of ngb in AD. Moreover, it also caused neurogenesis defects observed in APP/PS1 mice and N2a cells.

In summary, the present study suggests that p53 SUMOylation may promote neurogenesis defects through downregulating ngb and be related to neuronal activity in AD. Given that ngb deficiency exert neuropathological events in AD, blockage of p53 SUMOylation may provide a potential strategy for AD treatments.

Footnotes

Acknowledgments

The authors are grateful to Mr Dan Ke and Ms. Qun Wang for helpful technical suggestions during the conduct of this study.

ORCID iD

Xiaochuan Wang

Ethical considerations

No humans were used in this research. All animal experiments were approved by the Animal Care and Use Committee of Huazhong University of Science and Technology, and performed in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Author contributions

Anqi Yin: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Validation, Writing – original draft. Yuran Gui: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Writing – original draft. Lu Wan: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Writing – original draft. Qinfeng Cai: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Writing – original draft. Yong Luo: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Writing – original draft. Jian-Zhi: Wang Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision, Writing – review & editing. Rong Liu: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision, Writing – review & editing. Chenjiang Ying: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision, Writing – review & editing. Xiaochuan Wang: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Supervision, Writing – review & editing. Fumin Yang: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Supervision, Writing – review & editing.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported in parts by grants from National Natural Science Foundation of China (82330041).

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data availability

The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

References

Bloom

. Amyloid-β and tau: the trigger and bullet in Alzheimer disease pathogenesis. JAMA Neurol 2014; 71: 505–508.

McMillan

Brown

Henley

, et al. Profiles of SUMO and ubiquitin conjugation in an Alzheimer's disease model. Neurosci Lett 2011; 502: 201–208.

Qin

Bao

, et al. SET SUMOylation promotes its cytoplasmic retention and induces tau pathology and cognitive impairments. Acta Neuropathol Commun 2019; 7: 21.

Hay

. SUMO: a history of modification. Mol Cell 2005; 18: 1–12.

Johnson

. Protein modification by SUMO. Annu Rev Biochem 2004; 73: 355–382.

Zhang

Tang

, et al. The strategies for identification and quantification of SUMOylation. Chem Commun (Camb) 2017; 53: 6989–6998.

Gostissa

Hengstermann

Fogal

, et al. Activation of p53 by conjugation to the ubiquitin-like protein SUMO-1. EMBO J 1999; 18: 6462–6471.

Stehmeier

Muller

. Regulation of p53 family members by the ubiquitin-like SUMO system. DNA Repair (Amst) 2009; 8: 491–498.

Luo

Xia

Shu

, et al. SUMOylation at K340 inhibits tau degradation through deregulating its phosphorylation and ubiquitination. Proc Natl Acad Sci U S A 2014; 111: 16586–16591.

10.

Bao

Qin

Mahaman

YAR

, et al. BACE1 SUMOylation increases its stability and escalates the protease activity in Alzheimer's disease. Proc Natl Acad Sci U S A 2018; 115: 3954–3959.

11.

Rodriguez

Desterro

Lain

, et al. SUMO-1 modification activates the transcriptional response of p53. EMBO J 1999; 18: 6455–6461.

12.

Lakin

Jackson

. Regulation of p53 in response to DNA damage. Oncogene 1999; 18: 7644–7655.

13.

Arakawa

. P53, apoptosis and axon-guidance molecules. Cell Death Differ 2005; 12: 1057–1065.

14.

Maślińska

Laure-Kamionowska

Szukiewicz

, et al. Commitment of protein p53 and amyloid-beta peptide (aβ) in aging of human cerebellum. Folia Neuropathol 2017; 55: 161–167.

15.

Farmer

Ghag

Puangmalai

, et al. P53 aggregation, interactions with tau, and impaired DNA damage response in Alzheimer's disease. Acta Neuropathol Commun 2020; 8: 132.

16.

Melchior

Hengst

. SUMO-1 and p53. Cell Cycle 2002; 1: 245–249.

17.

Chen

Liu

Chen

, et al. P53 SUMOylation mediates AOPP-induced endothelial senescence and apoptosis evasion. Front Cardiovasc Med 2021; 8: 795747.

18.

Wan

Yang

Yin

, et al. Age-related p53 SUMOylation accelerates senescence and tau pathology in Alzheimer's disease. Cell Death Differ. Epub ahead of print 28 January 2025. DOI: https://doi.org/10.1038/s41418-025-01448-0.

19.

Dietz

. Protection by neuroglobin and cell-penetrating peptide-mediated delivery in vivo: a decade of research. Comment on Cai et al: TAT-mediated delivery of neuroglobin protects against focal cerebral ischemia in mice. Exp Neurol. 2011; 227(1): 224–31. Exp Neurol 2011; 231: 1–10.

20.

Liu

Xun

, et al. Amyloid-β25-35 upregulates endogenous neuroprotectant neuroglobin via NFκB activation in vitro. J Alzheimers Dis 2018; 64: 1163–1174.

21.

Xie

Yang

. Brain globins in physiology and pathology. Med Gas Res 2016; 6: 154–163.

22.

Khan

Mao

Banwait

, et al. Neuroglobin attenuates beta-amyloid neurotoxicity in vitro and transgenic Alzheimer phenotype in vivo. Proc Natl Acad Sci U S A 2007; 104: 19114–19119.

23.

Szymanski

Wang

Fallin

, et al. Neuroglobin and Alzheimer's dementia: genetic association and gene expression changes. Neurobiol Aging 2010; 31: 1835–1842.

24.

Chen

Xiong

Kong

, et al. Neuroglobin attenuates Alzheimer-like tau hyperphosphorylation by activating Akt signaling. J Neurochem 2012; 120: 157–164.

25.

Dai

Sun

, et al. Neuroglobin attenuates beta amyloid-induced apoptosis through inhibiting caspases activity by activating PI3K/Akt signaling pathway. J Mol Neurosci 2016; 58: 28–38.

26.

Cheng

Liu

, et al. Neuroglobin promotes neurogenesis through Wnt signaling pathway. Cell Death Dis 2018; 9: 945.

27.

Haines

Mao

Xie

, et al. Neuroglobin expression in neurogenesis. Neurosci Lett 2013; 549: 3–6.

28.

Carter

Bischof

Dejean

, et al. C-terminal modifications regulate MDM2 dissociation and nuclear export of p53. Nat Cell Biol 2007; 9: 428–435.

29.

Chen

Liu

Tao

. Regulating tumor suppressor genes: post-translational modifications. Signal Transduct Target Ther 2020; 5: 90.

30.

Chiang

. Crosstalk between sumoylation and acetylation regulates p53-dependent chromatin transcription and DNA binding. EMBO J 2009; 28: 1246–1259.

31.

Chiang

. P53 sumoylation: mechanistic insights from reconstitution studies. Epigenetics 2009; 4: 445–451.

32.

Eriksson

Perfilieva

Björk-Eriksson

, et al. Neurogenesis in the adult human hippocampus. Nat Med 1998; 4: 1313–1317.

33.

Sorrells

Paredes

Cebrian-Silla

, et al. Human hippocampal neurogenesis drops sharply in children to undetectable levels in adults. Nature 2018; 555: 377–381.

34.

Moreno-Jiménez

Flor-García

Terreros-Roncal

, et al. Adult hippocampal neurogenesis is abundant in neurologically healthy subjects and drops sharply in patients with Alzheimer's disease. Nat Med 2019; 25: 554–560.

35.

Franjic

Skarica

, et al. Transcriptomic taxonomy and neurogenic trajectories of adult human, macaque, and pig hippocampal and entorhinal cells. Neuron 2022; 110: 452–469.e414.

36.

Garry

Mammen

. Neuroprotection and the role of neuroglobin. Lancet 2003; 362: 342–343.

37.

Xiong

Pan

Chen

, et al. Neuroglobin boosts axon regeneration during ischemic reperfusion via p38 binding and activation depending on oxygen signal. Cell Death Dis 2018; 9: 163.

38.

Jin

Mao

Xie

, et al. Neuroglobin expression in human arteriovenous malformation and intracerebral hemorrhage. Acta Neurochir Suppl 2011; 111: 315–319.