Involvement of orexin nerves in early stage of Alzheimer's disease model mice and preventive effect of orexin receptor antagonists

Abstract

Background

Orexin (OX) levels are elevated in the cerebrospinal fluid of patients with mild cognitive impairment (MCI) and Alzheimer's disease (AD).

Objective

To investigate the efficacy of dual OX receptor antagonists (suvorexant and lemborexant) in an early-stage AD mouse model (App-KI).

Methods

OX receptor gene expression was measured. Additionally, drug distribution and effects on motor activity following single oral administration of suvorexant and lemborexant were assessed. Furthermore, cognitive function, amyloid-β (Aβ) levels and uptake by microglia in the hippocampal CA1 region were evaluated following daily administration of suvorexant and lemborexant for 60 days.

Results

OXR gene expression was highest in the lateral hypothalamus of wild-type mice and was also observed in other brain regions. OX1R gene expression was significantly increased in these brain regions in App-KI mice. In wild-type mice, brain concentrations of suvorexant peaked 20 to 40 min after administration, and those of lemborexant peaked 15 min after administration. Concentrations subsequently declined but remained detectable 24 h after administration. Additionally, motor activity decreased following the administration of either suvorexant or lemborexant; however, no difference in motor activity was observed compared to the control group 24 h later. Notably, the Y-maze test revealed that suvorexant and lemborexant mitigated cognitive impairment in App-KI mice. Furthermore, both drugs suppressed the accumulation of Aβ in the CA1 region of the hippocampus in App-KI mice. This was associated with increased Aβ uptake by activated microglia.

Conclusions

The results suggest that suvorexant and lemborexant effectively suppresses the early stages of AD.

Keywords

Alzheimer's disease amyloid-β cognition lemborexant mild cognitive impairment orexin orexin receptor antagonist suvorexant

Introduction

Mild cognitive impairment (MCI) is an intermediate state between healthy cognition and dementia and is considered a predementia condition that is likely to progress to Alzheimer's disease (AD).¹ The main symptom of MCI is memory loss. However, this condition has little impact on daily life and cannot be diagnosed as dementia.² Amyloid-β (Aβ) and total- and phosphorylated-tau protein levels are elevated in the cerebrospinal fluid and its accumulation in the brain parenchyma; however, the senile plaques and abnormal phosphorylation of the tau protein are mild.³ Acetylcholinesterase inhibitors, NMDA-type glutamate receptor antagonists, and anti-amyloid monoclonal antibodies are used to treat AD. Acetylcholinesterase inhibitors and NMDA-type glutamate receptor antagonists are symptomatic treatments that may slow disease progression, but only slightly prolong prognosis and are not fully effective.⁴ Lecanemab and donanemab, an anti-amyloid monoclonal antibody, are effective in removing amyloid but should be used with caution, as deaths due to amyloid-related imaging abnormalities have been reported as a side effect.^5–8 The appropriate prevention and treatment of MCI may prevent or delay AD onset. However, the lack of effective therapeutic agents and the absence of reliable treatment methods require a new approach from a new perspective.

In recent years, several clinical studies have reported elevated levels of orexin (OX) in the cerebrospinal fluid of patients with MCI and AD,^9,10 suggesting an association between OX, MCI, and AD. OX is a neuropeptide that was discovered in 1998. Two subtypes of OXs have been reported, OXA and OXB, which are enzymatically generated from prepro-orexin. OXA has a higher affinity for OX1 receptor (OX1R) than OX2 receptor (OX2R), while OXB has a similar affinity for OX1R and OX2R.¹¹ OX1R and OX2R can couple to Gα_q, Gα_s, Gα_i/o, and Gα_12/13 subtypes, which subsequently induce PLC, PLA, PLD, or AC, ultimately resulting in an increase in cytosolic [Ca2+] and a downstream cascade response through Gα_q-PLC-PKC or Gα_s/Gα_i-AC-PKA pathways.¹² OX neuron cell bodies are located in the lateral hypothalamic area (LHA) and project to several brain regions, including the cortex and hippocampus (Hip).^13,14 Although much is still unknown due to the short time since its discovery, it contributes to feeding behavior and the maintenance of wakefulness and sleep regulation in the brain, and its relationship to psychiatric and neurodegenerative disorders such as narcolepsy, depression, ischemic stroke, and AD, which may coexist with sleep disturbance, has attracted attention.^9–11^,15–27 Among these, the activation of the OX system has been reported to be positively correlated with the accumulation of Aβ and tau, leading to sleep disorder in animal models of AD.²⁸ This makes them potential therapeutic targets for AD.²⁹

The OX receptor antagonists suvorexant and lemborexant have been approved as hypnotic medications in the USA and Japan, respectively. Suvorexant has a similar affinity for OX1R and OX2R, while lemborexant has almost 15-fold higher affinity for OX2R than OX1R.^30,31 Recently, suvorexant and almorexant, dual OXR antagonists, were reported to inhibit cognitive impairment and brain Aβ accumulation in patients with AD and mouse models.^32–35 However, administration of OX1R-selective antagonists to AD model mice has been found to exacerbate cognitive impairment.^36,37 Meanwhile, OX2R-selective antagonists have been reported to suppress cognitive impairment and AD pathology in mouse models of AD.³⁸ Therefore, antagonizing OX2R may be effective in ameliorating AD pathology and cognitive impairment; however, no studies have reported on lemborexant, which has an almost 15-fold higher affinity for OX2R.

In recent years, the relationship among OX, MCI, and AD has become clear; however, more evidence is needed to confirm its clinical application. Furthermore, the involvement of OX neurons in early-stage AD mouse models remains controversial.

On the above background, we examined the following: (i) OX1R and OX2R gene expression in the brains of wild-type (WT) and App-KI mice, (ii) the pharmacokinetics of suvorexant and lemborexant in the hippocampus (Hip), orbitofrontal cortex (OFC), and lateral hypothalamic area (LHA), and (iii) the effects of suvorexant and lemborexant on the motor activity of WT mice. Additionally, we evaluated (iv) the effects of repeated administration of suvorexant or lemborexant on cognitive impairment in App-KI mice, and (v) the effects on Aβ accumulation and uptake by activated microglia, in order to determine the effectiveness of suvorexant and lemborexant in the early stages of AD. This study is the first to report that abnormalities in OX signaling in App-KI mice, and long-term oral administration of suvorexant and lemborexant, suppress Aβ accumulation and cognitive impairment by enhancing Aβ uptake by activated microglia in the brains of App-KI mice.

Methods

Animals

App^{NL-G-F/NL-G-F} (C57BL/6-App < tm3(NL-G-F)Tcs>; App-KI) mice were generated in a C57BL/6J genetic background and provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan.^39,40 App-KI mice and their WT littermates were obtained by breeding heterozygous App^+/NL-G-F mice. Male and female mice aged 4 − 6 months were used in this experiment (male WT = 151, male App-KI = 58, female WT = 45, and female App-KI = 46). Mice were housed at a density of 5–6 mice/cage (28 cm × 17 cm × 13 cm) under standard conditions (23 ± 1°C, 50 ± 5% humidity) with a 12 h light/dark cycle. Food and water were provided ad libitum. All animal experiments were approved and performed according to the Animal Care and Use Regulations of the School of Pharmacy, Aichi Gakuin University, Nagoya, Japan.

Gene expression analysis

Gene expression analysis was performed as previously described with minor modifications.^41,42 Ten 6-month-old male WT mice and four same-aged App-KI mice were sacrificed for gene expression analyses. Hip, OFC, cerebral cortex, striatum, nucleus accumbens, and LHA tissues were rapidly dissected on ice according to the Mouse Brain Atlas⁴³ using 2 mm diameter biopsy punches (Integra Miltex, NH, USA) and total RNA was extracted using the RNeasy Mini Kit (Qiagen, Germany). Total RNA was reverse transcribed to cDNA using ReverTra Ace^® qPCR RT Master Mix (TOYOBO, Japan). The expression of the OX1R and OX2R genes was measured from 500 ng of cDNA using the THUNDERBIRD^® SYBR^TM qPCR Mix (TOYOBO) and the StepOnePlus^TM Real-Time PCR System Upgrade (Thermo Fisher Scientiﬁc, MA, USA). The Gapdh gene was used as a housekeeping gene. In this study, the following primers were used: mOX1R forward: TTGGTGCGGAACTGGAAAC; mOX1R reverse: CCATCAGCATCTTAGCCGTCT; mOX2R forward: TTCCCGGAACTTCTTCTGTGG; mOX2R reverse: TCAGCAGCAACAGCGCTAATC; Gapdh forward: CAATGTGTCCGTCGTGGATCT; Gapdh reverse: GTCCTC AGTGTAGCCCAAGATG.

Drug preparation

Belsomra^® (MSD, NJ, USA) or Deyvigo^® (Eisai, Japan) tablets were suspended in 400 mL of water and stirred at 65°C for 10 min; 400 mL of ethyl acetic acid or 400 mL of chloroform was added to the Belsomra^® or Debigo^® suspension, respectively. The solution was filtered through a celite pad and the filtrate was extracted with 200 mL of ethyl acetate for Belsomra^® or 200 mL of chloroform for Debigo^®, respectively, three times. The organic phase was then dried over MgSO₄ and concentrated under pressure. The residue was purified using an Isolera^TM One (Biotage, Sweden) to obtain suvorexant or lemborexant.

LC-MS/MS analysis

Qualitative and quantitative determination of suvorexant and lemborexant by LC-MS/MS was performed as previously described with slight modifications.^44–47 Suvorexant and lemborexant were determined in positive ion mode using an LC system (Nexera 2; Shimadzu, Japan) connected to a triple quadrupole mass spectrometer (LC-MS 8040; Shimadzu) with an electrospray ion source. LC separation of suvorexant, lemborexant, and estazolam-d5, internal control, was performed using a C18 column (2.1 × 50 mm, 3 μm particle size; GL Sciences, Japan) maintained at 35°C. Separation was performed by gradient elution with mobile phases A (0.1% formic acid in water; MPA) and B (0.1% formic acid in acetonitrile; MPB). The gradient program was run as follows: 40% MPB (linear gradient, v/v) at 0 min, 40 − 90% MPB at 4 min, 90% MPB at 2 min, and 90 − 40% MPB at 2 min at a flow rate of 0.2 mL/min with a run time of 8 min for each 3 μL injection volume. Multiple reaction monitoring mode was applied for the detection of suvorexant, lemborexant, and estazolam-d5 by monitoring the transitions: m/z 451.4 to 186.1 for suvorexant, m/z 411.4 to 287.1 for lemborexant, and m/z 300.25 to 272.1 for estazolam-d5. Details of the LC-MS/MS conditions used for the measurements are provided in Table 1.

Table 1.

Summary of optimized parameters for LC-MS/MS analysis.

Parameters	Suvorexant	Lemborexant	Estazolam-d5
Column	C18 column (2.1 × 50 mm, 3 μm particle size)
MPA	0.1% formic acid in water
MPB	0.1% formic acid in acetonitrile
Linear gradient	40% MPB for 0 min
	40–90% MPB at 4 min
	90% MPB at 2 min
	90–40% MPB at 2 min
Flow rate	0.2 mL/min
Injection volume	3 μL
Column temperature	35°C
Polarity	Positive ESI
Molecular Weight	450.93 g/mol	410.42 g/mol	299.77 g/mol
Precursor (m/z)	451.25	411.25	300.15
Product (m/z)	186.10	287.05	272.10
Q1 pre bias (V)	−16	−14	−20
CE (V)	−24	−16	−26
Q3 pre bias (V)	−20	−30	−28
Detection time (min)	4.226	3.045	2.087
Interface voltage (kV)	Depends on tuning the file	Depends on tuning the file	Depends on tuning the file
Nebulizing gas (L/min)	3	3	3
DL temperature (°C)	250	250	250
Heat block temperature (°C)	400	400	400
Drying gas (L/min)	15	15	15

Drug treatment

Purified suvorexant and lemborexant were assayed for purity using LC-MS/MS, and only those with >95% purity were used in the experiments. Suvorexant and lemborexant were suspended in 1% sodium carboxymethylcellulose powder (Sigma-Aldrich, MA, USA) dissolved in saline at 3.0 mg/mL. Vehicle, suvorexant, and lemborexant were administered orally (10 mL/kg) once or repeatedly once daily using an oral sonde (Fuchigami, Japan).

Measurement of drug levels in the brain using an LC-MS/MS

Seventy 6-month-old male WT mice received a single oral dose of suvorexant (30 mg/kg) or lemborexant (30 mg/kg). Five mice were sacrificed at each of the following time points: 10, 20, 30, 40, and 60 min; 12 and 24 h; and 5, 10, 15, 30, and 60 min; and 12 and 24 h after suvorexant and lemborexant administration, respectively. Hip, OFC, and LHA tissues were rapidly dissected on ice according to the Mouse Brain Atlas⁴³ using 2 mm diameter biopsy punches (Integra Miltex). The tissue was then sonicated in a 120 μL MPA + MPB solution (MPA: MPB = 1:1). After sonication, the samples were added to 100 μL of MPB to remove the protein and centrifuged at 17,000 g for 20 min. The supernatant was collected and stored at −80°C until use. The samples were spiked with estazolam-d5 (final concentration 500 ng/mL) at the time of measurement. Brain suvorexant and lemborexant levels were measured in triplicate using LC-MS/MS under the same conditions as those used to confirm the purity of suvorexant and lemborexant. The areas under the curve (AUC)_10–60 and AUC_5–60 were calculated using the linear trapezoidal rule with extrapolation.

Locomotor activity

The locomotor test was performed as described in a previous report with minor modifications.⁴⁸ Twenty-seven 6-month-old male WT mice were randomly divided into three groups (WT vehicle, WT suvorexant, WT lemborexant). Each mouse was placed in a standard transparent rectangular rodent cage under normal light conditions (380 − 400 lx). The measurements were taken immediately and 24 h after administration for 120 min in each mouse. Locomotor activity was measured using an infrared sensor (WO-03; Brain Science Idea, Japan) and a receiver box (DIG-807; Med Associates Inc., VT, USA). Data were analyzed using data acquisition software (SOF-860; Med Associates Inc.).

Y-maze

The Y-maze test was performed as previously described with minor modifications.^49–51 One hundred and ninety-one 4-month-old male and female WT and App-KI mice were assigned to six groups (male WT vehicle, n = 14; male WT suvorexant, n = 17; male WT lemborexant, n = 15; male App-KI vehicle, n = 19; male App-KI suvorexant, n = 18; male App-KI lemborexant, n = 19; female WT vehicle, n = 15; female WT suvorexant, n = 16; female WT lemborexant, n = 14; female App-KI vehicle, n = 15; female App-KI suvorexant, n = 14; female App-KI lemborexant, n = 15). Mice were orally treated with vehicle, suvorexant (30 mg/kg), or lemborexant (30 mg/kg) once daily for 60 d. In this study, drug-treated 6-month-old WT and App-KI mice were used. Each arm of the Y-maze apparatus was 40 cm long, 12 cm high, 3 cm wide at the bottom, and 10 cm wide at the top. The arms converged to form an equilateral triangular central area measuring 4 cm along the longest axis. Each mouse was individually placed on one of the three arms of the apparatus and allowed to move freely through the maze during an 8-min session under illumination conditions (30 − 40 lx). The series of arm entries and alteration behavior were counted and analyzed using ANY-maze software (Stoelting, IL, USA). Three batch operations were conducted.

Immunohistochemistry

Immunohistochemistry was performed as previously described with minor modifications.^52–54 After the Y-maze test, six mice per group were used for immunohistochemistry. Mice were anesthetized intraperitoneally with medetomidine, midazolam, and butorphanol and perfused intracardially with 0.1 M phosphate buffer and 4% paraformaldehyde in 0.1 M phosphate buffer. The brains were removed, postfixed in the same fixative and cryoprotected in 20% sucrose, followed by 30% sucrose in 0.1 M phosphate buffer. The 25 μm thick coronal brain slices were cut on a cryostat (CM3050S; Leica Biosystems, Japan). These slices were placed in 0.1 M phosphate buffer, washed three times, fixed in 4% paraformaldehyde in 0.1 M phosphate buffer for 5 min, and permeabilized with 0.1% Triton X-100 in 0.1 M phosphate buffer for 10 min. After incubation in Blocking One Histo (Nacalai, Japan) for 60 min, purified anti-β-amyloid, 1 − 16 antibody (1:1000; BioLegend, CA, USA), anti-human Aβ (N) (82E1) mouse IgG MoAb biotin (1:300; Immuno-Biological Laboratories, Japan), anti-CD68 antibody (1:300; abcam, Cambridge, UK), and anti-Iba1 antibody (1:300; abcam) diluted in 0.1 M phosphate buffer were applied to the sections, which were then incubated overnight at 4°C. After three washes in 0.1 M phosphate buffer, goat anti-mouse Alexa Fluor 594 (1:10,000; Thermo Fisher Scientific), donkey anti-rabbit Alexa Fluor 488 (1:1000; Thermo Fisher Scientific), Streptavidin Alexa Fluor 546 (1:1000; Thermo Fisher Scientific), donkey anti-goat Alexa Fluor 647 (1:1000; Thermo Fisher Scientific), and Cellstain^®-Hoechst 33342 solution (1:2000; DOJINDO, Japan) diluted in 0.1 M of phosphate buffer were added to the sections for 1 h at 20 − 30°C. After three washes in 0.1 M phosphate buffer, the sections were mounted on a glass slide coated with MAS (Matsunami, Japan) using Fluorescence Mounting Medium (Dako, CA, USA) and a coverslip. Fluorescent images were captured using an all-in-one fluorescence microscope (BZ-X800; KEYENCE, Japan). The Hip CA1 region was identified using the Mouse Brain Atlas.⁴³ For quantitative Aβ analysis, six images were acquired from one sample and analyzed using Hybrid Cell Count software (KEYENCE). After creating regions of interest in the Hip CA1 region, positive regions with signal intensity above the background threshold and >28 µm2 were defined as Aβ-positive areas and aggregates to exclude nonspecific signals. Additionally, for quantitative CD68 and Iba1 analysis, three to nine images were acquired from one sample and analyzed. Aβ aggregates measuring between 200 and 1000 µm² were randomly selected within the CA1 region of the Hip, and the areas of positive CD68 signal intensity, and the number of Iba1-positive microglia on the Aβ aggregates were measured.

Statistical analysis

All data are presented as mean ± SEM for the others. Statistical analyses were performed using GraphPad Prism 6 software (GraphPad Software, San Diego, CA, USA). Statistical significance was determined using one-way or two-way analysis of variance, and the Tukey − Kramer multiple comparison test was used for post hoc analysis when F ratios were significant. All data and results of the statistical analyses are presented in Supplemental Table 1.

Results

Expression of OXR gene in the mouse brain

The distribution of the OXR gene has been described,^55,56 but its expression in target-week old mice is unknown. Therefore, we examined the expression of the OX1R and OX2R genes in the Hip, OFC, cerebral cortex, striatum, nucleus accumbens, and LHA of 6-month-old male WT mice. The results showed that OX1R and OX2R genes were expressed in all measured brain regions (Figure 1A, B). Additionally, the OX1R and OX2R genes were most highly expressed in LHA among these brain regions. Furthermore, we compared the expression of the OX1R and OX2R genes in the OFC, LHA, and Hip regions of WT and App-KI mice, a second-generation mouse model of AD that closely mimics AD pathology by harboring Swedish, Iberian, and Arctic mutations in the amyloid precursor protein gene, and has been reported to show cognitive impairment.^39,53,57 The results showed that OX1R gene expression was significantly higher in App-KI mice than in WT mice (Figure 1C). In contrast, no significant differences were observed between the two groups for OX2R gene expression (Figure 1D).

Figure 1.

Expression of OX1R and OX2R genes in the 6-month-old WT male mice. (A) OX1R mRNA levels and (B) OX2R mRNA levels in the hippocampus (Hip), orbitofrontal cortex (OFC), cerebral cortex, striatum, nucleus accumbens, and lateral hypothalamic area (LHA). **p < 0.01 compared to the respective expression level in Hip. (C) OX1R mRNA levels and (D) OX2R mRNA levels in the Hip, OFC, and LHA in WT and App-KI mice. *p < 0.05 and **p < 0.01 compared to the respective expression level in WT Hip. All data are presented as means ± SEM (WT; n = 4 mice, App-KI; n = 4 mice).

Brain levels of OXR antagonists

Understanding the brain pharmacokinetics is important for determining drug dosing schedules and monitoring drug efficacy and side effects.⁵⁸ The pharmacokinetics of suvorexant and lemborexant in plasma, cerebrospinal fluid, and brain have been partially reported.^59–63 However, reports on the pharmacokinetics of lemborexant in the brain and the same dose of suvorexant or lemborexant in the target-week old mice are lacking. Early Aβ deposition in the Hip and OFC has been reported in patients with MCI.⁶⁴ In addition, early metabolic abnormalities have been reported in the LHA of the AD mouse model.^65,66 The LHA is also an important site for evaluating the effects of OX receptor antagonists in the early stages of AD mouse models, as it is known to contain OX neuronal cell bodies.¹¹ Furthermore, we confirmed the expression of OX1R and OX2R in the Hip, OFC, and LHA (Figure 1A, B). Therefore, the levels of suvorexant and lemborexant in the brain were examined in 6-month-old male WT mice. Following single oral drug administration, drug levels increased in a time-dependent manner in each brain region, reaching maximum levels (suvorexant: Hip, 8.65 nM at 40 min; OFC, 13.53 nM at 20 min; LHA, 9.94 nM at 40 min and lemborexant: Hip, 30.52 nM at 15 min; OFC, 17.56 nM at 15 min; LHA, 32.07 nM at 15 min) and then decreased (Figure 2A, B). Additionally, brain drug levels 24 h after administration were as follows: Hip, 5.64 nM; OFC, 6.88 nM; LHA, 4.82 nM in suvorexant (Figure 2C) and Hip, 10.56 nM; OFC, 3.01 nM; LHA, 1.64 nM in lemborexant (Figure 2D). The pharmacokinetic parameters of suvorexant and lemborexant in the Hip, OFC, and LHA are shown in Table 2.

Figure 2.

Brain level-time curves for suvorexant and lemborexant in 6-month-old WT male mice. (A) Suvorexant level-time curves at 10 − 60 min and (B) 12 and 24 h after a single oral dose of suvorexant (30 mg/kg). (C) Lemborexant level-time curves at 5 − 60 min and (D) 12 and 24 h after a single oral dose of lemborexant (30 mg/kg). All data are presented as means ± SEM (n = 5 mice at each time point).

Table 2.

Pharmacokinetic parameters for suvorexant and lemborexant in mice brain.

Parameters	Suvorexant
Parameters	Hip	OFC	LHA
AUC₁₀₋₆₀ (nM·min)	308.12 ± 134.58	440.46 ± 225.49	345.04 ± 155.68
C_max (nM)	8.65 ± 1.53	13.53 ± 5.33	9.94 ± 2.01
t_max (min)	40	20	40
t_1/2 (min)	2272.07 + 215.38	1435.02 + 274.77	1341.68 + 107.9
Parameters	Lemborexant
Parameters	Hip	OFC	LHA
AUC_5–60 (nM·min)	930.67 ± 145.45	479.37 ± 94.35	825.56 ± 155.34
C_max (nM)	30.52 ± 7.67	17.56 ± 4.77	32.07 ± 6.48
t_max (min)	15	15	15
t_1/2 (min)	36.74 + 18.68	29.42 + 3.91	29.49 + 2.91

Effect of OXR antagonist on spontaneous locomotor activity

In this study, we identified the pharmacokinetics of suvorexant and lemborexant in the Hip, OFC, and LHA (Figure 2). However, assessing the brain pharmacokinetics and their effects and side effects is important. The effects of suvorexant and lemborexant on locomotor activity have already been reported.^31,60 However, the effects of suvorexant and lemborexant on locomotor activity 24 h after drug administration and in 6-month-old male WT mice have not been reported. Therefore, we administered a single dose of vehicle, suvorexant (30 mg/kg, p.o.), or lemborexant (30 mg/kg, p.o.) to 6-month-old male WT mice and assessed their locomotor activity immediately and 24 h after administration. In the results measured immediately after administration, locomotor activity decreased in a time-dependent manner in all three groups and was significantly faster in the WT suvorexant and WT lemborexant than in the WT vehicle (Figure 3A, B). Furthermore, WT lemborexant showed a significantly faster decrease in locomotor activity than WT suvorexant. In addition, no significant differences were noted in locomotor activity between the three groups 24 h after administration (Figure 3C, D).

Figure 3.

Effect of suvorexant and lemborexant on spontaneous locomotor activity in 6-month-old WT male mice. (A) Time-course changes in locomotor activity from 0 to 120 min after a single oral dose administration of vehicle, suvorexant, or lemborexant. (B) Locomotor activity for 0 − 60, 60 − 120 min, and 0 − 120 min after a single oral dose administration of vehicle, suvorexant, or lemborexant. (C) Time course of locomotor activity from 0 to 120 min 24 h after oral administration of vehicle, suvorexant, or lemborexant. (D) Locomotor activity for 0 − 60, 60 − 120 min, and 0 − 120 min 24 h after a single oral dose administration of vehicle, suvorexant, or lemborexant. *p < 0.05, **p < 0.01. All data are presented as means ± SEM (n = 9 mice for each group).

Effect of OXR antagonist in the early stage of AD model mice induced cognitive impairment

Suvorexant and almorexant have been reported to suppress cognitive impairment in mouse models of AD.^34,35 Therefore, we investigated the effect of suvorexant and lemborexant on the cognitive impairment observed in App-KI mice. The 4-month-old male and female WT and App-KI mice were assigned to six groups (WT vehicle, WT suvorexant, WT lemborexant, App-KI vehicle, App-KI suvorexant, and App-KI lemborexant) and vehicle, suvorexant (30 mg/kg), or lemborexant (30 mg/kg) was administered orally once a day for 60 d. No group showed any differences in changes in body weight during administration (Figure 4A). After 60 d, cognition was assessed using the Y-maze test. During the 8-min session, the WT vehicle showed approximately 14 arm entries and 72% spontaneous alternation, while the App-KI vehicle showed approximately 12 arm entries; however, spontaneous alternation was significantly lower at 55.8% (Figure 4B, C). For WT suvorexant and WT lemborexant, the arm entries were approximately 16 and 15, respectively, and spontaneous alternation rates were 68.6% and 69.4%, respectively, with no significant differences between them and the WT vehicle. App-KI suvorexant and App-KI lemborexant had approximately 13 arm entries each, which was not significantly different from the App-KI vehicle; however, spontaneous alternation was significantly higher than that of the App-KI vehicle at 68.8% and 68.6%, respectively. Similar results were obtained when sex differences were examined (Supplemental Figures 1 and 2).

Figure 4.

Effect of suvorexant and lemborexant on cognitive impairment in 6-month-old wt and app-ki mice. (A) Sequential changes in body weight during the administration period of vehicle, suvorexant, or lemborexant for 1–60 d. Y-maze test in (B) alteration behavior and (C) total arm entries. **p < 0.01. All data are presented as means ± SEM (n = 29 for WT vehicle, n = 33 for WT suvorexant, n = 29 for WT lemborexant, n = 34 for App-KI vehicle, n = 32 for App-KI suvorexant, n = 34 for App-KI lemborexant).

Effect of OXR antagonist on Aβ accumulation

Aβ accumulation has been reported to correlate with the progression of AD and MCI pathologies and is used for diagnosis.⁶⁷ Suvorexant and almorexant have been reported to inhibit Aβ accumulation in the brains of AD mouse models.^32,34 App-KI mice develop Aβ accumulation in the CA1 region of the Hip at 3–4 months of age.⁶⁸ Therefore, the assessment of Aβ accumulation in the Hip CA1 region is useful for the pathological evaluation of AD. Aβ accumulation in the Hip CA1 region was assessed in mice after behavioral analysis, and the staining area and number of Aβ aggregates were measured. Minute signals were observed in all groups; however, as these differed in shape and size from the Aβ signals seen in App-KI mice, it was concluded that the signals observed in WT mice were not Aβ signals. (Figure 5A). The App-KI vehicle showed 4.18% Aβ-positive areas and about 58 number of Aβ aggregates. Meanwhile, App-KI suvorexant and App-KI lemborexant showed 1.42% and 0.98% Aβ-positive areas, respectively, and approximately 34 and 28 the number of Aβ aggregates, respectively, and compared to App-KI vehicle showed Aβ-positive areas and the number of Aβ aggregates were found to be significantly decreased (Figure 5B, C).

Figure 5.

Effect of suvorexant and lemborexant on Aβ accumulation in 6-month-old App-KI mice. Immunohistochemistry. (A) Representative images of the hippocampal CA1 region. Measurement (B) area and (C) number of Aβ debris. **p < 0.01. All data are presented as means ± SEM (n = 6 mice for each group, 6-images/sample). Scale bar = 500 μm and 100 μm.

Effect of OXR antagonist on Aβ uptake

It has been reported that one of the mechanisms for Aβ clearance in the brain is phagocytosis by glial cells.^69–71 To investigate the cause of reduced Aβ accumulation, the uptake of Aβ in App-KI mice was evaluated by quantifying the amount of CD68 on Aβ aggregates. CD68 is closely related to the LAMP family and is a membrane glycoprotein mainly localized in late endosomes and lysosomes. Histologically, it is used as a marker of phagocytic activity in macrophages/microglia. Therefore, we evaluated the uptake of Aβ by activated microglia by quantifying the amount of CD68 present on Aβ aggregates. The results showed that the App-KI vehicle exhibited 31% CD68-positive areas on Aβ aggregates. Meanwhile, App-KI suvorexant and App-KI lemborexant showed 46.6% and 43.2% CD68-positive areas on Aβ aggregates, respectively. Compared to the App-KI vehicle, the areas of CD68-positive areas on Aβ aggregates were found to be significantly increased (Figure 6B). Additionally, when the number of Iba1-positive microglia on Aβ aggregates was counted, no significant differences were observed between the groups (Figure 6C).

Figure 6.

Effect of suvorexant and lemborexant on Aβ uptake in 6-month-old App-KI mice. Immunohistochemistry. (A) Representative images of the CD68, Iba1, and Aβ in the hippocampal CA1 region. Measurement (B) CD68 area on Aβ accumulation, (C) the number of Iba1-positive microglia on Aβ accumulation. *p < 0.05 and **p < 0.01 versus App-KI vehicle. All data are presented as means ± SEM (n = 6 mice for each group, 3–9 images/sample). Scale bar = 100 μm.

Discussion

In this experiment, we showed that OX1R and OX2R genes were expressed in the Hip, OFC, cerebral cortex, striatum, nucleus accumbens, and LHA tissues. These results are consistent with previously reported in situ hybridization results for the OX1R and OX2R genes.^55,56,72 These brain regions are innervated by OX nerves,^14,73 and have been implicated in clock and circadian oscillations, memory, decision making, feeding, and motor activity.^74–80 Additionally, the OX1R and OX2R genes were most highly expressed in the LHA between these brain regions in 6-month-old male WT mice. Endogenous OX release at the LHA has an excitatory effect and may lead to the amplification of excitation by further activating other OX neurons.⁸¹ These considerations made it reasonable to assess the efficacy of OXR antagonists in these brain regions in 6-month-old male WT mice. Furthermore, the increased expression of the OX1R gene in the OFC, LHA, and Hip regions of App-KI mice, compared with WT mice, suggests an abnormality in OX signaling in App-KI mice.

Suvorexant and lemborexant were administered as single oral doses to 6-month-old male WT mice, and their pharmacokinetics in the Hip, OFC, and LHA were investigated. The results of the brain pharmacokinetic analysis of suvorexant and lemborexant showed slight differences between tissues, but the highest levels were detected after 20 − 40 min for suvorexant (after 20 min for OFC, after 40 min for Hip and LHA) and 15 min for lemborexant in all three brain regions. These results were not entirely consistent with previously reported plasma drug level-time profiles.^63,82 This may be due to differences in postabsorptive drug transfer and tissue excretion. Furthermore, in suvorexant, drug levels above Ki values of OX1R and OX2R (OX1R, 0.55 nM; OX2R, 0.35 nM) were detected in the Hip, OFC, and LHA up to 24 h after administration. Meanwhile, drug levels above the Ki values of OX1R and OX2R (OX1R, 8.1 nM; OX2R, 0.48 nM) were detected only in the Hip at 24 h after administration in lemborexant, but only OX2R was detected above Ki values in the OFC and LHA. These results suggest that suvorexant or lemborexant administered orally at 30 mg/kg may be effective in the brain 24 h after administration.

Regarding the effects of vehicle, suvorexant, or lemborexant on locomotor activity in 6-month-old male WT mice, all three groups showed a chronological decrease in locomotor activity immediately after administration; however, WT suvorexant and WT lemborexant showed a significant decrease compared to the WT vehicle. Furthermore, WT lemborexant caused a significantly faster decrease in locomotor activity than WT suvorexant. This suggests that lemborexant may have a greater physiological inhibitory effect than the same dose of suvorexant. Previous reports have shown that lemborexant is more effective than suvorexant in improving sleep onset than suvorexant.⁸³ However, no effect was observed in locomotor activity after 24 h. No significant differences were noted between the control and OXR antagonist-treated groups in awake time, non-REM sleep time, and REM sleep time 24 h after suvorexant administration and 12 h after lemborexant administration.^84,85 Combined with the results of the brain pharmacokinetic analysis, the drug was still effective in the brain after 24 h administration but did not affect locomotor activity. Therefore, administering 30 mg/kg orally once a day to assess its effects on cognitive function seems reasonable. However, AD is a neurodegenerative disease; therefore, repeated drug administration has been used to assess its effects on cognitive function.

In the Y-maze study, cognitive function was significantly impaired in the App-KI vehicle compared to the WT vehicle, consistent with previous reports.^39,57 Furthermore, repeated administration of suvorexant or lemborexant significantly improved cognitive impairment observed in the App-KI vehicle. These results are consistent with those of previous reports of improved cognitive impairment in AD models after repeated administration of suvorexant or almorexant.^34,35 Furthermore, suvorexant or lemborexant had no effect on arm entry. The results for arm entry in the Y-maze test and locomotor activity test, this drug did not affect locomotor activity not only 24 h after a single dose but also 24 h after repeated administration. These results suggest that suvorexant and lemborexant inhibit the pathophysiology of AD without affecting motor activity 24 h after administration and ameliorate cognitive impairment in the early stages of AD. In this study, the effects of suvorexant and lemborexant were only examined using the Y-maze test, but App-KI mice have also been reported to show impairments in other tests that assess cognitive function, such as the novel object recognition test, water maze test, and contextual fear conditioning.⁸⁶ Therefore, the effects of suvorexant and lemborexant should be examined in other behavioral analyses.

Immunohistochemical analysis revealed that repeated administration of suvorexant or lemborexant suppressed Aβ accumulation and enhanced its uptake by activated microglia in the Hip CA1 region. Suvorexant and lemborexant induce sleep by antagonizing the G protein-coupled receptors (OX1R and OX2R). Therefore, the decrease in Aβ in the Hip CA1 region may also be mainly due to OX1R and OX2R antagonism. Several postmortem analyses of brains from patients with AD have reported abnormalities in PLA and PLD, since these molecules are downstream of orexin receptors.^87–89 Additionally, An et al. reported that OX inhibits phagocytosis and degradation of Aβ fibrils by microglial cells.⁹⁰ Moreover, during sleep, debris, such as Aβ, tau protein, and misfolded proteins, in the brain are removed by the glymphatic pathway.^18,25,27,91 Furthermore, Fujita et al. reported that astrocytes and neurons can phagocytose Aβ via the MEGF10 receptors,⁷¹ and that they can also endocytose Aβ.⁹² Such findings have been reported. Although this study identified only one cause of Aβ reduction, these reports suggest that repeated administration of suvorexant and lemborexant may also influence the underlying mechanisms of Aβ reduction. Therefore, our results support these reports, and we plan to conduct more detailed investigations in the future.

In conclusion, the results of this study revealed the expression of the OX1R and OX2R genes in the brains of WT and App-KI mice, suvorexant and lemborexant on brain pharmacokinetics and the effect on locomotor activity in WT mice. Therefore, the efficacy of a single oral dose of 30 mg/kg and its safety after 24 h were assessed, providing new information on the use of suvorexant and lemborexant. Additionally, our results showed that repeated administration of suvorexant or lemborexant mitigated cognitive impairment in App-KI mice. We also established that this phenomenon was partly due to increased Aβ uptake by activated microglia. This study is the first to report that abnormalities in OX signaling in App-KI mice, and long-term oral administration of suvorexant and lemborexant, suppress Aβ accumulation and cognitive impairment by enhancing Aβ uptake by activated microglia in the brains of App-KI mice. However, several challenges remain. For example, abnormalities in neurotransmitters (dopamine, serotonin, glutamate, GABA, histamine, adrenaline, noradrenaline, glycine, and acetylcholine) are some of the causes of cognitive impairment,^93–97 and OXR antagonists may have improved them. OX has been reported to regulate dopamine, serotonin, GABA, and glutamate neurons, among others;^98–100 these nerves have also been discussed for their involvement in AD pathology,^101–104 and suvorexant and lemborexant may indirectly normalize their neural functions. Therefore, whether these symptoms improve with repeated administration of suvorexant or lemborexant must be investigated. In addition, repeated administration of suvorexant or lemborexant suppressed Aβ accumulation in the Hip CA1 region of early-stage AD model mice, which may also ameliorate previously reported synaptic morphological and electrophysiological changes in the Hip CA1 region, the turnover of proteins associated with presynaptic terminals previously reported in App-KI mice.^68,105–107 This study did not find any significant differences between suvorexant and lemborexant, except for locomotor activity outcomes. This suggests that these differences cannot be assessed by cognitive function assessment or Aβ quantification and that electrophysiology and sleep-related factors need to be evaluated. Furthermore, this study showed that suvorexant and lemborexant effectively suppressed the pathology of MCI and early AD. However, their effects on the intermediate and late stages of AD remain unclear and require further investigation. Based on these considerations, further studies on factors associated with cognitive dysfunction and Aβ reduction in this study will elucidate the regulatory mechanisms of AD pathology through OX neurons and lead to new therapeutic approaches for patients with early-stage AD.

Footnotes

Acknowledgements

We would like to thank Editage () for English language editing.

ORCID iD

Kiyofumi Yamada

Kazuhiro Hada

Kayoko Ozeki

Takaomi C. Saido

Ethical considerations

All animal experiments were approved and performed according to the Animal Care and Use Regulations of the School of Pharmacy, Aichi Gakuin University, Nagoya, Japan.

Author contribution(s)

Kazuhiro Hada: Conceptualization; Data curation; Formal analysis; Funding acquisition; Investigation; Methodology; Project administration; Resources; Supervision; Visualization; Writing – original draft.

Yuki Murata: Methodology; Resources; Writing – original draft.

Yoshiaki Ohi: Funding acquisition; Supervision; Writing – review & editing.

Sana Hashimoto: Investigation.

Hinata Watanabe: Investigation.

Kayoko Ozeki: Supervision; Writing – review & editing.

Takaomi C Saido: Resources; Writing – review & editing.

Takashi Saito: Resources; Writing – review & editing.

Hiroki Sasaguri: Resources; Writing – review & editing.

Hiroyuki Mizoguchi: Funding acquisition; Supervision; Writing – review & editing.

Kiyofumi Yamada: Funding acquisition; Supervision; Writing – review & editing.

Yoshifumi Wakiya: Supervision; Writing – review & editing.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by Grant of AMED, Japan (JP21wm0425014); The Clinical Research Promotion Foundation (2022); Ichihara International Scholarship Foundation (2022); Institute of Pharmaceutical Life Sciences, Aichi Gakuin University (2022-23); THE HORI SCIENCE AND ARTS FOUNDATION (2023), The Nitto Foundation (2024), THE FORDAYS FOUNDATION (2024) Grant-in-Aid for Early-Career Scientists (23K14364; 2023-2026).

Declaration of conflicting interests

The authors declared the following potential conflicts of interest with respect to the research, authorship, and/or publication of this article: Takaomi C. Saido is an Editorial Board Member of this journal but was not involved in the peer-review process of this article nor had access to any information regarding its peer-review.

Data availability statement

The data supporting the findings of this study are available within the article and/or its supplemental material.

Supplemental material

Supplemental material for this article is available online.

References

Petersen

Lopez

Armstrong

, et al. Practice guideline update summary: mild cognitive impairment: report of the guideline development, dissemination, and implementation subcommittee of the American academy of neurology. Neurology 2018; 90: 126–135.

Albert

DeKosky

Dickson

, et al. The diagnosis of mild cognitive impairment due to Alzheimer's disease: recommendations from the National Institute on Aging-Alzheimer's Association workgroups on diagnostic guidelines for Alzheimer's disease. Alzheimers Dement 2011; 7: 270–279.

Dubois

Feldman

Jacova

, et al. Advancing research diagnostic criteria for Alzheimer's disease: the IWG-2 criteria. Lancet Neurol 2014; 13: 614–629.

Wattmo

Londos

Minthon

. Longitudinal associations between survival in Alzheimer's disease and cholinesterase inhibitor use, progression, and community-based services. Dement Geriatr Cogn Disord 2015; 40: 297–310.

Solopova

Romero-Fernandez

Harmsen

, et al. Fatal iatrogenic cerebral β-amyloid-related arteritis in a woman treated with lecanemab for Alzheimer's disease. Nat Commun 2023; 14: 8220.

Swanson

Zhang

Dhadda

, et al. A randomized, double-blind, phase 2b proof-of-concept clinical trial in early Alzheimer's disease with lecanemab, an anti-Aβ protofibril antibody. Alzheimers Res Ther 2021; 13: 80.

Swanson

Zhang

Dhadda

, et al. Correction to: a randomized, double-blind, phase 2b proof-of-concept clinical trial in early Alzheimer's disease with lecanemab, an anti-Aβ protofibril antibody. Alzheimers Res Ther 2022; 14: 70.

Zimmer

Ardayfio

Wang

, et al. Amyloid-related imaging abnormalities with donanemab in early symptomatic Alzheimer disease: secondary analysis of the TRAILBLAZER-ALZ and ALZ 2 randomized clinical trials. JAMA Neurol 2025; 82: 461–469.

Gabelle

Jaussent

Hirtz

, et al. Cerebrospinal fluid levels of orexin-A and histamine, and sleep profile within the Alzheimer process. Neurobiol Aging 2017; 53: 59–66.

10.

Liguori

Chiaravalloti

Nuccetelli

, et al. Hypothalamic dysfunction is related to sleep impairment and CSF biomarkers in Alzheimer's disease. J Neurol 2017; 264: 2215–2223.

11.

Sakurai

Amemiya

Ishii

, et al. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 1998; 92: 573–585.

12.

Zhang

Wang

, et al. Signal transduction, dimerization, and therapeutic targeting of Orexin and receptor systems. Front Pharmacol 2025; 16: 1697406.

13.

de Lecea

Kilduff

Peyron

, et al. The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A 1998; 95: 322–327.

14.

Peyron

Tighe

van den Pol

, et al. Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 1998; 18: 9996–10015.

15.

Sakurai

. The neural circuit of orexin (hypocretin): maintaining sleep and wakefulness. Nat Rev Neurosci 2007; 8: 171–181.

16.

Allard

Tizabi

Shaffery

, et al. Stereological analysis of the hypothalamic hypocretin/orexin neurons in an animal model of depression. Neuropeptides 2004; 38: 311–315.

17.

Fronczek

van Geest

Frölich

, et al. Hypocretin (orexin) loss in Alzheimer's disease. Neurobiol Aging 2012; 33: 1642–1650.

18.

Iliff

Wang

Liao

, et al. A paravascular pathway facilitates CSF flow through the brain parenchyma and the clearance of interstitial solutes, including amyloid β. Sci Transl Med 2012; 4: 147ra111.

19.

Kitamura

Hamada

Kanazawa

, et al. The effect of orexin-A on the pathological mechanism in the rat focal cerebral ischemia. Neurosci Res 2010; 68: 154–157.

20.

Liguori

Nuccetelli

Izzi

, et al. Rapid eye movement sleep disruption and sleep fragmentation are associated with increased orexin-A cerebrospinal-fluid levels in mild cognitive impairment due to Alzheimer's disease. Neurobiol Aging 2016; 40: 120–126.

21.

Nishino

Kanbayashi

. Symptomatic narcolepsy, cataplexy and hypersomnia, and their implications in the hypothalamic hypocretin/orexin system. Sleep Med Rev 2005; 9: 269–310.

22.

Nishino

Ripley

Overeem

, et al. Hypocretin (orexin) deficiency in human narcolepsy. Lancet 2000; 355: 39–40.

23.

Nishino

Ripley

Overeem

, et al. Low cerebrospinal fluid hypocretin (orexin) and altered energy homeostasis in human narcolepsy. Ann Neurol 2001; 50: 381–388.

24.

Salomon

Ripley

Kennedy

, et al. Diurnal variation of cerebrospinal fluid hypocretin-1 (orexin-A) levels in control and depressed subjects. Biol Psychiatry 2003; 54: 96–104.

25.

Sharkey

Cortese

Goodyear

, et al. Longitudinal analysis of glymphatic function in amyotrophic lateral sclerosis and primary lateral sclerosis. Brain 2024; 147: 4026–4032.

26.

Thannickal

Moore

Nienhuis

, et al. Reduced number of hypocretin neurons in human narcolepsy. Neuron 2000; 27: 469–474.

27.

Xie

Kang

, et al. Sleep drives metabolite clearance from the adult brain. Science 2013; 342: 373–377.

28.

Liu

Wang

Tang

, et al. Amyloid β and tau are involved in sleep disorder in Alzheimer's disease by orexin A and adenosine A(1) receptor. Int J Mol Med 2019; 43: 435–442.

29.

Gao

Liu

Tuo

, et al. The role of orexin in Alzheimer disease: from sleep-wake disturbance to therapeutic target. Neurosci Lett 2021; 765: 136247.

30.

Beuckmann

Suzuki

Ueno

, et al. In vitro and in silico characterization of lemborexant (E2006), a novel dual orexin receptor antagonist. J Pharmacol Exp Ther 2017; 362: 287–295.

31.

Winrow

Gotter

Cox

, et al. Promotion of sleep by suvorexant-a novel dual orexin receptor antagonist. J Neurogenet 2011; 25: 52–61.

32.

Kang

Lim

Bateman

, et al. Amyloid-beta dynamics are regulated by orexin and the sleep-wake cycle. Science 2009; 326: 1005–1007.

33.

Lucey

Liu

Toedebusch

, et al. Suvorexant acutely decreases tau phosphorylation and Aβ in the human CNS. Ann Neurol 2023; 94: 27–40.

34.

Zhou

Yan

Wang

, et al. Suvorexant ameliorates cognitive impairments and pathology in APP/PS1 transgenic mice. Neurobiol Aging 2020; 91: 66–75.

35.

Zhou

. Effect of different doses of almorexant on learning and memory in 8-month-old APP/PS1 (AD) mice. Peptides 2023; 167: 171044.

36.

Durairaja

Steinecke

Fendt

. Intracerebroventricular infusion of the selective orexin 1 receptor antagonist SB-334867 impairs cognitive flexibility in a sex-dependent manner. Behav Brain Res 2022; 424: 113791.

37.

Gao

, et al. Selective orexin 1 receptor antagonist SB-334867 aggravated cognitive dysfunction in 3xTg-AD mice. Behav Brain Res 2023; 438: 114171.

38.

, et al. Selective orexin 2 receptor blockade alleviates cognitive impairments and the pathological progression of Alzheimer's disease in 3xTg-AD mice. J Gerontol A Biol Sci Med Sci 2024; 79: glae115.

39.

Saito

Matsuba

Mihira

, et al. Single app knock-in mouse models of Alzheimer's disease. Nat Neurosci 2014; 17: 661–663.

40.

Sasaguri

Nilsson

Hashimoto

, et al. APP Mouse models for Alzheimer's disease preclinical studies. EMBO J 2017; 36: 2473–2487.

41.

Hada

Wulaer

Nagai

, et al. Mice carrying a schizophrenia-associated mutation of the Arhgap10 gene are vulnerable to the effects of methamphetamine treatment on cognitive function: association with morphological abnormalities in striatal neurons. Mol Brain 2021; 14: 21.

42.

Ventzke

Oster

Jöhren

. Diurnal regulation of the orexin/hypocretin system in mice. Neuroscience 2019; 421: 59–68.

43.

Franklin

Paxinos

. The Mouse brain in stereotaxic coordinates. San Diego, CA: Academic Press, 1997.

44.

Mano

Ueno

Hotta

. Establishment of a simultaneous assay for lemborexant, a novel dual orexin receptor antagonist, and its three metabolites, and its application to a clinical protein binding study. J Pharm Biomed Anal 2020; 187: 113359.

45.

Skillman

BKS

. Identification of suvorexant in blood using LC-MS-MS: important considerations for matrix effects and quantitative interferences in targeted assays. J Anal Toxicol 2020; 44: 245–255.

46.

Skillman

Kerrigan

. Drug-mediated ion suppression and mitigation of interferences using liquid chromatography-quadrupole/time of flight mass spectrometry (LC-Q/TOF-MS) and liquid chromatography tandem mass spectrometry (LC-MS/MS). J Chromatogr B Analyt Technol Biomed Life Sci 2020; 1152: 122265.

47.

Skillman

Kerrigan

. CYP450-Mediated Metabolism of suvorexant and investigation of metabolites in forensic case specimens. Forensic Sci Int 2020; 312: 110307.

48.

Takase

Liao

Liu

, et al. Antipsychotic-like effects of fasudil, a Rho-kinase inhibitor, in a pharmacologic animal model of schizophrenia. Eur J Pharmacol 2022; 931: 175207.

49.

Sawahata

Asano

Nagai

, et al. Microinjection of Reelin into the mPFC prevents MK-801-induced recognition memory impairment in mice. Pharmacol Res 2021; 173: 105832.

50.

Yamada

Hiramatsu

Noda

, et al. Role of nitric oxide and cyclic GMP in the dizocilpine-induced impairment of spontaneous alternation behavior in mice. Neuroscience 1996; 74: 365–374.

51.

Yamada

Noda

Hasegawa

, et al. The role of nitric oxide in dizocilpine-induced impairment of spontaneous alternation behavior in mice. J Pharmacol Exp Ther 1996; 276: 460–466.

52.

Wulaer

Nagai

Sobue

, et al. Repetitive and compulsive-like behaviors lead to cognitive dysfunction in Disc1(Delta2-3/Delta2-3) mice. Genes Brain Behav 2018; 17: e12478.

53.

Saifullah

MAB

Komine

Dong

, et al. Touchscreen-based location discrimination and paired associate learning tasks detect cognitive impairment at an early stage in an App knock-in mouse model of Alzheimer's disease. Mol Brain 2020; 13: 147.

54.

Sobue

Komine

Endo

, et al. Microglial cannabinoid receptor type II stimulation improves cognitive impairment and neuroinflammation in Alzheimer's disease mice by controlling astrocyte activation. Cell Death Dis 2024; 15: 858.

55.

Marcus

Aschkenasi

Lee

, et al. Differential expression of orexin receptors 1 and 2 in the rat brain. J Comp Neurol 2001; 435: 6–25.

56.

Trivedi

MacNeil

, et al. Distribution of orexin receptor mRNA in the rat brain. FEBS Lett 1998; 438: 71–75.

57.

Moriguchi

Inagaki

Saito

, et al. Propolis promotes memantine-dependent rescue of cognitive deficits in APP-KI mice. Mol Neurobiol 2022; 59: 4630–4646.

58.

Loryan

Hammarlund-Udenaes

Syvänen

. Brain distribution of drugs: pharmacokinetic considerations. Handb Exp Pharmacol 2022; 273: 121–150.

59.

Beuckmann

Suzuki

Musiek

, et al. Evaluation of SAMP8 mice as a model for sleep-wake and rhythm disturbances associated with Alzheimer's disease: impact of treatment with the dual orexin (hypocretin) receptor antagonist lemborexant. J Alzheimers Dis 2021; 81: 1151–1167.

60.

Beuckmann

Ueno

Nakagawa

, et al. Preclinical in vivo characterization of lemborexant (E2006), a novel dual orexin receptor antagonist for sleep/wake regulation. Sleep 2019; 42: zsz076.

61.

Breidinger

Simpson

Mangin

, et al. Determination of suvorexant in human plasma using 96-well liquid-liquid extraction and HPLC with tandem mass spectrometric detection. J Chromatogr B Analyt Technol Biomed Life Sci 2015; 1002: 254–259.

62.

Keenan

Daykin

Metha

, et al. Orexin 2 receptor antagonism sex-dependently improves sleep/wakefulness and cognitive performance in tau transgenic mice. Br J Pharmacol 2024; 181: 87–106.

63.

Sun

Kennedy

Wilbraham

, et al. Effects of suvorexant, an orexin receptor antagonist, on sleep parameters as measured by polysomnography in healthy men. Sleep 2013; 36: 259–267.

64.

Palmqvist

Schöll

Strandberg

, et al. Earliest accumulation of β-amyloid occurs within the default-mode network and concurrently affects brain connectivity. Nat Commun 2017; 8: 1214.

65.

Mormino

Kluth

Madison

, et al. Episodic memory loss is related to hippocampal-mediated beta-amyloid deposition in elderly subjects. Brain 2009; 132: 1310–1323.

66.

Zheng

Zhou

, et al. The hypothalamus as the primary brain region of metabolic abnormalities in APP/PS1 transgenic mouse model of Alzheimer's disease. Biochim Biophys Acta Mol Basis Dis 2018; 1864: 263–273.

67.

Chételat

Arbizu

Barthel

, et al. Amyloid-PET and (18)F-FDG-PET in the diagnostic investigation of Alzheimer's disease and other dementias. Lancet Neurol 2020; 19: 951–962.

68.

Gast

, et al. Hippocampal neural circuit connectivity alterations in an Alzheimer's disease mouse model revealed by monosynaptic rabies virus tracing. Neurobiol Dis 2022; 172: 105820.

69.

Lee

Landreth

. The role of microglia in amyloid clearance from the AD brain. J Neural Transm (Vienna) 2010; 117: 949–960.

70.

Liu

Frost

, et al. Complement component C3 and complement receptor type 3 contribute to the phagocytosis and clearance of fibrillar Aβ by microglia. Glia 2012; 60: 993–1003.

71.

Fujita

Maeda

Sato

, et al. Engulfment of toxic amyloid β-protein in neurons and astrocytes mediated by MEGF10. Neuroscience 2020; 443: 1–7.

72.

Tsuneoka

Funato

. Whole brain mapping of orexin receptor mRNA expression visualized by branched in situ hybridization chain reaction. eNeuro 2024; 11: ENEURO.0474–23.2024.

73.

Nambu

Sakurai

Mizukami

, et al. Distribution of orexin neurons in the adult rat brain. Brain Res 1999; 827: 243–260.

74.

Harris

Wimmer

Aston-Jones

. A role for lateral hypothalamic orexin neurons in reward seeking. Nature 2005; 437: 556–559.

75.

Karimi

Hamidi

Fatahi

, et al. Orexin 1 receptors in the anterior cingulate and orbitofrontal cortex regulate cost and benefit decision-making. Prog Neuropsychopharmacol Biol Psychiatry 2019; 89: 227–235.

76.

Kotz

Teske

Levine

, et al. Feeding and activity induced by orexin A in the lateral hypothalamus in rats. Regul Pept 2002; 104: 27–32.

77.

Jiang

Zhang

. Orexin signaling regulates both the hippocampal clock and the circadian oscillation of Alzheimer's disease-risk genes. Sci Rep 2016; 6: 36035.

78.

Mavanji

Butterick

Duffy

, et al. Orexin/hypocretin treatment restores hippocampal-dependent memory in orexin-deficient mice. Neurobiol Learn Mem 2017; 146: 21–30.

79.

Thorpe

Kotz

. Orexin A in the nucleus accumbens stimulates feeding and locomotor activity. Brain Res 2005; 1050: 156–162.

80.

Yang

Zou

Xiong

, et al. Hypocretin/orexin neurons contribute to hippocampus-dependent social memory and synaptic plasticity in mice. J Neurosci 2013; 33: 5275–5284.

81.

Burt

Alberto

Parsons

, et al. Local network regulation of orexin neurons in the lateral hypothalamus. Am J Physiol Regul Integr Comp Physiol 2011; 301: R572–R580.

82.

Landry

Aluri

Hall

, et al. Effect of gastric acid-reducing agents on the pharmacokinetics and efficacy of lemborexant. Pharmacol Res Perspect 2020; 8: e00678.

83.

Yue

Chang

Zheng

, et al. Efficacy and tolerability of pharmacological treatments for insomnia in adults: a systematic review and network meta-analysis. Sleep Med Rev 2023; 68: 101746.

84.

Mahoney

Mochizuki

Scammell

. Dual orexin receptor antagonists increase sleep and cataplexy in wild type mice. Sleep 2020; 43: zsz302.

85.

Tsuneki

Kon

Ito

, et al. Timed inhibition of orexin system by suvorexant improved sleep and glucose metabolism in type 2 diabetic db/db mice. Endocrinology 2016; 157: 4146–4157.

86.

Sakakibara

Sekiya

Saito

, et al. Amyloid-β plaque formation and reactive gliosis are required for induction of cognitive deficits in App knock-in mouse models of Alzheimer's disease. BMC Neurosci 2019; 20: 13.

87.

Gattaz

Maras

Cairns

, et al. Decreased phospholipase A2 activity in Alzheimer brains. Biol Psychiatry 1995; 37: 13–17.

88.

Krishnan

Kayed

Taglialatela

. Elevated phospholipase D isoform 1 in Alzheimer's disease patients’ hippocampus: relevance to synaptic dysfunction and memory deficits. Alzheimers Dement (N Y) 2018; 4: 89–102.

89.

Ross

Moszczynska

Erlich

, et al. Phospholipid-metabolizing enzymes in Alzheimer's disease: increased lysophospholipid acyltransferase activity and decreased phospholipase A2 activity. J Neurochem 1998; 70: 786–793.

90.

Cho

Kim

, et al. Orexin impairs the phagocytosis and degradation of amyloid-β fibrils by microglial cells. J Alzheimers Dis 2017; 58: 253–261.

91.

Ishida

Yamada

Nishiyama

, et al. Glymphatic system clears extracellular tau and protects from tau aggregation and neurodegeneration. J Exp Med 2022; 219: e20211275.

92.

Domínguez-Prieto

Velasco

Tabernero

, et al. Endocytosis and transcytosis of amyloid-β peptides by astrocytes: a possible mechanism for amyloid-β clearance in Alzheimer's disease. J Alzheimers Dis 2018; 65: 1109–1124.

93.

Nieoullon

. Dopamine and the regulation of cognition and attention. Prog Neurobiol 2002; 67: 53–83.

94.

Švob Štrac

Pivac

Mück-Šeler

. The serotonergic system and cognitive function. Transl Neurosci 2016; 7: 35–49.

95.

Volk

Chiu

Sharma

, et al. Glutamate synapses in human cognitive disorders. Annu Rev Neurosci 2015; 38: 127–149.

96.

Sun

Chen

, et al. Implications of GABAergic neurotransmission in Alzheimer's disease. Front Aging Neurosci 2016; 8: 31.

97.

Pepeu

Giovannini

. Changes in acetylcholine extracellular levels during cognitive processes. Learn Mem 2004; 11: 21–27.

98.

Aracri

Banfi

Pasini

, et al. Hypocretin (orexin) regulates glutamate input to fast-spiking interneurons in layer V of the Fr2 region of the murine prefrontal cortex. Cereb Cortex 2015; 25: 1330–1347.

99.

Liu

van den Pol

Aghajanian

. Hypocretins (orexins) regulate serotonin neurons in the dorsal raphe nucleus by excitatory direct and inhibitory indirect actions. J Neurosci 2002; 22: 9453–9464.

100.

Nakamura

Uramura

Nambu

, et al. Orexin-induced hyperlocomotion and stereotypy are mediated by the dopaminergic system. Brain Res 2000; 873: 181–187.

101.

Calvo-Flores Guzmán

Vinnakota

Govindpani

, et al. The GABAergic system as a therapeutic target for Alzheimer's disease. J Neurochem 2018; 146: 649–669.

102.

Claeysen

Bockaert

Giannoni

. Serotonin: a new hope in Alzheimer's disease? ACS Chem Neurosci 2015; 6: 940–943.

103.

Francis

. Glutamatergic systems in Alzheimer's disease. Int J Geriatr Psychiatry 2003; 18: S15–S21.

104.

Martorana

Koch

. Is dopamine involved in Alzheimer's disease? Front Aging Neurosci 2014; 6: 252.

105.

Bevan

Hughes

Williams

, et al. Retinal ganglion cell degeneration correlates with hippocampal spine loss in experimental Alzheimer's disease. Acta Neuropathol Commun 2020; 8: 216.

106.

Blume

Filser

Sgobio

, et al. β-secretase inhibition prevents structural spine plasticity deficits in App (NL-G-F) mice. Front Aging Neurosci 2022; 14: 909586.

107.

Hark

Rao

Castillon

, et al. Pulse-chase proteomics of the app knockin mouse models of Alzheimer's disease reveals that synaptic dysfunction originates in presynaptic terminals. Cell Syst 2021; 12: 141–158.e149.