Early branched-chain amino acid reduction delays the onset of cognitive decline in a mouse model of Alzheimer's disease

Abstract

Background

Many Alzheimer's disease (AD) treatments focus on a single variable of AD that have yet demonstrated clinically meaningful and perceived benefits by the patients. We recently showed that lowering plasma branched-chain amino acids (BCAAs) can deliver multiple pro-neuronal effects in APP/PS1 and 5xFAD mouse models.

Objective

The main aim was to determine the optimal point in time for the disease-modifying effects of BCAA reduction during AD development.

Methods

12-month-old, cognitively impaired male WT and APP/PS1 mice were injected with either vehicle or BCAA-lowering compound BT2 (40 mg/kg/day ip) for 30 days. To test if early BT2 during AD progression would have long-lasting beneficial effects, 2-month-old, cognitively intact male 5xFAD mice were treated with BT2 after which they were left alone for a month.

Results

Plasma BCAAs were reduced in BT2-treated APP/PS1 mice. Despite Aβ₄₂ reduction, BT2 did not modify proteins or genes related to AD-related pathology, dendritic density and neurotransmitters in the cortex and hippocampus, or alleviate cognitive deficit. In another experiment, BT2-treated 5xFAD mice had lower plasma BCAAs. Importantly, early BT2, even after treatment cessation for a month, was able to effectively delay cognitive impairment which was associated with a complete restoration of cortical neurotransmitters. These results were observed without any changes in pathology markers in the brain.

Conclusions

Our findings suggest that BT2-induced BCAA reduction is a novel strategy to delay AD progression possibly through enhanced neurotransmission. The efficacy is time-dependent such that treating with BT2 before the onset of AD can successfully rescue cognitive function.

Keywords

Alzheimer's disease APP/PS1 BT2 glycemic control neurotransmitters 5xFAD

Introduction

The prevalence of dementia is on the rise. Individuals diagnosed with Alzheimer's disease (AD), in particular, exceeds six million in the US alone with limited treatment options.¹ While recent FDA approval of amyloid-clearing antibody medications is encouraging, their efficacy in reducing cognitive decline is modest with serious side effects such as brain swelling and hemorrhage.^2,3 Due to the complex pathogenesis of this neurodegenerative disease, therapeutic strategies aimed at not just amyloid or tau proteins, but at multiple other pathological targets simultaneously would greatly improve the likelihood of alleviating AD development.

One metabolic feature implicated in the pathogenesis of AD is branched-chain amino acids (BCAAs).^4–6 Studies suggest that plasma BCAA levels are positively and causally associated with obesity and Type 2 diabetes (T2D),^7–11 two strong risk factors for AD. Different therapeutic strategies to lower circulating BCAAs, either through nutritionally or pharmacologically, are currently being investigated. 3,6-dichlorobenzo[b]thiophene-2-carboxylic acid, or BT2, is a small molecule that works as an allosteric inhibitor of BCKDH kinase.¹² Because this enzyme suppresses branched-chain α-ketoacid dehydrogenase (BCKDH), the rate-limiting enzyme in BCAA catabolic pathway, by inhibiting the kinase, BT2 allows for over-activation of BCKDH and efficient BCAA breakdown resulting in lower circulating BCAAs. To date, a growing number of preclinical studies have provided very promising results on the effects of BT2 in alleviating several disease conditions (i.e., insulin resistance, heart failure, ulcerative colitis) that are characterized by defective BCAA catabolism and high plasma BCAAs.^13–15

We recently demonstrated that plasma BCAAs are also higher in individuals with AD and in three transgenic mouse models of AD (APP_Swe, APP/PS1, 5xFAD).¹⁶ By lowering plasma BCAA levels, BT2 administration in cognitively intact 5xFAD mice substantially improved glycemia and brain neurotransmitters and reduced brain pathology markers, similar to the observations following BCAA restriction diet in APP/PS1 mice, thereby supporting the utility of BT2 in alleviating AD progression. However, whether these effects of BT2 can lead to delayed cognitive deficit is unclear. Its potential effects in ameliorating the disease in the late stage with cognitive impairment also deserve investigation as a novel, effective treatment strategy.

To address these knowledge gaps, in this study, a series of experiments were conducted in AD transgenic mouse models in which the effects of BT2 treatment on peripheral/brain pathological traits and cognitive function at a late disease state (i.e., presence of cognitive deficit) are assessed first, followed by examination of BT2 effects at an early stage of AD without cognitive impairment. To test if BT2 provides any long-lasting positive effects, young, cognitively intact 5xFAD mice were exposed to BT2 followed by treatment cessation for one month at which naïve 5xFAD mice start to manifest impaired cognition.

Methods

Animals

We used two popular AD transgenic mouse models in this study: APP/PS1 (B6;C3-Tg(APP_Swe,PSEN1dE9)85Dbo/Mmjax; The Jackson Laboratory; Stock #34829) and 5xFAD (B6SJL-Tg(APPSwFlLon,PSEN1*M146L*L286 V)6799Vas/Mmjax; The Jackson Laboratory; Stock #34840). We specifically used them here because in our previous study,¹⁶ we observed similar outcomes from apparently two genetically different models following BCAA-lowering approaches, thereby allowing us to conclude that these two widely used AD models respond similarly to BCAA modulation. APP/PS1 mice are double-transgenic mice that overexpress chimeric mouse/human APP and mutant human presenilin 1 (PS1), both directed to CNS neurons. Aβ plaque deposition in the brain is reported to develop around six months of age, with abundant plaques spreading to the cortex and hippocampus by nine months of age.^17–19 Cognitive impairment is observed typically at the age of twelve months or later.^16,20,21 5xFAD mice overexpress APP with the Swedish (K670N, M671L), Florida (I716 V), and London (V717I) mutations and PS1 containing two mutations (M146L and L286 V). 5xFAD mice are known to accumulate Aβ plaques starting at 1.5 months of age and cognitive impairment is typically observed at around four months of age.^22–24 Tau aggregates are not observed until around 7–8 months in males and 5–6 months in females detected by thioflavin S (ThS) staining.²⁵ Males were used here since our previous study¹⁶ tested and confirmed the beneficial effects of BT2 in male mice. Age-matched male wildtype (WT) littermates were used as controls. All mice were fed a standard chow diet (22% protein, 63% carbohydrate, and 15% fat; Advanced Protocol PicoLab Select Rodent 50 IF/6F; Cat# 5V5R) and water ad libitum. All mice were housed at Texas Tech University animal facility room with a temperature of 23 ± 2°C and 12:12 h light/dark cycle. Experiments in this study were conducted in accordance with the National Institutes of Health's Guide for the Care and Use of Laboratory Animals, and the protocol was approved by the Institutional Animal Care and Use Committee (IACUC) at Texas Tech University.

Experiment 1: BT2 after the onset of cognitive deficit

12-month-old WT or APP/PS1 male mice on a normal chow diet were separated into four groups: WT vehicle (n = 6), WT BT2 (n = 6), APP/PS1 vehicle (n = 7), and APP/PS1 BT2 (n = 7). Behavioral test (Y-maze) at baseline was performed to confirm cognitive impairment two days before measuring blood glucose, plasma BCAAs, and insulin from tail blood after 2.5 h fasting. Animals were injected intraperitoneally (ip) with either vehicle or BT2 (40 mg/kg) daily in the morning for 30 consecutive days. The dose and duration of BT2 are based on what we previously found to be effective in lowering plasma BCAAs and alleviating the brain pathology in 5xFAD mice,¹⁶ as well as from others’ studies that demonstrated significant reduction in plasma BCAAs in mouse models for diabetes and heart failure.^{12–14,26,27} BT2 (Millpore Sigma Cat# 34576-94-8) was dissolved in DMSO, then diluted to a final concentration of 5% DMSO, 10% Cremophor EL, and 85% 0.1 M sodium bicarbonate at pH 9. Vehicle was made of the same components without BT2. Daily body weight and weekly food intake were monitored throughout the treatment duration. After 30 days of treatment, Y-maze was conducted and animals were euthanized using isoflurane overdose followed by cervical dislocation. Tail blood was collected after 2.5 h fasting before mice were euthanized. Fasting blood glucose was measured using a hand-held glucometer (AlphaTRAK2). Brain was harvested fresh and the neocortex and hippocampus were dissected quickly in ice-cold PBS using a sterile blade and forceps, then snap-frozen in liquid nitrogen and stored at −80°C for protein, gene, and neurotransmitter analyses. Other tissues including liver were harvested as well during sacrifice and frozen in liquid nitrogen.

Experiment 2: BT2 before the onset of cognitive deficit

6-week-old WT or 5xFAD male mice under a normal chow diet were separated into four groups: WT vehicle (n = 7), WT BT2 (n = 7), 5xFAD vehicle (n = 7), and 5xFAD BT2 (n = 7). Mice underwent Y-maze test at baseline to ensure intact cognition/memory as expected. 2.5 h fasting blood glucose, plasma BCAAs, and insulin were measured two days after. Then, animals were injected with either vehicle or BT2 (40 mg/kg ip) daily between 9–10 am for 30 consecutive days. Daily body weight and weekly food intake were recorded during the treatment period. After 30 days of injection, animals were aged until four months of age when cognitive impairment is expected, and Y-maze test was performed. During this time no treatment was administered. After the behavioral testing, fasting blood was collected from the tail. All animals were euthanized using isoflurane overdose followed by cervical dislocation. Fasting blood glucose was measured using a hand-held glucometer (AlphaTRAK2), and blood from cardiac puncture was collected in EDTA tubes under anesthesia to isolate plasma. Brain was harvested fresh and the neocortex and hippocampus were dissected quickly in ice-cold PBS using a sterile blade and forceps, then snap-frozen in liquid nitrogen and stored at −80°C. Other tissues were also collected during euthanasia and stored in −80°C.

Plasma BCAA measurement

For plasma separation, blood samples collected before and after BT2 treatment were centrifuged at 2000 rpm (∼360 g) for 10 min at 4°C. 10 µL of plasma per sample was used in performing BCAA assay, a spectrophotometric assay that measures NADH generated from BCAA oxidation.²⁸ Leucine standards were prepared by adding leucine into double-distilled water at a concentration of 100, 200, 400, 600, 800, 1000, and 2000 µM. For every leucine standard and plasma sample (10 µL each per well in 96-well plate), 270 µL of BCAA buffer was added to each well with the buffer pH kept between 10.5 and 10.7. Fresh NAD solution was prepared each time and 10 µL was added to standards and sample wells. Absorbance was then taken at 340 nm for background reading. For reaction, 10 µL of leucine dehydrogenase was added to each well and incubated in the dark for 30 min before absorbance was read again at 340 nm. The standard curve was generated by subtracting the first baseline absorbance reading from the second reaction reading and BCAA concentration for each sample was calculated accordingly in µM.

Insulin ELISA

Plasma insulin at baseline and post-BT2 treatment was measured using Mouse Insulin ELISA kit (Mercodia, Cat# 10-1247-01) based on highly specific monoclonal antibodies with insignificant or no cross-reactivity to C-peptide or pro-insulin. For plasma isolation, blood was collected in EDTA-coated microvette tubes with a protease inhibitor cocktail added. Microvette tubes were centrifuged at 4°C and plasma was collected and stored at −80°C before analysis. Insulin ELISA was performed following the manufacturer's instructions on the kit manual. The detection limit of insulin is ≤ 0.2 ng/mL.

Western blots

Isolated neocortex of the brain was homogenized in RIPA lysis buffer (Cell Signaling, Cat# 9806) with an EDTA-free protease inhibitor. Tissues were homogenized by Tissue Lyser LT (Qiagen, Cat# 85600) at 50 oscillations per second for 5 min and placed on a rocker at 4°C for 40 min followed by a two-step centrifugation at 4°C for 5 min at 2500 rpm (∼560 g) then for 15 min at 14,000 rpm (∼17,500 g). The protein supernatant was then collected in a 1.5 mL tube and protein concentration was measured via BCA Protein Assay Kit (Thermo Scientific, Cat# 23225). Protein concentrations were adjusted accordingly to load 30 µg of protein per well in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; BioRad, Cat# 3450125). After electrophoretic transfer to elute proteins from the gel onto a PVDF membrane, the membrane was blocked with TBST buffer containing 5% BSA for 1 h at room temperature. It was then washed with TBST and incubated overnight at 4°C in the primary antibody solution (1:1000 dilution) containing 1% BSA and 0.1% sodium azide for pGSK-3α/β (Cell Signaling, Cat# 9331S), GSK-3α/β (Cell Signaling, Cat# 5676S), pTau Ser202 (Abcam, Cat# ab108387), Tau (Cell Signaling, Cat# 30328), IDE (Invitrogen, Waltham, MA, USA, Cat# PA5-29349), F4/80 (Cell Signaling, Cat# 70076S), GFAP (Cell Signaling, Cat# 12389S), Neprilysin (Cell Signaling, Cat# 65534S), Synaptophysin (Cell Signaling, Cat# 5461S), PSD95 (Cell Signaling, Cat # 2507S), GAPDH (Cell Signaling, Cat# 2118S), and Vinculin (Cell Signaling, Cat# 13901S). Next day, the membrane was washed with TBST three times for 10 min each, incubated with an anti-rabbit HRP-conjugated secondary antibody (1:4000 dilution; Cell Signaling, Cat# 7074) in TBST containing 1% non-fat milk for 1 h at room temperature. After washing, ECL reagents were added in a 1:1 ratio to the membrane 4 min before visualization of bands through ChemiDoc Imaging System – Bio-Rad. Some immunoblots (not for probing phosphorylated state) were covered and stored in TBST at 4°C and re-probed for other proteins after washing with stripping buffer (Cell Signaling, Cat# 91925) for 45 min to efficiently remove primary and secondary antibodies from the immunoblot without damaging the immobilized antigen. pGSK3β and pTau were normalized to total GSK3β and total tau protein, respectively. Synaptophysin and PSD95 were normalized to a housekeeping protein, vinculin. Other proteins were normalized to GAPDH. ImageJ software was used to quantify protein bands for analysis.

Real-time quantitative PCR (RT-qPCR)

RNA was extracted from hippocampal tissue using RNeasy^® Plus Universal Mini Kit (Qiagen, Cat# 73404). cDNA was synthesized using the iScript^TM Reverse Transcription Supermix (Bio-Rad, Cat# 1708841) and diluted to 5 ng/µL with nuclease-free water and stored at −20°C. cDNA was then amplified in a Bio-Rad CFX RT-PCR detection system using a mastermix composed of 10 µL SYBR green, 0.9 µL forward and reverse primer each (450 nM final concentration), 3.2 µL nuclease free water, and 5 µL cDNA per well using a 96-well PCR plate. The relative mRNA expression was determined using the ΔΔCt method, using beta-2 microglobulin (B2 M) gene as a reference gene. Primers used in this study are listed in Table 1.

Table 1.

Primer sequences for genes used in RT-qPCR.

Gene Name		Primer Sequence (5’-3’)
PERK	Forward	ACGGTTACTACTTGCCATACTAC
PERK	Reverse	CCTTCTTGCGGATGTTCTTG
TNFα	Forward	ACCACCATCAAGGACTCAA
TNFα	Reverse	AAGGTCTGAAGGTAGGAAGG
NF-κβ	Forward	GAAATTCCTGATCCAGACAAAAAC
NF-κβ	Reverse	ATCACTTCAATGGCCTCTGTGTAG
IL-6	Forward	ACAGAAGGAGTGGCTAAG
IL-6	Reverse	AGAGAACAACATAAGTCAGATAC
BACE1	Forward	CCTATGCGATGCGAATGTT
BACE1	Reverse	TCTCCTTCCTGTCTCTATCCTAT
Beclin 1	Forward	ACCAGCGGGAGTATAGTGAGT
Beclin 1	Reverse	CAGCTGGATCTGGGCGTAG
IRE1-α	Forward	GTGACTGGTTGGAGAAGGA
IRE1-α	Reverse	GGCTGAGATGTGCTTGTG
OPA1	Forward	ACCTTGCCAGTTTAGCTCCC
OPA1	Reverse	TTGGGACCTGCAGTGAAGAA
IL-1β	Forward	TGCCACCTTTTGACAGTGATG
IL-1β	Reverse	ATGTGCTGCTGCGAGATTTG
B2M	Forward	GAAGCCGAACATACTGAACTG
B2M	Reverse	CTGAAGGACATATCTGACATCTCT

Aβ₄₂ measurement

Recombinant human Aβ₄₂ in the cortex of APP/PS1, 5xFAD, and their WT littermates was measured after vehicle or BT2 treatment using a commercially available ELISA kit (Invitrogen, Cat# KHB3442). This is a solid-phase sandwich ELISA with the assay sensitivity at 15.6 pg/ml. According to the manufacturer's instruction, proteins were first extracted with the lysis buffer solution containing guanidine hydrochloride before running the assay. The results are normalized to total protein amount in µg. Due to guanidine hydrochloride being a strong denaturant which effectively disrupts hydrogen bonding and hydrophobic interactions holding the amyloid fibrils and oligomers together, the tissue-lysing process leads to a complete solubilization. Thus, what we measured includes both original soluble and insoluble form of Aβ₄₂ from the mouse brains.

Brain monoamine quantification

Micropunches of the hippocampus were collected from brain sections and subjected to the analysis of neurotransmitters and their metabolites—norepinephrine (NE), dopamine (DA), DOPAC (dopamine metabolite), serotonin (5-HT), and 5-HIAA (serotonin metabolite)—as previously described.¹⁶ Briefly, samples were homogenized in 200 µL of 0.05 M HClO₄ and an aliquot was used to quantify protein concentrations while the remaining lysate was centrifuged to obtain clear homogenates. 15 µL was used for High Performance Liquid Chromatography (HPLC) with electrochemical detection (Shimadzu Prominence UFLC). 0.05 M DHBA was used as the internal standard. Chromatograms were analyzed using Class-VP software Version 7.4-SP3. Concentration of monoamine neurotransmitters and their metabolites were normalized by the protein concentration of a sample and was expressed as pg/µg protein.

Hippocampal dendritic density

To visualize potential BT2-induced changes in the neuronal morphology and dendrites in the hippocampus of APP/PS1 mice, Golgi-Cox staining was performed using the FD Rapid GolgiStain Kit (FD NeuroTechnologies, Cat# PK401). During sacrifice, whole mouse brains were carefully harvested and washed with double-distilled water to remove excess blood after which the brains were immersed in the impregnation solution in the dark for 14 days. Then, the brains were transferred into Solution C for overnight followed by serial coronal sections of 100 µm by cryostat that would contain the dorsal hippocampus (between bregma −1.34 mm and −2.54 mm). Every first section of each series of two sections was mounted on gelatin-coated slides. The sections were stained in solutions D & E, dehydrated in ethanol and cleared in xylenes before cover-slipping. The dendritic density in the hippocampus was imaged using AMG EVOS microscope (Thermo Fisher Scientific, Waltham, MA, USA) or an Olympus IX83 (Olympus Corporation, Tokyo, Japan).

Spatial memory test

Y-maze comprising three symmetrical arms (A, B, C; 120° angle between arms) was conducted in mice to assess their short-term spatial memory. Mice were acclimated to the procedure room for 1 h prior to testing. Each mouse was placed in arm A of the Y-maze facing the center and allowed to explore freely for two minutes. ANY-maze video tracking software was programed to compute percent spontaneous alternation and other relevant parameters including mean speed, freezing time, and total distance traveled in the maze which can used to explain if the animal's performance may be influenced by motor impairment or anxiety-like behavior. Arm entries were recorded when the center point of the animal's body entered the arm, all four paws had crossed the threshold of the central zone into the arm, and the nose was pointed toward the end of the arm being entered. The maze was cleaned thoroughly between each session with 70% EtOH, water, then allowed to thoroughly dry to reduce any residual scents from the previous trial. Percent spontaneous alternation was calculated as follows:

S p o n t a n e o u s a l t e r n a t i o n % = \frac{# o f s p o n t a n e o u s a l t e r n a t i o n s}{t o t a l n u m b e r o f a r m e n t r i e s - 2} \times 100

Statistics

Based on our previous experience using both APP/PS1 and 5xFAD mouse models,¹⁶ we estimated that 5–7 mice per group would be adequate to reach statistical significance between groups. Plasma BCAAs, hippocampal Aβ₄₂ levels, hippocampal mRNA abundance, cortical protein expressions, neurotransmitters, and behavioral test parameters were analyzed using two-way ANOVA followed by Tukey's post hoc test. This statistical test is appropriate for comparing four groups in our study with two independent levels (genotype as one factor and treatment as another factor). Fasting blood glucose and plasma insulin in Experiment 1 were analyzed by one-way ANOVA followed by Tukey's post hoc test. Fasting blood glucose in Experiment 2 was analyzed by two-way ANOVA followed by Tukey's post hoc test. Daily body weight and weekly food intake were analyzed by two-way Repeated Measures ANOVA followed by Tukey's post hoc test. Data are expressed as the Mean ± SEM with statistical significance between groups set at p < 0.05. GraphPad Prism version 9 was used to analyze the data.

Results

Effects of BT2 on the metabolic profile in cognitively impaired APP/PS1 mice

We recently showed that through lowering plasma BCAAs, dietary BCAA restriction in APP/PS1 mice at the early stage of AD (i.e., intact cognition) reduced blood glucose and improved neurotransmitter levels in both the cortex and hippocampus that most likely contributed to delayed cognitive impairment.¹⁶ To determine if BCAA reduction can exert pro-neuronal and memory-enhancing benefits in the late stage of AD, cognitively impaired APP/PS1 mice at 12 months old were treated with BCAA-lowering BT2 compound daily for a month (Figure 1A). The dose of BT2 (40 mg/kg) was based on our earlier study that showed its effectiveness in reducing plasma BCAAs and improving neuronal functions.¹⁶ Throughout the experiment, APP/PS1 mice tended to have higher body weight compared to WT mice, but BT2 did not have any effects in either genotype (Figure 1B). Similarly, food intake was very stable during the treatment period and there was no difference between groups (Figure 1C), indicating no measurable influence of BT2 on energy balance that may have contributed to changes in pathology or cognition. Consistent with our previous findings, plasma BCAAs were significantly elevated in APP/PS1 mice compared to WTs at baseline (Genotype, F[1,22] = 22.0, p = 0.0001; Figure 1D), but BT2-treated APP/PS1 mice had markedly lower BCAA levels compared to the respective controls (Genotype, F[1,22] = 3.46, p = 0.08; Interaction, F[1,22] = 6.98, p = 0.01; µM; 1684 ± 144 APP/PS1 Veh versus 1161 ± 110 APP/PS1 BT2, p = 0.02; Figure 1E) which was mainly due the ability of BT2 to prevent the rise of BCAAs. Interestingly, plasma insulin and blood glucose at fasting were not different between WT and APP/PS1 mice, and BT2 did not exert any effect on them (Figure 1F, G).

Figure 1.

BT2 treatment lowers plasma BCAAs in cognitively impaired APP/PS1 mice. (A) Experimental design. Baseline blood glucose and plasma BCAAs of male APP/PS1 mice and WT littermates were checked along with spatial memory function by Y-maze at 12 months of age. Then, they were injected with either vehicle or BT2 (40 mg/kg ip) daily for 30 days after which behavioral test was performed, and the brains and terminal blood samples were collected for analysis. (B) Daily body weight and (C) Weekly food intake of WT littermates and APP/PS1 mice during the experimental period. N = 7/group. Data were analyzed by two-way repeated measures ANOVA followed by Tukey's post hoc test. (D) Plasma BCAAs measured at baseline and (E) after BT2 treatment. N = 6–7/group. Data were analyzed by two-way ANOVA followed by Tukey's post hoc test. (F) Plasma insulin levels (N = 6/group) and (G) Blood glucose after BT2 (N = 5–7/group). Baseline and post-treatment blood glucose and plasma insulin within WT and APP/PS1 were pooled since there were no changes. Data were analyzed by one-way ANOVA followed by Tukey's post hoc test; Values are Mean ± SEM; * p < 0.05.

BT2 lowers cortical Aβ₄₂ without affecting brain pathology markers in cognitively impaired APP/PS1 mice

Cognitively dysfunctional APP/PS1 mice displayed a significantly higher amount of Aβ₄₂ in the cortex compared to WTs as expected, but daily injections of BT2 for one month markedly reduced its levels (Genotype, F[1,16] = 5.78, p = 0.03; Treatment, F[1,16] = 59.15, p < 0.0001; Interaction, F[1,16] = 5.39, p = 0.03; pg/ug protein; 12.1 ± 1.6 APP/PS1 Veh versus 7.3 ± 1.1 APP/PS1 BT2, p = 0.02; Figure 2A). Contrary to our expectations, this was not associated with changes in many proteins in the cortex involved in amyloid clearance and neuroinflammation (Figure 2B-H). In particular, insulin-degrading enzyme (IDE) that is known to break down amyloid peptides was lower in APP/PS1 mice compared to WTs, and BT2 was not able to reverse it (Genotype, F[1,16] = 17.6, p = 0.0007; Fold change; 1.0 ± 0.04 WT Veh versus 0.78 ± 0.04 APP/PS1 Veh, p = 0.004; 0.78 ± 0.04 APP/PS1 Veh versus 0.88 ± 0.04 APP/PS1 BT2, p = 0.29; Figure 2C). Phosphorylated Tau at Ser202 was decreased in BT2-treated APP/PS1 mice compared to the APP/PS1 controls (Genotype, F[1,16] = 5.1, p = 0.04; Treatment, F[1,16] = 10.9, p = 0.005; Fold change; 0.95 ± 0.03 APP/PS1 Veh versus 0.74 ± 0.03 APP/PS1 BT2; p = 0.03; Figure 2D), but we did not detect any BT2 effects in the expression of phosphorylated GSK3β, total GSK3β, and microglial or astrocyte activation markers such as F4/80 and GFAP (Figure 2E-H). Furthermore, there was no change in mRNA of genes related to ER stress (PERK), inflammation (NFkβ, TNF-α, IL-6, IL-1β), or amyloid synthesis (BACE1) in the hippocampus of WTs and APP/PS1 mice, as well as no clear impact of BT2 (Figure 2I).

Figure 2.

Despite reducing Aβ42 in the cortex, BT2 does not alter cortical pathology markers in APP/PS1 mice. (A) Cortical Aβ₄₂ levels measured by ELISA kit. N = 4–5/group. (B) Western blots showing cortical expression of proteins in AD-related pathology including (C) Insulin-degrading enzyme (IDE), (D) pTau Ser 202, (E) pGSKβ, (F) Total GSKβ, G) F4/80, a marker of microglial activation, (H) GFAP, a marker of astrocyte activation. pTau and pGSKβ were normalized to total Tau and GSKβ, respectively. Other proteins were normalized to GAPDH and data are expressed as fold change from WT Veh group. N = 4–5/group. (I) mRNA abundance of genes related to AD measured by RT-qPCR. N = 4–5/group. Gene expression was normalized to B2 M and data are expressed as fold change from WT Veh group. Data were analyzed by two-way ANOVA followed by Tukey's post hoc test; Values are Mean ± SEM; * p < 0.05.

BT2 does not improve dendritic density, neurotransmitters, or cognition in APP/PS1 mice with AD onset

In agreement with our findings on gene and protein expressions in the brain, Golgi-Cox staining showed substantially lower dendritic arborization in the hippocampus of APP/PS1 mice compared to that in WT mice, and BT2 failed to improve dendritic density in either genotype (Figure 3A). Our earlier study demonstrated enhanced levels of neurotransmitters (NTs)—norepinephrine (NE), dopamine (DA), serotonin (5-HT)—in both the cortex and hippocampus of APP/PS1 mice with dietary BCAA restriction initiated when they were cognitively intact.¹⁶ However, in this current study with already cognitively impaired APP/PS1 mice, we did not detect any BT2-induced changes in NTs in both regions across groups (Figure 3B, C). Consistent with the lack of restoration in neuronal functions following BT2 treatment, the impaired working and spatial memory in APP/PS1 mice as measured by spontaneous alternation in Y-maze test was not reversed by BT2 (Figure 3D, E). Detailed analyses revealed similar mean speed (Figure 3F), total distance (Figure 3G), and freezing time (Figure 3H) across groups, suggesting that the outcome of the behavioral test was most likely not confounded by differences in motor functions or distractions/anxiety of animals.

Figure 3.

BT2 does not affect neuronal functions or morphology and does not improve spatial memory in APP/PS1 mice. (A) Coronal brain sections, by Golgi-Cox staining, showing the dendritic density in the hippocampus of WT and APP/PS1 mice treated with either vehicle or BT2 (40 mg/kg ip) daily for 30 days (4x magnification). Zoomed pictures display 10x magnification. (B) Neurotransmitter levels measured in the cortex and (C) Hippocampus by HPLC-EC. N = 4–5/group (D) Y-maze setup schematic. (E) Spontaneous alternation (%) using Y-maze to test the effects of BT2 on the short-term spatial memory in WT and APP/PS1 mice. (F) Mean speed, (G) Total distance, and (H) Freezing time quantified in Y-maze test. N = 6–7/group. Data were analyzed by two-way ANOVA followed by Tukey's post hoc test. NE: Norepinephrine, DOPAC: A metabolite of dopamine, DA: Dopamine, 5-HIAA: A metabolite of serotonin, 5-HT: Serotonin; Values are Mean ± SEM; * p < 0.05.

Early BT2 treatment in cognitively intact 5xFAD mice has long-lasting effects on delaying cognitive deficit

BT2 was not able to alter the course of AD development once AD mice already exhibited cognitive dysfunction, but it is possible that early intervention may be effective in delaying the disease onset (i.e., cognitive impairment). Indeed, our recent findings demonstrate that BT2 treatment in young, cognitively intact 5xFAD mice was able to improve glycemic control and brain neurotransmitter levels while lowering GSK3β and neuroinflammatory markers, leading one to expect at least partial delay in AD progression. To test this, 2-month-old, cognitively intact WT and 5xFAD mice were injected with either vehicle or BT2 (40 mg/kg) daily for one month (Figure 4A). Animals were left alone thereafter for another one month which allowed us to determine if BT2 not only can slow down cognitive deficit, but also that the effect is long-lasting. In line with our previous results,¹⁶ body weight and food intake were not affected by BT2 during the intervention period (Figure 4B, C). As expected, plasma BCAAs significantly increased in 5xFAD mice compared to those in WT littermates, but this was effectively prevented by BT2 (Genotype, F[1,23] = 5.63, p = 0.02; Treatment, F[1,23] = 18.08, p < 0.001; Interaction, F[1,23] = 7.01, p = 0.01; µM; 862 ± 70 WT Veh versus 745 ± 93 5xFAD Veh versus 1230 ± 73 5xFAD BT2, p < 0.01; Figure 4D). Blood glucose also improved in BT2-treated 5xFAD mice (Genotype, F[1,24] = 6.52, p = 0.02; Treatment, F[1,24] = 4.68, p = 0.04; mg/dl; 180 ± 6 WT Veh versus 227 ± 19 5xFAD Veh versus 185 ± 5 5xFAD BT2, p < 0.05; Figure 4E). Importantly, while young 5xFAD mice started to manifest cognitive deficit in Y-maze test as they reached 4 months of age, those treated with BT2 early displayed a complete resistance to cognitive decline (Genotype, F[1,24] = 11.71, p = 0.002; Treatment, F[1,24] = 15.73, p < 0.001; Interaction, F[1,24] = 8.36, p = 0.008; Spontaneous alternation %; 51 ± 4 WT Veh versus 19 ± 4 5xFAD Veh versus 49 ± 5 5xFAD BT2, p < 0.001; Figure 4F). This result was not due to any changes in motor functions or distractions/anxiety between groups (Figure 4G). Altogether, these data suggest that pharmacologically lowering plasma BCAAs can lead to long-lasting effects in slowing down AD progression.

Figure 4.

Early BT2 treatment in 5xFAD mice shows a long-lasting effect on delaying cognitive deficit. (A) Experimental design. Baseline blood glucose and plasma BCAAs of male 5xFAD mice and WT littermates were measured along with spatial memory function by Y-maze before two months of age when animals were cognitively intact. Then, they were injected with either vehicle or BT2 (40 mg/kg ip) daily for 30 days after which they were left at rest for one month and Y-maze was performed at the end. The brains and terminal blood samples were collected during sacrifice. (B) Daily body weight and (C) Weekly food intake throughout BT2 treatment. N = 7/group. Data were analyzed by two-way repeated measures ANOVA followed by Tukey's post hoc test. D) Plasma BCAAs and (E) Blood glucose at the end of the treatment. N = 6–7/group for both. (F) Spontaneous alternation (%) measured in Y-maze test to assess cognitive function after BT2. (G) Mean Speed, (H) Total distance, and (I) Freezing time quantified in Y-maze test. N = 5–7/group. Data were analyzed by two-way ANOVA followed by Tukey's post hoc test. N = 7/group; Values are Mean ± SEM; * p < 0.05.

BT2 has long-lasting effects in enhancing neurotransmitter levels in the cortex of 5xFAD mice

Impaired synthesis of neurotransmitters leading to reduced neurotransmission throughout the brain is a key pathophysiological hallmark in AD.²⁹ The opposite, i.e., enhanced neurotransmitter synthesis, is anticipated in the case of improved cognition or delay of cognitive deterioration. While BT2 did not affect neurotransmitter levels in WT mice, we observed a complete normalization of neurotransmitters (NE, DA, 5-HT) in the cortex of BT2-treated 5xFAD mice compared to 5xFAD control mice (pg/µg; NE: Treatment, F[1,23] = 4.9, p = 0.04; Interaction, F[1,23] = 14.0, p = 0.001; 2.0 ± 0.2 WT Veh verss. 1.0 ± 0.1 5xFAD Veh versus 2.2 ± 0.2 5xFAD BT2, p < 0.05; DA: Treatment, F[1,21] = 14.2, p = 0.001; Interaction, F[1,21] = 12.7, p = 0.002; 1.7 ± 0.4 WT Veh versus 0.5 ± 0.2 5xFAD Veh versus 2.7 ± 0.5 5xFAD BT2, p < 0.05; 5-HT: Treatment, F[1,23] = 20.2, p = 0.0002; Interaction, F[1,23] = 7.96, p = 0.01; 3.5 ± 0.5 WT Veh versus 2.8 ± 0.3 5xFAD Veh versus 7.2 ± 1.0 5xFAD BT2, p < 0.05; Figure 5A). Interestingly, these positive effects were largely absent in the hippocampus (Figure 5B).

Figure 5.

Early BT2 treatment completely normalizes neurotransmitter levels in the cortex of 5xFAD mice. Cognitively intact WT and 5xFAD mice were injected with either vehicle or BT2 (40 mg/kg ip) daily for 30 days after which they were left at rest for one month before sacrifice. (A) Neurotransmitters measured in the cortex and (B) Hippocampus by HPLC-EC. Data were analyzed by two-way ANOVA followed by Tukey's post hoc test. N = 5–7/group; Values are Mean ± SEM; * p < 0.05.

Beneficial effects of BT2 are independent of cortical Aβ₄₂, tau, or neuroinflammation

Restoration of cortical neurotransmitter levels may be attributed to reduced amyloid and/or Tau burden and neuroinflammation, or enhanced essential neuronal functions. However, 5xFAD mice treated with BT2 ended up still maintaining high Aβ42 in the cortex (Genotype, F[1,23] = 37.6, p < 0.0001; pg/µg protein; 0.7 ± 0.1 WT Veh versus 76 ± 12.8 5xFAD Veh versus 109 ± 11.2 5xFAD BT2; Figure 6A) in spite of increased protein expression of neprilysin, an amyloid-degrading enzyme (Genotype, F[1,20] = 41.0, p < 0.001; Interaction, F[1,20] = 18.5, p = 0.0003; Fold change; 1.0 ± 0.05 WT Veh versus 1.1 ± 0.06 5xFAD Veh versus 1.45 ± 0.09 5xFAD BT2, p < 0.05; Figure 6B, C), without much changes in Tau or GSK3β (Figure 6D-F). A marker of glial activation, F4/80, as well as neuronal synapse markers like synaptophysin and PSD95 were not altered in the cortex of 5xFAD mice in response to BT2 (Figure 6G-1). Consistent with these results, BT2 did not affect mRNA of genes relevant to inflammation, mitochondrial fusion, autophagy, or amyloid synthesis in both WT and 5xFAD mice (Figure 6J). These findings suggest that BT2-induced increase in brain neurotransmitters and delay of cognitive dysfunction in 5xFAD mice might be mostly independent of the primary brain pathological features including amyloid and inflammation.

Figure 6.

Early BT2 does not induce any changes in brain pathology in 5xFAD mice. (A) Cortical Aβ₄₂ levels measured by ELISA kit. N = 7/group. (B) Western blots showing cortical expression of proteins in AD-related pathology including (C) Neprilysin, (D) pGSKβ, (E) pGSKβ, (F) pTau Ser 202, (G) F4/80, (H) GFAP, and (I) PSD95. pTau and pGSKβ were normalized to total Tau and GSKβ, respectively, while synaptophysin and PSD95 were normalized to vinculin. Other proteins were normalized to GAPDH and data are expressed as fold change from WT Veh group. N = 5–7/group J) mRNA abundance of genes related to neuronal functions and AD in the hippocampus measured by RT-qPCR. N = 6–7/group. Gene expression was normalized to B2 M and data are expressed as fold change from WT Veh group. Data were analyzed by two-way ANOVA followed by Tukey's post hoc test; Values are Mean ± SEM; * p < 0.05.

Discussion

Beyond the association between circulating BCAA levels and AD, a growing number of studies indicate them as a potential contributor to the pathophysiology of the disease.^4,5,26 Mendelian Randomization Analysis has uncovered that single nucleotide polymorphisms (SNPs) leading to genetic predisposition to high isoleucine may increase the risk of AD,⁴ and supplementing or restricting BCAAs from diet in rodent models of AD has mostly shown to exacerbate or ameliorate AD-related pathology and cognitive impairment, respectively.⁵ Our previous study was able to demonstrate that lowering plasma BCAAs pharmacologically by a small molecule BT2 in 5xFAD mice leads to similar positive effects including reduced neuroinflammatory markers and enhanced neurotransmitter levels in the brain.¹⁶ Here we sought to determine the right time for the BCAA-lowering intervention during the course of AD development. We extend our earlier findings and reveal that BT2 treatment in transgenic AD mice not after, but before the onset of cognitive deficit, can effectively delay disease progression and this benefit is long-lasting.

We previously used cognitively intact APP/PS1 mice to show that BCAA lowering by dietary BCAA restriction alleviated AD-related pathology and delayed cognitive decline, and BCAA reduction by a small molecule BT2 led to similar reduction in brain pathology and improved neurotransmitter levels,¹⁶ thereby giving us validation to test the effects of BT2 at the onset of AD. APP/PS1 mouse model typically develops cognitive impairment at the age of 12 months,^16,20,21 so we treated APP/PS1 mice with either vehicle or BT2 when they were 12 months old presenting memory impairment already. BT2-treated APP/PS1 mice had indeed lower plasma BCAA levels compared to vehicle-treated, cognitively impaired controls, indicating that the ability of BT2 to decrease plasma BCAAs is faithful regardless of the timing of disease progression. Similarly, no change in body weight or food intake following BT2 in both WT and APP/PS1 mice confirms the specificity of BT2 on BCAA levels without any off-target metabolic effects, and at the same time validates the safety of its utility in AD models.

The effect of BCAA reduction on glycemic control was negated in APP/PS1 mice that display cognitive symptoms. This actually raises an important point. Thus far, a number of studies^7,9,13,30 have implied that the way BCAAs raise blood glucose is more or less peripherally mediated by primarily acting on liver or muscle, but it may be that they in fact engage in the glucoregulatory system in the brain. The reason we failed to observe BT2-induced decrease in blood glucose in cognitively deficient APP/PS1 mice, as opposed to the case in cognitively intact mice,¹⁶ could be due to neuronal dysfunctions that made the critical glucoregulatory brain regions insensitive to lower plasma BCAAs. In support of this, induction of hypothalamic insulin resistance by mTOR hyperactivation, an intracellular signaling event also triggered by leucine, has shown to disrupt glucose homeostasis.³¹ It is possible that the hypothalamus of cognitively impaired APP/PS1 mice is already severely compromised and does not respond appropriately to lower BCAAs, hence exhibiting effects similar to insulin resistance that do not allow these mice to improve blood glucose. A study by Zheng and colleagues clearly demonstrated hypothalamic defects in APP/PS1 mice,³² thus supporting this possibility. Examining metabolic alterations within the hypothalamus and any changes in its response to low or high BCAAs in symptomatic APP/PS1 mice might offer a clue on the mechanistic association between BCAAs and CNS-driven glycemic control in AD.

APP/PS1 mice had significantly higher levels of Aβ42 in the cortex compared to the WT controls as expected, and BT2 treatment for one month was able to significantly reduce the amyloid burden. Surprisingly, unlike our earlier work in which cognitively intact AD mice were treated early with BT2 or BCAA restriction,¹⁶ the amyloid reduction in APP/PS1 mice in the current study was not accompanied by any alleviations in cortical or hippocampal pathology as demonstrated by no major changes in protein and gene markers related to inflammation, pTau formation, and glial activation. Furthermore, BT2 was not able to improve hippocampal dendritic arborization, neurotransmitter levels, or cognitive functions. These findings suggest that lowering plasma BCAAs after the onset of cognitive deficit is probably not an effective strategy and may be too late to alleviate AD-related pathology and cognitive symptoms. Furthermore, while excess Aβ42 accumulation is considered as one of the major players in the pathogenesis of AD, our current data question the causal relationship between the brain amyloid accumulation and the disease progression. A number of clinical studies strengthen this notion by consistently demonstrating the failure of anti-amyloid therapies designed to lower either soluble or insoluble forms of Aβ42 to deliver perceived cognitive benefits in individuals diagnosed with AD.^33–37 The weakened causal inference of amyloid protein in AD is also supported by animal studies in which a mutation in gamma secretase, a key enzyme in Aβ₄₂ synthesis, in rodents leads to accelerated neurodegeneration and neuronal loss without amyloid deposit.^38,39

Interestingly, compared to healthy WT littermates, cognitively impaired APP/PS1 mice did not display upregulation of protein or genes involved in inflammation and oxidative stress in the cortex and hippocampus. This finding may seem counter-intuitive at first since neuroinflammation and neuronal dysfunction are closely linked with AD development. It is important to recognize, however, that AD-related brain pathology or its markers are not found to be present in all AD mouse models, possibly due to the differences in the animal strain and sex, the timing of detection, detection methods, and specific brain areas assessed, among others. For instance, Francois and colleagues⁴⁰ did not observe any changes in IL-1β and TNF-α in both the cortex and hippocampus of APP/PS1 mice compared to their WT littermates at 6 months of age, although variable changes were detected later when the mice were 12 months old. It is difficult to compare these to our findings since the authors measured protein levels as opposed to mRNA abundance, and the sex of the animals used in their study is unclear. A more recent study⁴¹ showed higher Iba-1 protein expression in the frontal cortex and hippocampus of a similar APP/PS1 mouse model when they were 12 months old, which contrasts with no changes in F4/80, another microglial activation marker, observed in our current study. However, their mice were bred in C57Bl/6 background as opposed to B6C3 background in our study that is known to manifest very different pathology and cognitive behavioral phenotype. Similarly, Takkinen and others⁴² demonstrated higher Iba-1 expression in the cerebral cortex of another transgenic AD mouse model named APP/PS1-21 at 12 versus 6 months of age, but the study did not include age-matched WT littermates to compare to. Furthermore, APP751SL/PS1 knock-in mice that are known to overexpress both APP and the cleavage enzyme presenilin 1 revealed no changes in both IL-1β and TNF-α in the hippocampus at both 6 and 12 months of age compared to the WT littermates, although they both increased significantly when the mice reached 18 months of age.⁴³

It is noteworthy to mention that the expression of pathology or neuronal health markers can vary substantially across the age and brain regions even within the same AD mouse model. Lopez-Gonzalez and colleagues⁴⁴ showed a significantly increased gene expression of TNF-α and IL-6 in the cortex of 12-month-old APP/PS1 mice, without any changes in IL-1β even up to 20 months of age. Consistent with this, variable changes in protein expression of beclin (autophagy marker) were found in APP/PS1 mice with no change at 6 months but significant reduction at 12 months of age compared to WTs.⁴⁰ Interestingly, they did not observe any changes in LC3, another crucial autophagy marker, in either the cortex or hippocampus regardless of the age of the mice. Nonetheless, our data showing the lack of BT2 effects on various AD-related pathology and neuroinflammation markers suggest that BT2 treatment may not be able to provide any neuronal health benefits at the late stage of AD when cognitive deficit sets in.

Due to the severe CNS damage and atrophy at the advanced stage of the disease with absolutely no evidence of any possibility of halting or reversal by the available therapies, currently more attention in the field is focused on finding novel pathways or agents to prevent AD in individuals at the preclinical stage without yet overt cognitive impairment. Thus, we took our study one step further to assess whether intervention with BT2 in the early stage of AD would delay cognitive deficit and sustain a prolonged effect. After treating cognitively intact 5xFAD mice with BT2 and letting them age one month at which 5xFAD controls were expected to display impaired memory, we noticed a significant decrease in plasma BCAAs and blood glucose in 5xFAD mice that was independent of body weight or food intake, which is consistent with the results from our previous study.¹⁶ Even with the cessation of BT2 treatment for one full month, 5xFAD mice did not deteriorate their cognitive function unlike vehicle-treated 5xFAD mice. Interestingly, this was accompanied by a significant increase and restoration in the neurotransmitters (i.e., NE, DA, 5-HT) within the cortex but not in the hippocampus, unlike our previous study. The exact mechanisms for these positive outcomes are not clear because most protein and gene markers related to neuroinflammation, amyloid and pTau synthesis, and neuronal health did not change in response to BT2 treatment. One possible reason for observing restored neurotransmitters in the cortex but not in the hippocampus in our current study may have to do with region-specific compensatory mechanisms that become enhanced at different stages of AD progression. Similar to what we observed in cognitively impaired APP/PS1 mice, many neuronal health and pathology markers in the cortex and the hippocampus of 5xFAD mice did not change compared to the WT littermates. While this appears contradictory to what is known about AD pathogenesis, there are a number of in vivo studies that showed similar findings possibly due to differences in age, sex, and detection methods used. Consistent with our data, Manji and colleagues⁴⁵ demonstrated no differences in mRNA abundance of IL-1β, IL-6, and TNF-α, as well as the markers of microglial and astrocyte activation (i.e., GFAP, Iba-1) in the brains of male 5xFAD mice at 4 months of age, although there was a clear trend of increasing gene expressions in the female 5xFAD mice at the same age. A study by Ardestani and others⁴⁶ revealed higher IL-1β, IL-6, and TNF-α, and Iba-1 mRNAs in the cortex of male 5xFAD mice only at 6 months of age. GFAP and Iba-1 protein expressions were found to be in fact lower in the cortex of 4-month-old 5xFAD mice compared to the WTs with no differences between them in the hippocampus.⁴⁷ ER stress is strongly associated with the neuroinflammation observed in AD, however various ER stress markers in the whole brains of 4-month-old 5xFAD mice failed to show any differences compared to those in WT littermates,⁴⁸ further supporting our and others’ observations of apparently no or minimal changes in AD-related pathology markers in 5xFAD mice at this age. Another interesting finding in our current study is that we did not observe a significant reduction in neurotransmitters in APP/PS1 mice compared to healthy WT mice at this advanced age. While it is not clear, the potential reasons may include the disease severity stage, mouse strain and sex, among others. In support of this, in our previous study¹⁶ demonstrating significantly lower neurotransmitters and their metabolites in APP/PS1 mice compared to WT littermates in both cortex and hippocampus, the findings were based on a mixture of both male and female mice that contrasts from our current study in which only male mice were utilized. Furthermore, the only other study that measured neurotransmitters from APP/PS1 mice⁴⁹ was able to show decreased neurotransmitter levels in the brain. However, an accurate interpretation of the data is difficult because regular C57Bl/6J mice, instead of WT littermates, were separately obtained and used as a normal control group. The background strain also differs from that of APP/PS1 mice used in our study (C57Bl/6J×C3H). Further investigation to assess region-specific neurotransmitters from the same strain of APP/PS1 mice in both sexes is warranted.

Our study has several limitations. Unlike with APP/PS1 experiment, we could not collect data on cortical and hippocampal dendritic density in 5xFAD experiment via Golgi-Cox staining. Even with APP/PS1 mice, due to technical reasons, we were not able to conduct detailed analyses on dendrite length and dendritic spine numbers which would provide more insights into the pro-neuronal effects of BT2. Moreover, our current findings are limited to males only. Because women represent two thirds of the individuals diagnosed with AD, it would be critical to test the efficacy of BT2 in female mice as well to understand possible similarity or dichotomy in responsiveness between males and females. Lastly, as a number of emerging studies indicate, brain areas other than the cortex and hippocampus including the midbrain and pons that contains serotonergic, noradrenergic, and dopaminergic neurons, and the hypothalamus in the mediobasal region of the brain are heavily implicated in metabolic and synaptic dysfunction that contribute to AD-related pathology and cognitive impairment. Examining possible changes in neuronal health and pathology markers in these brain areas in response to BT2 treatment is warranted.

In conclusion, our findings suggest that whereas BT2 treatment does not reverse or alleviate AD-related pathology or cognitive deficit after the onset of the disease, it is quite effective in delaying AD progression if administered at the early stage in the absence of impaired cognition. This is most probably achieved through restored levels of neurotransmitters in the cortex, although the exact mechanisms leading to that needs further investigation. The long-lasting cognitive benefits of BT2 allows for potentially developing it as a clinically meaningful drug candidate for treating individuals at a preclinical stage.

Footnotes

Acknowledgements

We appreciate Dr P. Hemachandra Reddy and Dr Murali Vijayan from Texas Tech University Health Sciences Center (TTUHSC) for their technical guidance with Golgi-Cox staining.

ORCID iD

Andrew C Shin

Ethical considerations

Not applicable

Consent to participate

Not applicable

Consent for publication

Not applicable

Author contribution(s)

Caitlyn A Mullins: Conceptualization; Data curation; Formal analysis; Investigation; Writing – review & editing.

Ritchel B Gannaban: Data curation; Formal analysis; Writing – review & editing.

Alyssa Kramer: Data curation; Formal analysis; Writing – review & editing.

Harsh Shah: Data curation; Formal analysis; Writing – review & editing.

Zobayda Farzana Haque: Data curation; Formal analysis; Writing – review & editing.

Marjan Ramezan: Data curation; Formal analysis; Writing – review & editing.

Fereshteh Dehghani: Data curation; Formal analysis; Writing – review & editing.

Arun Kumar Palaniyappan: Data curation; Formal analysis; Writing – review & editing.

Frances Bowers: Data curation; Formal analysis; Writing – review & editing.

Sheba MJ MohanKumar: Data curation; Formal analysis; Funding acquisition; Writing – review & editing.

Puliyur S MohanKumar: Data curation; Formal analysis; Funding acquisition; Writing – review & editing.

Andrew C Shin: Conceptualization; Data curation; Funding acquisition; Project administration; Supervision; Writing – original draft; Writing – review & editing.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by NIH R21 AG069140-01 and Alzheimer's Association (ACS), and NIH R41 AG069539 (SMJM, PSM).

Declaration of conflicting interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data availability statement

The data supporting the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

References

Alzheimer's Association . Alzheimer's Disease Facts and Figures, https://www.alz.org/alzheimers-dementia/facts-figures (2023).

Woloshin

Kesselheim

. What to know about the Alzheimer drug Aducanumab (Aduhelm). JAMA Intern Med 2022; 182: 892.

van Dyck

Swanson

Aisen

, et al. Lecanemab in early Alzheimer's disease. N Engl J Med 2023; 388: 9–21.

Larsson

Markus

. Branched-chain amino acids and Alzheimer's disease: a Mendelian randomization analysis. Sci Rep 2017; 7: 13604.

Tournissac

Vandal

Tremblay

, et al. Dietary intake of branched-chain amino acids in a mouse model of Alzheimer's disease: effects on survival, behavior, and neuropathology. Alzheimers Dement (N Y) 2018; 4: 677–687.

Xie

, et al. Defect of branched-chain amino acid metabolism promotes the development of Alzheimer's disease by targeting the mTOR signaling. Biosci Rep 2018; 38: BSR20180127.

Cummings

Williams

Kasza

, et al. Restoration of metabolic health by decreased consumption of branched-chain amino acids. J Physiol 2018; 596: 623–645.

Jang

Wada

, et al. A branched-chain amino acid metabolite drives vascular fatty acid transport and causes insulin resistance. Nat Med 2016; 22: 421–426.

Newgard

Bain

, et al. A branched-chain amino acid-related metabolic signature that differentiates obese and lean humans and contributes to insulin resistance. Cell Metab 2009; 9: 311–326.

10.

She

Van Horn

Reid

, et al. Obesity-related elevations in plasma leucine are associated with alterations in enzymes involved in branched-chain amino acid metabolism. Am J Physiol Endocrinol Metab 2007; 293: E1552–E1563.

11.

Wang

Larson

Vasan

, et al. Metabolite profiles and the risk of developing diabetes. Nat Med 2011; 17: 448–453.

12.

Tso

Gui

, et al. Benzothiophene carboxylate derivatives as novel allosteric inhibitors of branched-chain alpha-ketoacid dehydrogenase kinase. J Biol Chem 2014; 289: 20583–20593.

13.

Zhou

Shao

, et al. Targeting BCAA catabolism to treat obesity-associated insulin resistance. Diabetes 2019; 68: 1730–1746.

14.

Uddin

Zhang

Shah

, et al. Impaired branched chain amino acid oxidation contributes to cardiac insulin resistance in heart failure. Cardiovasc Diabetol 2019; 18: 86.

15.

Wei

Zhang

, et al. 3,6-dichlorobenzo[b]thiophene-2-carboxylic Acid alleviates ulcerative colitis by suppressing mammalian target of rapamycin complex 1 activation and regulating intestinal microbiota. World J Gastroenterol 2022; 28: 6522–6536.

16.

Siddik

MAB

Mullins

Kramer

, et al. Branched-chain amino acids are linked with Alzheimer's disease-related pathology and cognitive deficits. Cells 2022; 11: 3523.

17.

Radde

Bolmont

Kaeser

, et al. Abeta42-driven cerebral amyloidosis in transgenic mice reveals early and robust pathology. EMBO Rep 2006; 7: 940–946.

18.

Ordonez-Gutierrez

Fernandez-Perez

Herrera

, et al. AbetaPP/PS1 transgenic mice show sex differences in the cerebellum associated with aging. J Alzheimers Dis 2016; 54: 645–656.

19.

Jankowsky

Fadale

Anderson

, et al. Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: evidence for augmentation of a 42-specific gamma secretase. Hum Mol Genet 2004; 13: 159–170.

20.

Lalonde

Kim

Maxwell

, et al. Exploratory activity and spatial learning in 12-month-old APP(695)SWE/co+PS1/DeltaE9 mice with amyloid plaques. Neurosci Lett 2005; 390: 87–92.

21.

Volianskis

Kostner

Molgaard

, et al. Episodic memory deficits are not related to altered glutamatergic synaptic transmission and plasticity in the CA1 hippocampus of the APPswe/PS1deltaE9-deleted transgenic mice model of ss-amyloidosis. Neurobiol Aging 2010; 31: 1173–1187.

22.

Oakley

Cole

Logan

, et al. Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer's disease mutations: potential factors in amyloid plaque formation. J Neurosci 2006; 26: 10129–10140.

23.

Devi

Ohno

. Phospho-eIF2alpha level is important for determining abilities of BACE1 reduction to rescue cholinergic neurodegeneration and memory defects in 5XFAD mice. PLoS One 2010; 5: e12974.

24.

Xiao

Zhang

Zhou

, et al. Reduction of glucose metabolism in olfactory bulb is an earlier Alzheimer's disease-related biomarker in 5XFAD mice. Chin Med J (Engl) 2015; 128: 2220–2227.

25.

Shin

Park

Lee

, et al. Thioflavin-positive tau aggregates complicating quantification of amyloid plaques in the brain of 5XFAD transgenic mouse model. Sci Rep 2021; 11: 1617.

26.

Zhang

Kolwicz

Jr. , et al. Defective branched-chain amino acid catabolism disrupts glucose metabolism and sensitizes the heart to ischemia-reperfusion injury. Cell Metab 2017; 25: 374–385.

27.

Chen

Gao

, et al. Therapeutic effect of targeting branched-chain amino acid catabolic flux in pressure-overload induced heart failure. J Am Heart Assoc 2019; 8: e011625.

28.

Beckett

. [5] - Spectrophotometric assay for measuring branched-chain amino acids. In: Harris

Sokatch

(eds) Methods in enzymology. New York: Academic Press, 2000, pp.40–47.

29.

Simic

Babic Leko

Wray

, et al. Monoaminergic neuropathology in Alzheimer's disease. Prog Neurobiol 2017; 151: 101–138.

30.

Richardson

Green

, et al. The adverse metabolic effects of branched-chain amino acids are mediated by isoleucine and valine. Cell Metab 2021; 33: 905–922 e906.

31.

Ono

Pocai

Wang

, et al. Activation of hypothalamic S6 kinase mediates diet-induced hepatic insulin resistance in rats. J Clin Invest 2008; 118: 2959–2968.

32.

Zheng

Zhou

, et al. The hypothalamus as the primary brain region of metabolic abnormalities in APP/PS1 transgenic mouse model of Alzheimer's disease. Biochim Biophys Acta Mol Basis Dis 2018; 1864: 263–273.

33.

Gilman

Koller

Black

, et al. Clinical effects of Abeta immunization (AN1792) in patients with AD in an interrupted trial. Neurology 2005; 64: 1553–1562.

34.

Ostrowitzki

Lasser

Dorflinger

, et al. A phase III randomized trial of gantenerumab in prodromal Alzheimer's disease. Alzheimers Res Ther 2017; 9: 95.

35.

Honig

Vellas

Woodward

, et al. Trial of solanezumab for mild dementia due to Alzheimer's disease. N Engl J Med 2018; 378: 321–330.

36.

Hoilund-Carlsen

Revheim

Costa

, et al. FDG-PET versus amyloid-PET imaging for diagnosis and response evaluation in Alzheimer's disease: benefits and pitfalls. Diagnostics (Basel) 2023; 13: 2254.

37.

Yuksel

Noviasky

Britton

. Aducanumab for Alzheimer's disease: summarized data from EMERGE, ENGAGE, and PRIME studies. Sr Care Pharm 2022; 37: 329–334.

38.

Chui

Tanahashi

Ozawa

, et al. Transgenic mice with Alzheimer presenilin 1 mutations show accelerated neurodegeneration without amyloid plaque formation. Nat Med 1999; 5: 560–564.

39.

Saito

Suemoto

Brouwers

, et al. Potent amyloidogenicity and pathogenicity of Abeta43. Nat Neurosci 2011; 14: 1023–1032.

40.

Francois

Rioux Bilan

Quellard

, et al. Longitudinal follow-up of autophagy and inflammation in brain of APPswePS1dE9 transgenic mice. J Neuroinflammation 2014; 11: 139.

41.

Cao

Fisher

Rodriguez

, et al. Comparisons of neuroinflammation, microglial activation, and degeneration of the locus coeruleus-norepinephrine system in APP/PS1 and aging mice. J Neuroinflammation 2021; 18: 10.

42.

Takkinen

Lopez-Picon

Al Majidi

, et al. Brain energy metabolism and neuroinflammation in ageing APP/PS1-21 mice using longitudinal (18)F-FDG and (18)F-DPA-714 PET imaging. J Cereb Blood Flow Metab 2017; 37: 2870–2882.

43.

Jimenez

Baglietto-Vargas

Caballero

, et al. Inflammatory response in the hippocampus of PS1M146L/APP751SL mouse model of Alzheimer's disease: age-dependent switch in the microglial phenotype from alternative to classic. J Neurosci 2008; 28: 11650–11661.

44.

Lopez-Gonzalez

Schluter

Aso

, et al. Neuroinflammatory signals in Alzheimer disease and APP/PS1 transgenic mice: correlations with plaques, tangles, and oligomeric species. J Neuropathol Exp Neurol 2015; 74: 319–344.

45.

Manji

Rojas

Wang

, et al. 5xFAD Mice display sex-dependent inflammatory gene induction during the prodromal stage of Alzheimer's disease. J Alzheimers Dis 2019; 70: 1259–1274.

46.

Ardestani

Evans

, et al. Modulation of neuroinflammation and pathology in the 5XFAD mouse model of Alzheimer's disease using a biased and selective beta-1 adrenergic receptor partial agonist. Neuropharmacology 2017; 116: 371–386.

47.

Oblak

Lin

Kotredes

, et al. Comprehensive evaluation of the 5XFAD mouse model for preclinical testing applications: a MODEL-AD study. Front Aging Neurosci 2021; 13: 713726.

48.

Sadleir

Popovic

Vassar

. ER Stress is not elevated in the 5XFAD mouse model of Alzheimer's disease. J Biol Chem 2018; 293: 18434–18443.

49.

Wei

Liu

Chen

, et al. Schisandrin ameliorates cognitive impairment and attenuates Abeta deposition in APP/PS1 transgenic mice: involvement of adjusting neurotransmitters and their metabolite changes in the brain. Acta Pharmacol Sin 2018; 39: 616–625.

Early branched-chain amino acid reduction delays the onset of cognitive decline in a mouse model of Alzheimer's disease

Abstract

Background

Objective

Methods

Results

Conclusions

Keywords

Introduction

Methods

Animals

Experiment 1: BT2 after the onset of cognitive deficit

Experiment 2: BT2 before the onset of cognitive deficit

Plasma BCAA measurement

Insulin ELISA

Western blots

Real-time quantitative PCR (RT-qPCR)

Aβ42 measurement

Brain monoamine quantification

Hippocampal dendritic density

Spatial memory test

Statistics

Results

Effects of BT2 on the metabolic profile in cognitively impaired APP/PS1 mice

BT2 lowers cortical Aβ42 without affecting brain pathology markers in cognitively impaired APP/PS1 mice

BT2 does not improve dendritic density, neurotransmitters, or cognition in APP/PS1 mice with AD onset

Early BT2 treatment in cognitively intact 5xFAD mice has long-lasting effects on delaying cognitive deficit

BT2 has long-lasting effects in enhancing neurotransmitter levels in the cortex of 5xFAD mice

Beneficial effects of BT2 are independent of cortical Aβ42, tau, or neuroinflammation

Discussion

Footnotes

Acknowledgements

ORCID iD

Ethical considerations

Consent to participate

Consent for publication

Author contribution(s)

Funding

Declaration of conflicting interests

Data availability statement

References

Aβ₄₂ measurement

BT2 lowers cortical Aβ₄₂ without affecting brain pathology markers in cognitively impaired APP/PS1 mice

Beneficial effects of BT2 are independent of cortical Aβ₄₂, tau, or neuroinflammation