THRA Orchestrates Myocardial Protection Against Hypothyroidism-Induced Ferroptosis via the GATA4-GPX4 Transcriptional Cascade

Abstract

Aims:

Hypothyroidism frequently causes myocardial injury, but the role of thyroid hormone receptor alpha (THRA) remains unclear. This study investigated the function and mechanism of THRA in hypothyroidism-associated cardiac damage.

Methods:

A propylthiouracil (PTU)-induced hypothyroid mouse model was utilized, incorporating wild-type and THRA-knockout (KO) groups with or without thyroxine (T4) treatment. Systemic parameters, cardiac injury, histopathology, and molecular pathways were analyzed using enzyme-linked immunosorbent assay, immunohistochemistry, Western blot, quantitative polymerase chain reaction, RNA sequencing, chromatin immunoprecipitation, and dual-luciferase reporter assays.

Results:

PTU-induced hypothyroidism significantly reduced body weight, impaired cardiac function, and dysregulated thyroid hormones. THRA KO exacerbated these effects and completely abolished the therapeutic response to T4. Crucially, group KO-M markedly elevated markers of ferroptosis, including iron overload, malondialdehyde, and reactive oxygen species, while suppressing the reduced-to-oxidized glutathione ratio (GSH/GSSG) and key antiferroptotic proteins like glutathione peroxidase 4 (GPX4), compared with group M. Mechanistically, we identified GATA binding protein 4 (GATA4) as an upstream transcriptional activator of THRA. Furthermore, THRA itself directly bound to the GPX4 promoter and transactivated its expression. This GATA4-THRA-GPX4 axis was essential for cardioprotection, alongside modulation of the phosphoinositide 3-kinase/protein kinase B signaling pathway.

Conclusion:

This study defines the GATA4-THRA-GPX4 transcriptional axis as a crucial mechanism that protects the heart from hypothyroidism-driven ferroptosis, uncovering a previously unrecognized transcriptional axis that is crucial for cardioprotection during hypothyroidism. Antioxid. Redox Signal. 44, 236–250.

Keywords

hypothyroidism myocardial injury ferroptosis

Introduction

Hypothyroidism, a prevalent disorder in the field of endocrinology, is characterized by reduced synthesis or secretion of thyroid hormones or by a decreased responsiveness of the body to these hormones, leading to a series of metabolic disturbances (Udovcic et al., 2017). Hypothyroidism not only affects the overall metabolic rate but also frequently accompanies alterations in cardiac structure and function, with myocardial injury being one of its significant complications (Yao et al., 2018). Manifestations of myocardial injury in hypothyroid patients include myocardial hypertrophy, weakened contractile function, and arrhythmias, which can progress to heart failure in severe cases (Sabatino et al., 2014).

The thyroid hormone receptor alpha (THRA), as one of the primary receptors for thyroid hormones within cells, is responsible for mediating the signaling of these hormones (Alfadda et al., 2018). Mutations in the THRA gene are a known cause of resistance to thyroid hormone, a specific form of hypothyroidism characterized by reduced responsiveness to thyroid hormone supplementation (Hwang et al., 2023; Tylki-Szymańska et al., 2015). Clinically, a subset of hypothyroid patients exhibits inadequate response to thyroxine (T4) treatment, and pituitary-independent mechanisms, such as genetic variations in THRA, are suspected to underpin this treatment resistance (Lacámar et al., 2020). While the role of THRA in development and general metabolism is established, its cell-specific protective functions in the heart, particularly under pathological conditions like hypothyroidism, remain poorly understood. Given the critical dependence of the heart on thyroid hormone, we sought to investigate the specific role and mechanism of THRA in hypothyroidism-induced myocardial injury.

In recent years, ferroptosis, a novel form of cell death, has garnered significant attention due to its crucial roles in various diseases (Belavgeni et al., 2020; Lillo-Moya et al., 2021; Rishi et al., 2021; Yang et al., 2021). Ferroptosis refers to cell death induced by the accumulation of iron-dependent lipid peroxides and is intimately linked to cardiovascular diseases (Wang and Wu, 2023; Wu et al., 2023; Xu et al., 2023) and neurodegenerative disorders (Reichert et al., 2020; Wang et al., 2023, 2024). The central guardian against ferroptosis, glutathione peroxidase 4 (GPX4), is known to be transcriptionally regulated by various factors. Given the established role of ferroptosis in cardiac pathology(Fang et al., 2023; Zhang et al., 2023), we hypothesize that THRA deficiency may exacerbate hypothyroidism-induced myocardial injury by promoting ferroptosis. The exploration of this potential link represents a significant gap in our current understanding.

This study provides the first evidence of a GATA binding protein 4 (GATA4)-THRA-GPX4 transcriptional axis in protecting against hypothyroidism-induced myocardial ferroptosis. The identification of GATA4 as an upstream regulator of THRA, along with the elucidation of THRA’s direct transcriptional control over GPX4, provides novel insights into the transcriptional networks governing thyroid hormone receptor expression and its cardioprotective effects. By linking THRA to the phosphoinositide 3-kinase/protein kinase B (PI3K/AKT) signaling pathway and directly to ferroptosis execution, this study offers a comprehensive mechanistic explanation for how THRA deficiency exacerbates myocardial injury. These findings open new avenues for therapeutic interventions targeting this axis in hypothyroid patients with myocardial injury.

Innovation

This study is the first to identify the GATA4-THRA-GPX4 transcriptional axis as a central mechanism protecting against ferroptosis in hypothyroidism-induced myocardial injury. More importantly, it provides a novel molecular basis for the resistance to standard T4 therapy, offering critical insights for developing targeted therapeutic strategies for hypothyroid patients with impaired THRA signaling or those who are refractory to conventional treatment.

Results

Systemic characterization of hypothyroidism-induced physiological alterations and myocardial injury in THRA-deficient mice

The efficiency of THRA gene knockout (KO) was first confirmed by reverse transcription quantitative real-time polymerase chain reaction and Western blot, which revealed a significant reduction of THRA mRNA and protein levels in the hearts of KO-C compared with group C, validating the successful establishment of the genetic model (Fig. 1A, B). We then evaluated the impact of propylthiouracil (PTU)-induced hypothyroidism, T4 treatment, and THRA depletion on systemic physiological parameters across six experimental groups. A significant reduction in body weight was observed in Groups M and T compared with Group C during the initial 2 weeks of the study. T4 administration initiated a partial recovery in body weight in Group T from week 5 onward. A parallel trend was noted in water intake. THRA KO groups (KO-M and KO-T) exhibited a similar significant reduction in these parameters compared with the KO-C group during the early phase. Crucially, T4 treatment failed to elicit a significant improvement in the KO-T group compared with the KO-M group throughout the experimental duration (Fig. 1C, D). The results indicate that hypothyroid mice exhibited poor dietary and hydration status postmodeling, which improved in wild-type (WT) hypothyroid mice after T4 treatment but remained unchanged in THRA KO mice.

FIG. 1.

Impact of THRA gene knockout on cardiac functional damage in PTU-induced hypothyroid mice. Model grouping and treatment: (1) Group C: Normal feeding; (2) Group M: Administered with 0.1% PTU (dose: 1.0 mL/100 g) via intragastric gavage and fed a low-iodine diet for 6 consecutive weeks; (3) Group T: Treated with 0.1% PTU via intragastric gavage and a low-iodine diet, with subcutaneous injections of T4 [dose: 0.95 μg/(100 g·d)] starting from the 4^th week; (4) Group KO-C: Normal feeding of THRA gene knockout mice; (5) Group KO-M: THRA gene knockout mice were administered with 0.1% PTU via intragastric gavage and fed a low-iodine diet for 6 consecutive weeks; and (6) Group KO-T: THRA gene knockout mice were administered with 0.1% PTU via intragastric gavage and a low-iodine diet, with subcutaneous injections of T4 starting from the 4th week. (A, B) Efficiency of THRA gene knockout. THRA mRNA and protein expression levels in myocardial tissue were detected by RT-qPCR and Western blot. (C, D) Effect of THRA knockout on body weight and water intake in hypothyroid mice; (E, F) Effect of THRA knockout on serum T3, T4, and TSH levels in hypothyroid mice; (G) Effect of THRA knockout on serum CK and CK-Mb levels in hypothyroid mice. ns, not significant; **p < 0.01; ***p < 0.001. CK, creatine kinase; CK-Mb, creatine kinase isoenzyme MB; KO, knockout; PTU, propylthiouracil; RT-qPCR, reverse transcription quantitative real-time polymerase chain reaction; T3, triiodothyronine; T4, thyroxine; THRA, thyroid hormone receptor alpha; TSH, thyroid-stimulating hormone.

The systemic effects on endocrine profile and cardiac injury markers were rigorously evaluated using two-way analysis of variance (ANOVA), which revealed significant main effects of Treatment (triiodothyronine [T3]: F(2,54) = 383.20, p < 0.001; T4: F(2,54) = 575.60, p < 0.001; thyroid-stimulating hormone [TSH]: F(2,54) = 294.40, p < 0.001); and Genotype (T3: F(1,54) = 1921.00, p < 0.001; T4: F(1,54) = 2834.00, p < 0.001; TSH: F(1,54) = 1047.00, p < 0.001), along with significant Treatment × Genotype interactions (all p < 0.001) for all hormonal parameters. Post hoc Sidak’s test analysis demonstrated that PTU-induced hypothyroidism (M) significantly reduced serum T3 and T4 levels while elevating TSH in both WT and KO mice (all p < 0.001 vs. respective C groups). Crucially, T4 treatment completely normalized this endocrine profile in WT mice (all p < 0.001), but failed to elicit any significant improvement in THRA-KO mice (all p > 0.05) (Fig. 1E, F).

Cardiac injury markers showed parallel changes. Two-way ANOVA revealed significant main effects of Treatment (creatine kinase [CK]: F(2,54) = 65.07, p < 0.001; creatine kinase isoenzyme MB [CK-Mb]: F(2,54) = 259.40, p < 0.001) and Genotype (CK: F(1,54) = 479.40, p < 0.001; CK-Mb: F(1,54) = 1535.00, p < 0.001), with significant Treatment × Genotype interactions (both p < 0.001) for both cardiac injury markers. Hypothyroidism significantly increased CK and CK-Mb levels in both genotypes (both p < 0.001). While T4 treatment effectively reduced these markers in WT mice (both p < 0.001), it provided no significant benefit in KO mice (both p > 0.05) (Fig. 1G). Collectively, these results demonstrate that THRA deletion exacerbates hypothyroidism-induced systemic dysfunction and myocardial injury. Crucially, the complete abolition of the therapeutic efficacy of T4 replacement in THRA-KO mice establishes that an intact THRA signaling pathway is indispensable for the systemic and cardiac responses to thyroid hormone.

Histopathological evaluation of myocardial architecture and apoptotic signaling in hypothyroid mice with THRA deletion

Hematoxylin and eosin (HE) staining and Masson staining revealed that myocardial tissue cells in the C group were tightly and neatly arranged, with uniform size and regular morphology. In contrast, myocardial tissue cells in the M group were loosely arranged and swollen, with some exhibiting myocardial fiber rupture and collagen fiber deposition in the interstitial space. These pathological features were ameliorated in Group T. The KO-M group exhibited more severe damage compared with the KO-C group, whereas the KO-T group showed a pathology similar to the KO-M group (Fig. 2A, C).

FIG. 2.

Effect of THRA gene knockout on myocardial pathological damage in PTU-induced hypothyroid mice. (A–D) Impact of THRA knockout on myocardial histopathology and fibrosis in hypothyroid mice (HE and Masson staining); (E, F) Effect of THRA knockout on myocardial cell apoptosis in hypothyroid mice (cleaved Caspase-3, IHC); (G) Influence of THRA knockout on myocardial cell apoptosis in hypothyroid mice (qPCR); (H) Influence of THRA knockout on myocardial cell apoptosis in hypothyroid mice (Western Blot). ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001. HE, hematoxylin and eosin; IHC, immunohistochemistry.

Quantitative analysis of HE staining scores was performed using two-way ANOVA followed by Sidak’s multiple comparisons test. Analysis revealed significant main effects of both Treatment (F(2, 12) = 28.50, p < 0.001) and Genotype (F(1,12) = 10.67, p = 0.007), with no significant interaction (F(2,12) = 2.17, p = 0.157). Post hoc analysis confirmed that PTU-induced hypothyroidism (M) significantly exacerbated myocardial injury compared with controls (C) in both WT (p < 0.001) and KO (p = 0.001) mice. Crucially, T4 treatment (T) significantly attenuated this injury in WT mice (T vs. M in WT: p = 0.012), but failed to do so in THRA-KO mice (T vs. M in KO: p = 0.870) (Fig. 2B).

Two-way ANOVA of fibrosis area percentage revealed a significant main effect of Treatment (F(2, 12) = 9.943, p = 0.003), but no significant main effect of Genotype and no significant interaction (P > 0.05). Post hoc Sidak’s test within each genotype demonstrated that PTU-induced hypothyroidism (M) significantly increased cardiac fibrosis compared with the control group (C) in both WT (p = 0.046) and THRA-KO mice (p = 0.015). Crucially, subsequent T4 treatment (T) significantly reversed this fibrosis in WT mice (T vs. M in WT: p = 0.026), but failed to ameliorate it in THRA-KO mice (T vs. M in KO: p = 0.319). In WT mice, the fibrosis level in the T4-treated group (T) was restored to a level comparable with controls (C vs. T in WT: p = 0.946) (Fig. 2D).

At the molecular level, apoptosis was significantly activated in the hypothyroid state. This was evidenced by a significantly increased positive expression rate of Caspase-3 protein, grayscale intensity of Bax protein, and Bax mRNA levels, accompanied by a decrease in Bcl-2 protein expression in Group M compared with Group C. These changes were reversed in Group T. The KO-M group showed similar pro-apoptotic alterations compared with the KO-C group. However, no statistically significant differences were observed in these apoptosis-related markers between the KO-T and KO-M groups (Fig. 2E–H). These findings demonstrate that THRA deletion abrogates the protective effects of T4 treatment against hypothyroidism-induced myocardial histopathological damage and apoptosis. The failure of T4 to rescue the cardiac pathology in KO mice underscores that THRA is an obligatory mediator of thyroid hormone’s cardioprotective action.

Comprehensive analysis of ferroptosis pathway activation in hypothyroidism-induced myocardial injury

To systematically evaluate the activation of ferroptosis, we first assessed key drivers and markers of this process in the myocardium. PTU-induced hypothyroidism (Group M) significantly increased reactive oxygen species (ROS) levels and iron content compared with the control group (Group C), as determined by enzyme-linked immunosorbent assay (ELISA) (Fig. 3A, B). This iron overload was visually confirmed by Prussian blue staining with 3,3′-diaminobenzidine (DAB) enhancement, which revealed prominent iron deposits (brown granules) in the myocardial tissue of Group M mice (Fig. 3C). Concomitantly, the hypothyroid state led to a severe disruption of redox homeostasis, characterized by a significantly reduced reduced-to-oxidized glutathione ratio (GSH/GSSG) (Fig. 3D), decreased activities of the antioxidant enzymes superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px), and an elevated concentration of malondialdehyde (MDA), a marker of lipid peroxidation (Fig. 3E–G). Crucially, T4 treatment in WT mice (Group T) effectively normalized these parameters. T4 treatment provided no significant benefit to THRA KO mice (Group KO-T), as evidenced by the sustained abnormalities across all metrics (Fig. 3A–G).

FIG. 3.

Impact of THRA gene knockout on ferroptosis in the myocardium of hypothyroid mice. (A, B) Effect of THRA knockout on ROS and iron content in myocardial cells of hypothyroid mice (ELISA); (C) Prussian blue staining with DAB enhancement for myocardial iron deposition. Representative images of myocardial tissue sections from each group subjected to Prussian blue staining with DAB enhancement. Iron deposits appear as brownish granules, whereas nuclei are counterstained blue with hematoxylin; (D) Ratio of reduced to oxidized glutathione (GSH/GSSG); (E) Superoxide dismutase (SOD) activity; (F) Malondialdehyde (MDA) concentration; (G) Glutathione peroxidase (GSH-PX) activity; (H, I) Representative IF images of GPX4 protein expression (red) in myocardial tissues. Nuclei are counterstained with DAPI (blue); (J) Representative Western blots and quantification of GPX4 protein expression; (K) Representative Western blots and quantification of HSP27, SLC7A11, and NOX1 protein expression; (L) The mRNA expression levels of GPX4, HSP27, SLC7A11, and ACSL4 detected by qPCR. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001. DAB, 3,3′-diaminobenzidine; DAPI, 4’,6-diamidino-2-phenylindole; ELISA, enzyme-linked immunosorbent assay; IF, immunofluorescence; ROS, reactive oxygen species.

At the molecular level, immunofluorescence analysis and its quantification demonstrated a significant reduction in GPX4 protein expression in Group M, which was restored in Group T. This decrease was further exacerbated in Group KO-M and remained unimproved in Group KO-T (Fig. 3H, I). Western blot analysis corroborated these findings, showing downregulation of GPX4 and the related transporters heat shock protein 27 (HSP27) and solute carrier family 7 member 11 (SLC7A11), alongside an upregulation of the pro-oxidant enzymes NADPH oxidase 1 (NOX1) in Group M compared with Group C (Fig. 3J, K). These expression changes were reversed by T4 treatment in WT mice, but persisted in THRA KO groups despite T4 administration. Consistent with the protein data, qPCR analysis revealed corresponding alterations in the mRNA levels of GPX4, HSP27, SLC7A11, and ACSL4 (Fig. 3L). Crucially, group KO-M presented markedly elevated markers of ferroptosis, including iron overload, MDA, and ROS, while displaying reduced GSH/GSSG ratios and key antiferroptotic proteins like GPX4 compared with group M. The complete rescue by T4 in WT mice, and the lack of efficacy in THRA KO mice, unequivocally identifies THRA as an essential component required for counteracting ferroptosis in the hypothyroid heart.

Inhibition of ferroptosis by Ferrostatin-1 ameliorates myocardial injury in THRA-KO hypothyroid mice

To establish the causal role of ferroptosis in the myocardial injury observed in THRA-KO hypothyroid mice, we performed a rescue experiment using the specific ferroptosis inhibitor Ferrostatin-1 (Fer-1). The administration of Fer-1 to THRA-KO hypothyroid mice (KO-M+Fer-1 group) significantly attenuated the pathological alterations compared with the untreated KO-M group. Fer-1 treatment markedly reduced myocardial levels of ROS (Fig. 4A) and iron content (Fig. 4B) and decreased the concentration of MDA, a key marker of lipid peroxidation (Fig. 4C). Concurrently, the impaired redox balance was restored, as evidenced by a significant increase in the GSH/GSSG ratio (Fig. 4D) and enhanced activities of the antioxidant enzymes SOD and GSH-PX (Fig. 4E, F). Crucially, the expression of the pivotal antiferroptotic protein GPX4, which was severely suppressed in the KO-M group, was significantly rescued by Fer-1 treatment (Fig. 4G). Collectively, these data demonstrate that pharmacological inhibition of ferroptosis is sufficient to ameliorate the oxidative damage in THRA-deficient hearts, establishing ferroptosis as the key executive mechanism downstream of THRA disruption.

FIG. 4.

Inhibition of ferroptosis by Fer-1 ameliorates myocardial injury in THRA-knockout hypothyroid mice. (A) ROS levels in myocardial tissue; (B) Cardiac iron content measured by ELISA; (C) MDA concentration; (D) Ratio of reduced glutathione to oxidized glutathione (GSH/GSSG); (E) SOD activity; (F) Glutathione peroxidase (GSH-PX) activity; (G) Representative Western blots and quantification of GPX4 protein expression. *p < 0.05; **p < 0.01; ***p < 0.001. Fer-1, Ferrostatin-1; GPX4, glutathione peroxidase 4; MDA, malondialdehyde; SOD, superoxide dismutase.

THRA protects against myocardial ferroptosis through direct transcriptional regulation of GPX4 and modulation of the PI3K/AKT signaling pathway

We next investigated the upstream molecular mechanisms by which THRA suppresses ferroptosis. Bioinformatic analysis using the JASPAR database predicted potential binding motifs for THRA on the promoter region of the key antiferroptosis gene GPX4 (Fig. 5A). To validate this prediction, we performed chromatin immunoprecipitation (ChIP) assays in AC16 cells, which confirmed significant enrichment of the GPX4 promoter sequence by the THRA antibody compared with the IgG control (Fig. 5B). Furthermore, dual-luciferase reporter assays demonstrated that THRA overexpression significantly enhanced the transcriptional activity of a WT GPX4 promoter construct. This enhancement was completely abolished when the predicted THRA binding sites were mutated (Fig. 5C). Consistent with its role as a transcriptional activator, the data in mice showed that THRA knockdown reduced GPX4 protein levels (Fig. 3J). These results unequivocally identify THRA as a direct transcriptional activator of GPX4.

FIG. 5.

THRA protects against myocardial ferroptosis through direct transcriptional regulation of GPX4 and modulation of the PI3K/AKT signaling pathway. (A) Schematic diagram of the predicted THRA binding motif on the GPX4 promoter via JASPAR database; (B) ChIP assays in AC16 cells using an anti-THRA antibody. Enrichment of the GPX4 promoter region was analyzed by qPCR. IgG was used as a negative control; (C) Dual-luciferase reporter assay. The wild-type (WT) or mutant (MUT) GPX4 promoter sequences were cloned into the pGL3-basic vector. 293 T cells were co-transfected with the reporter plasmids and a THRA overexpression vector or empty vector (Vec). Firefly luciferase activity was normalized to Renilla luciferase activity; (D, E) Volcano plot of differentially expressed genes (DEGs) from RNA-seq analysis of cardiac tissues from KO-C vs. C mice; (F, G) KEGG pathway enrichment analysis of DEGs. The PI3K/AKT signaling pathway was significantly enriched; (H) Western blot analysis of PI3K, p-PI3K, AKT, and p-AKT protein levels in cardiac tissues from KO-C and C groups. The ratios of p-PI3K/PI3K and p-AKT/AKT were quantified. (I) Fasting blood glucose level and fasting insulin level. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001. ChIP, chromatin immunoprecipitation; KEGG, Kyoto Encyclopedia of Genes and Genomes; PI3K/AKT, phosphoinositide 3-kinase/protein kinase B; RNA-seq, RNA sequencing.

In parallel, RNA sequencing analysis of cardiac tissues from THRA-KO (KO-C) and control (C) mice revealed a set of differentially expressed genes (|Foldchange|>1, p < 0.05) (Fig. 5D, E; Supplementary Table S1). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis indicated that the PI3K/AKT signaling pathway was significantly inhibited in the KO-C group (Fig. 5F, G). This finding was confirmed at the protein level by Western blot, which showed significantly reduced ratios of phosphorylated PI3K to total PI3K and phosphorylated AKT to total AKT in the hearts of KO-C mice compared with controls (Fig. 5H).

To determine whether the observed inhibition of cardiac PI3K/AKT signaling and exacerbation of myocardial injury in THRA-KO hypothyroid mice were secondary to systemic insulin resistance, we measured fasting blood glucose and insulin levels. As shown in Figure 5I, PTU-induced hypothyroidism in WT mice (Group M) led to mild, nonsignificant elevations in fasting glucose and insulin compared with the control group (Group C). THRA KO under hypothyroid conditions (Group KO-M) significantly exacerbated these metabolic parameters relative to the KO-C group. However, the magnitude of this metabolic dysregulation was relatively modest. Crucially, T4 treatment completely normalized the metabolic profile in WT hypothyroid mice (Group T), but provided no significant improvement in THRA-KO mice (Group KO-T). The dissociation between the mild metabolic phenotype in KO-M mice and the severe cardiac injury and ferroptosis observed in the same group, coupled with the lack of therapeutic response to T4 in KO-T mice, strongly suggests that the inhibition of cardiac PI3K/AKT and the ensuing ferroptosis are a direct consequence of disrupted THRA signaling within cardiomyocytes, rather than being indirectly mediated by systemic insulin resistance. In summary, our findings reveal a mechanism wherein THRA inhibits myocardial ferroptosis both by directly transcriptionally upregulating GPX4 and by modulating the PI3K/AKT signaling pathway.

Investigation of the upstream regulatory mechanism of THRA gene

To explore the upstream regulators of THRA, we synthesized a 2000 bp sequence of the THRA gene promoter in vitro and cloned it into the pGL3 vector. Using biotin-labeled primers, we amplified the THRA gene promoter sequence to incorporate biotin labeling (Fig. 6A). Subsequently, we performed DNA pull-down coupled with mass spectrometry analysis using the biotinylated THRA promoter (Bio-THRA-Pro) to screen for transcription factors that regulate THRA. By functional annotation for 236 proteins that only interact with THRA promoters (Supplementary Table S2, Fig. 6B, C), we identified 20 proteins that function as transcription regulator complex (Supplementary Table S3). Through literature review, we discovered that the absence of the GATA4 transcription factor is closely associated with myocardial injury. The GEPIA database confirmed a significant positive correlation between GATA4 and THRA expression in myocardial tissue (Fig. 6D). We then examined the expression of GATA4 in our hypothyroid model. While GATA4 mRNA expression remained unchanged in the M group compared with the C group (Fig. 6E), its protein expression level was significantly reduced (Fig. 6F), suggesting post-transcriptional regulation. To investigate the mechanism of GATA4 protein downregulation, we performed ubiquitination assays. Co-immunoprecipitation (Co-IP) with a ubiquitin antibody followed by GATA4 immunoblot confirmed increased enrichment of ubiquitinated GATA4 in the M group, alongside decreased GATA4 protein levels in the input sample, indicating that PTU promotes GATA4 degradation via ubiquitin–proteasome pathway (Fig. 6G). Subsequently, we validated the regulation of THRA expression by GATA4 in both AC16 and HL-1 cells. The results revealed that overexpression of GATA4 significantly increased both the mRNA and protein levels of THRA (Fig. 6H, I), reconfirming the significant positive correlation between GATA4 and THRA expression and establishing GATA4 as a key upstream transcriptional activator of THRA.

FIG. 6.

Study on the upstream regulatory mechanism of THRA gene. (A–C) THRA promoter DNA pull-down with mass spectrometry (AC16 cells); (D) Confirmation from the GEPIA database: A Significant positive correlation exists between GATA4 and THRA expression in cardiac tissue; (E) GATA4 mRNA expression remains unchanged in Group M compared with Group C; (F) Reduced protein expression level of GATA4 in Group M versus Group C; (G) Ubiquitination assay of GATA4 Protein. Cardiac tissue lysates from C and M mice were subjected to IP with an anti-Ub antibody, followed by IB with an anti-GATA4 antibody; (H) Regulation of THRA mRNA expression by GATA4 with overexpression plasmid; (I) Regulation of THRA protein expression by GATA4. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001. GATA4, GATA binding protein 4.

GATA4 influences THRA activity by binding to its promoter

To elucidate the mechanism underlying GATA4’s regulation of THRA, we cloned the 2000 bp sequence of the THRA promoter into the Pgl3-basic luciferase plasmid. A dual-luciferase assay was used to assess the effect of GATA4 overexpression on luciferase activity (Fig. 7A). Our findings revealed a marked increase in the relative luciferase activity with heightened GATA4 expression and activation of the THRA promoter, indicating that GATA4 enhances THRA promoter activity. Subsequently, we utilized JASPAR to predict potential binding sites between GATA4 and THRA (Fig. 7B). Preliminary confirmation was obtained through Chip-qPCR, suggesting an interaction between GATA4 and the binding site within the −649 to −395 region of the THRA promoter. Furthermore, we utilized site-mutated dual-luciferase assays to confirm that GATA4 binds specifically to the P4 segment of the THRA promoter (Fig. 7C). We then constructed a luciferase reporter plasmid containing the −800 to −300 sequence and assessed the impact of GATA4 overexpression on luciferase activity with various site mutations (Fig. 7D, E). The results demonstrated that GATA4 overexpression promoted WT THRA luciferase activity. However, when mutations were introduced at P3 and P5, GATA4 overexpression continued to stimulate THRA luciferase activity. Notably, the stimulatory effect of GATA4 on THRA luciferase activity vanished after P4 mutation, confirming that GATA4’s regulation of THRA is dependent on the P4 binding site and independent of P3 and P5. These findings underscore the pivotal role of GATA4 in modulating THRA transcriptional activity through direct binding to its promoter.

FIG. 7.

GATA4 influences THRA transcriptional activity by binding to the THRA promoter. (A) Effect of GATA4 on THRA promoter activity; (B) JASPAR prediction of binding motif; (C) JASPAR prediction of potential binding sites between GATA4 and THRA; (D) Preliminary confirmation by Chip-qPCR that GATA4 may interact with the binding site within −649 to −395 of the THRA promoter; (E) Site mutation dual luciferase assay confirms the binding of GATA4 to the P4 segment on the THRA promoter. ns, not significant; *p < 0.05; ***p < 0.001.

Discussion

Hypothyroidism, a common endocrine disorder, frequently leads to alterations in cardiac structure and function, with myocardial injury being a significant complication (Udovcic et al., 2017; Yao et al., 2018; Sabatino et al., 2014). THRA is a primary mediator of thyroid hormone signaling (Alfadda et al., 2018), and mutations in the THRA gene cause resistance to thyroid hormone, characterized by reduced responsiveness to hormone supplementation (Hwang et al., 2023; Lacámar et al., 2020; Tylki-Szymańska et al., 2015). This study, utilizing a THRA-KO hypothyroid mouse model, provides the first evidence of a GATA4-THRA-GPX4 transcriptional axis that protects the heart from hypothyroidism-induced ferroptosis, offering novel insights into the pathogenesis of hypothyroid cardiomyopathy.

We demonstrated that THRA deletion exacerbates myocardial injury in PTU-induced hypothyroid mice. Compared with WT hypothyroid mice, THRA-KO hypothyroid mice exhibited more severe myocardial architectural disruption, apoptosis, and fibrosis. Crucially, the complete abolition of the therapeutic benefits of T4 administration on cardiac injury markers and histopathology in THRA-KO mice unequivocally establishes that an intact THRA signaling pathway is indispensable for the cardioprotective effects of thyroid hormone replacement (Köhrle, 2023; Rutigliano et al., 2023). This finding aligns with clinical observations of treatment resistance in some hypothyroid patients (Lacámar et al., 2020), suggesting impaired THRA signaling as a potential underlying mechanism.

Ferroptosis, an iron-dependent form of regulated cell death, has emerged as a key player in cardiovascular pathophysiology (Belavgeni et al., 2020; Lillo-Moya et al., 2021; Rishi et al., 2021; Yang et al., 2021). Our results confirm that ferroptosis is a key executive mechanism downstream of disrupted THRA signaling. The hypothyroid state triggered a comprehensive ferroptotic response in the myocardium, including iron overload, lipid peroxidation, and collapse of the antioxidant defense. Most importantly, pharmacological inhibition of ferroptosis by Fer-1 significantly ameliorated oxidative damage and restored the antiferroptotic defense in THRA-KO hypothyroid hearts. This rescue experiment provides compelling causal evidence positioning ferroptosis as a pivotal downstream event in myocardial injury upon THRA deficiency (Miotto et al., 2020; Robinson et al., 2011).

Mechanistically, we unraveled a novel protective transcriptional axis. We identified GATA4 as an upstream transcriptional activator of THRA. Furthermore, we demonstrated that THRA itself directly binds to the GPX4 promoter and transactivates its expression. This linear GATA4-THRA-GPX4 transcriptional axis provides a previously unrecognized framework for how cardiac thyroid hormone receptor signaling maintains redox homeostasis (Zhang et al., 2024; Zhao et al., 2010). Disruption of this axis creates a permissive environment for ferroptosis under hypothyroid conditions.

In parallel, our transcriptomic and biochemical analyses revealed that THRA deletion suppressed the PI3K/AKT signaling pathway, a critical pro-survival axis in the heart (Kim et al., 2003; Park et al., 2011). We propose that the inhibition of PI3K/AKT likely acts in concert with the direct disruption of GPX4-mediated defense, collectively exacerbating susceptibility to ferroptosis. A key question for future research is whether PI3K/AKT contributes to ferroptosis suppression by regulating GPX4 stability or activity or operates through independent parallel mechanisms to maintain cardiac homeostasis (Chaanine and Hajjar, 2011).

This study has limitations. First, while we established the role of the GATA4/THRA axis, the precise molecular mechanisms downstream of PI3K/AKT require further investigation. Second, the use of a global THRA KO model precludes the full delineation of cardiac-specific versus systemic effects. Finally, the mechanisms by which THRA influences thyroid hormone homeostasis warrant experimental verification.

In conclusion, our study defines the GATA4-THRA-GPX4 transcriptional axis and its modulation of PI3K/AKT signaling as a central mechanism protecting against hypothyroidism-driven myocardial ferroptosis. These findings not only provide a novel pathogenic framework but also open compelling translational avenues, such as screening for THRA mutations in patients with refractory hypothyroid heart disease and exploring the therapeutic potential of ferroptosis inhibitors in this subpopulation.

Materials and Methods

Animal models and grouping

Grouping: C57BL/6J mice (male, 6 weeks old) were used as experimental animals in this study and divided into six groups: Group C (Control): WT mice fed normally. Group M (Hypothyroidism Model): WT mice administered with 0.1% PTU (dose: 1.0 mL/100 g) (supplied by MCE, Catalog No. HY-B0346) by gavage and fed a low-iodine diet for 8 weeks. Group T (Hypothyroidism Model + T4 Treatment): Hypothyroid mice treated with 0.1% PTU (same as above) by gavage and low-iodine diet, with subcutaneous injections of T4 (dose: 4 μg/(100 g·d)) (Rutigliano et al., 2023) (supplied by MCE, Catalog No. HY-18341) starting from week 6. Group KO-C (THRA KO Control): THRA gene KO mice fed normally. Group KO-M (THRA KO Hypothyroidism Model): THRA gene KO mice treated with 0.1% PTU (same as above) by gavage and low-iodine diet for 8 weeks. Group KO-T (THRA KO Hypothyroidism Model + T4 Treatment): THRA gene KO hypothyroid mice treated with 0.1% PTU (same as above) by gavage and low-iodine diet, with subcutaneous injections of T4 (same as above) starting from week 6. The number of mice in each group was determined based on experimental requirements. After the experiment, mice were euthanized by intraperitoneal injection of 150 mg/kg sodium pentobarbital. This study was designed, implemented, and reported strictly in accordance with the ARRIVE Guideline 2.0. We provided detailed information on the experimental design, the experimental group, and the control group as well as a clear description of the experimental results.

THRA Gene KO Mouse Model Construction: The Thra gene KO mouse model on a C57BL/6J background (purchased from Henan Skobes Biotechnology Co., Ltd) was constructed using the CRISPR/Cas9 system. Two pairs of gRNA target sequences (gRNA-A1, gRNA-A2 and gRNA-B1, gRNA-B2) were designed to guide Cas9 cleavage of the Thra gene. The gRNA target sequences and Cas9 gene were constructed into a vector and injected into mouse embryos. Successful KO of the Thra gene was confirmed by PCR and sequencing. Homozygous Thra KO mice (Thra-/-) were obtained by self-crossing heterozygous mice.

During model creation, mouse body weight was measured weekly using an electronic balance (model: WT3003, manufacturer: Hangzhou Wanting Instrument Co. Ltd.), accurate to 0.1 g. Mouse water intake was recorded weekly by equipping cages with special water bottles, noting initial and remaining water volumes, and calculating the difference to assess overall mouse condition.

Sample collection

Serum sample collection

At the end of the experiment, mice were fasted for 12 h, and blood samples were collected by orbital bleeding. Blood was collected into centrifuge tubes without anticoagulant, left at room temperature for 30 min to clot, and then centrifuged at 3000 rpm for 15 min. The upper serum was transferred to new centrifuge tubes and stored at –80°C for subsequent detection of biochemical indicators such as T3, T4, TSH, CK, and CK-Mb. Strict aseptic operation was followed during sample collection and processing to prevent hemolysis and contamination.

Cardiac muscle tissue sample collection

After blood collection, mice were euthanized by cervical dislocation. The chest cavity was quickly opened, the heart removed, rinsed with precooled saline to remove surface blood, and surrounding fat and connective tissue were carefully stripped. Left ventricular myocardial tissue was taken; part was fixed in 4% paraformaldehyde for histopathological examination, and another part was quickly frozen in liquid nitrogen and then stored at –80°C for molecular biology and protein detection. Aseptic operation was maintained throughout to ensure sample quality.

ELISA detection

ELISA kits (Shanghai Coibo Biotechnology Co., Ltd.) were used to measure serum T3, T4, TSH, ROS, iron content, MDA, and myocardial SOD and GSH-PX. Taking serum T3 detection as an example, the kit and samples were brought to room temperature. Standards were diluted as per the kit manual to prepare a standard curve. A measure of 50 μL of standard or sample and 50 μL of enzyme conjugate working solution were added to corresponding wells of the microplate, mixed gently, and incubated at 37°C for 60 min. After incubation, the liquid was discarded, the plate was washed 5 times with wash solution (30 s each), and 100 μL of substrate solution was added to each well, incubated at 37°C in the dark for 15 min. A measure of 50 μL of stop solution was added, and absorbance was measured at 450 nm using a microplate reader. Sample contents were calculated based on the standard curve. Each sample had 3 replicates, and the average was taken to reduce error.

Biochemical analysis

A biochemical analyzer (Model: Hitachi 7600, Hitachi High-Tech Corporation) was used to measure serum CK and CK-Mb. Samples were brought to room temperature, added to sample cups as per the instrument’s procedure, and the instrument automatically performed the detection after selecting CK and CK-Mb items and setting parameters. Regular instrument calibration and quality control ensured accurate and reliable results.

Histopathological examination of tissues

Myocardial tissue fixed in 4% paraformaldehyde was dehydrated, cleared, infiltrated with wax, embedded, and sectioned into 4 μm-thick paraffin sections. For HE staining, sections were dewaxed to water, stained with hematoxylin for 5 min, rinsed, differentiated with 1% hydrochloric acid ethanol, rinsed, blued in running water, stained with eosin for 3 min, rinsed again, dehydrated with ethanol gradient, cleared with xylene, and mounted with neutral gum. Myocardial cell morphology was observed under a microscope. For Masson staining, sections were dewaxed to water, fixed with Bouin’s solution for 30 min, rinsed, stained with Weigert’s iron hematoxylin for 10 min, rinsed, treated with 1% phosphomolybdic acid solution for 5 min, stained with aniline blue dye for 5 min, treated with 1% acetic acid solution for 3 min, dehydrated, cleared, and mounted. The fibrosis extent was observed under a microscope, with blue areas representing fibrotic tissue, and the proportion of fibrotic area to the total field area was calculated.

Immunohistochemical detection

Paraffin sections were dewaxed to water, underwent antigen retrieval (using high-temperature high-pressure method or citrate buffer retrieval method), cooled, and incubated with 3% hydrogen peroxide at room temperature for 10 min to quench endogenous peroxidase activity. After 3 phosphate-buffered saline (PBS) rinses (5 min each), 5% bovine serum albumin blocking solution was added and incubated at room temperature for 30 min. The blocking solution was discarded, and primary antibody Caspase-3 (Wuhan Servicebio Technology Co., Ltd., Catalog No. GB11532-100) was added and incubated at 4°C overnight. The next day, after 3 PBS rinses (5 min each), corresponding secondary antibodies (horseradish peroxidase [HRP]-labeled) were added and incubated at room temperature for 30 min. After another 3 PBS rinses (5 min each), DAB was used for color development, which was monitored under a microscope and stopped when appropriate. Nuclei were counterstained with hematoxylin, and sections were rinsed, dehydrated, cleared, and mounted. Five high-power fields were randomly selected under a microscope to count positive cells and calculate the positive cell rate.

Western blot detection

An appropriate amount of myocardial tissue was taken, RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors was added, and the tissue was fully ground on ice to lyse completely. After centrifugation at 4°C, 12,000 rpm for 15 min, the supernatant was transferred to a new tube, and protein concentration was measured using the bicinchoninic acid method. Equal amounts of protein samples were mixed with loading buffer and boiled for 5 min. Sodium dodecyl sulfate–polyacrylamide gelelectrophoresis (SDS-PAGE) was performed, with gel concentration chosen based on protein molecular weight. After electrophoresis, proteins were transferred to a polyvinylidene fluoride membrane, blocked with 5% skim milk for 1 h at room temperature with shaking. Primary antibodies Bax, Bcl-2, GPX4 (Wuhan Proteintech, Catalog No.: Cat No. 67763–1-Ig), HSP27 (Wuhan Proteintech, Catalog No.: Cat No. 18284–1-AP), SLC7A11 (Abcam, Catalog No.: ab307601), and NOX1 (Wuhan Proteintech, Catalog No.: Cat No. 17772–1-AP) were added at dilutions as per antibody manuals and incubated at 4°C overnight.

The next day, the membrane was washed thrice with Tris-buffered saline with Tween (TBST) (10 min each), and corresponding secondary antibodies (HRP-labeled) were added and incubated at room temperature for 1 h. After another 3 TBST washes (10 min each), chemiluminescence was used for development, and the membrane was exposed and photographed in a gel imaging system. Band gray-value analysis was performed using ImageJ software, with GAPDH (Wuhan Proteintech, Catalog No.: Cat No. 60004–1-Ig) as the internal reference to calculate the relative expression of target proteins. Relevant primers are as follows: Mouse-GPX4: Forward: ACCTGGACGCCAAAGTCCTA, Reverse: GTGACGATGCACACGAAACC. Mouse-HSP27: Forward: GCCGAGTACGAATTTGCCAAC, Reverse: CCCGAGGCCGAACATAGTAG. Mouse-SLC7A11: Forward: 5′TGGAGCCCTGTCCTATGC3′, Reverse: 5′GTATTACGAGCAGTTCCACCC3′. Mouse-Bax: Forward: GCCTTTTTGCTACAGGGTTTCAT, Reverse: TATTGCTGTCCAGTTCATCTCCA. Mouse-Bcl2: Forward: TGACTTCTCTCGTCGCTACCGT, Reverse: CCTGAAGAGTTCCTCCACCACC. Mouse-ACSL4: Forward: GGAAAGCAAACTGAAGGCGG, Reverse: CCCTCAGGGTACTCTGCTCT.

qPCR detection

An appropriate amount of myocardial tissue was taken, 1 mL of TRIzol reagent was added, and the tissue was fully ground and left at room temperature for 5 min. A measure of 0.2 mL of chloroform was added, shaken vigorously for 15 s, and left at room temperature for 2–3 min. After centrifugation at 4°C, 12,000 rpm for 15 min, the aqueous phase was transferred to a new tube. A measure of 0.5 mL of isopropanol was added, mixed by inversion, and left at room temperature for 10 min. After centrifugation at 4°C, 12,000 rpm for 10 min, the supernatant was discarded, and the RNA pellet was washed once with 75% ethanol, centrifuged at 4°C, 7500 rpm for 5 min, and air-dried. The RNA pellet was dissolved in diethylpyrocarbonate water, and RNA concentration and purity were measured using a NanoDrop spectrophotometer. A measure of 1 μg of RNA was reverse-transcribed into complementary DNA (cDNA) using a reverse transcription kit. qPCR was performed using the cDNA as the template. The reaction system included SYBR Green PCR Master Mix, upstream and downstream primers (BAX, BCL2, GPX4, HSP27, SLC7A11, and ACSL4, designed based on the NCBI database and synthesized by a company, with a concentration of 10 μmol/L each), cDNA template, and ddH₂O. Reaction conditions were as follows: 95°C predenaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing for 30 s, for a total of 40 cycles. The 2^-ΔΔCt method was used to calculate the relative expression of target genes.

Iron detection by Prussian blue staining

To visually assess iron deposition in myocardial tissues, we performed Prussian blue staining with DAB enhancement. Briefly, paraffin-embedded tissue sections were deparaffinized and rehydrated through graded alcohols to distilled water. Sections were then incubated in a freshly prepared solution of 2% potassium ferrocyanide in 2% hydrochloric acid for 30 min at room temperature to form insoluble Prussian blue precipitate. To enhance sensitivity for low iron levels, sections were treated with DAB substrate for 10 min, which reacts with the precipitated iron to generate a brown-colored product. Sections were counterstained with hematoxylin for 1 min to visualize nuclei, followed by dehydration through graded alcohols, clearing in xylene, and mounting with neutral balsam. Iron-rich areas appeared brown, whereas nuclei were blue.

Measurement of myocardial GSH/GSSG ratio

The GSH/GSSG ratio was determined using a commercial assay kit (Beyotime Biotechnology, Catalog No. S0053). Myocardial tissues were homogenized, deproteinized, and centrifuged. Supernatants were treated with a GSH scavenger for GSSG measurement or directly used for total glutathione. Samples were reacted with NADPH, 5,5′-dithio-bis-(2-nitrobenzoic acid) (DTNB), and glutathione reductase, and absorbance was measured at 412 nm. Concentrations were calculated via a GSSG standard curve, and the GSH/GSSG was derived as (Total glutathione-2×GSSG)/GSSG.

Bioinformatic prediction of transcription factor binding sites

The prediction of potential transcription factor binding sites on gene promoters was performed using the JASPAR database (http://jaspar.genereg.net/).

ChIP-qPCR

ChIP assays were performed to examine the binding of transcription factors to specific gene promoters. Briefly, AC16 cells were cross-linked with 1% formaldehyde for 10 min at room temperature, and the reaction was quenched with glycine. Cells were lysed, and chromatin was sheared by sonication to an average fragment size of 200–1000 bp. The sheared chromatin was immunoprecipitated overnight at 4°C with specific antibodies against the target protein (anti-GATA4 for GATA4-THRA interaction, anti-THRA for THRA-GPX4 interaction). Normal rabbit IgG was used as a negative control. Protein A/G magnetic beads were then added to capture the antibody–chromatin complexes. After extensive washing, the cross-links were reversed, and the co-precipitated DNA was purified. Enrichment of specific promoter regions was quantified by real-time qPCR using SYBR Green Master Mix.

Dual luciferase reporter gene assay

To investigate the transcriptional regulation between candidate genes, dual-luciferase reporter assays were performed. Briefly, the putative promoter sequences (2000 bp upstream of the transcription start site) of the target genes (THRA or GPX4) were cloned into the pGL3-Basic luciferase reporter vector. For each promoter, both WT and binding site-mutant constructs were generated using site-directed mutagenesis. HEK293T cells were co-transfected with the resulting promoter-reporter constructs (pGL3-Promoter), a pRL-TK plasmid, and either an overexpression plasmid for the putative transcription factor (pcDNA3.1-GATA4 for the GATA4-THRA pair or pcDNA3.1-THRA for the THRA-GPX4 pair) or its corresponding empty vector control, using Lipofectamine 3000 transfection reagent. After 48 h of transfection, Firefly and Renilla luciferase activities were measured sequentially using the Dual-Luciferase Reporter Assay System according to the manufacturer’s instructions (Solarbio, Catalog #D0011). The relative promoter activity was calculated as the ratio of firefly luciferase luminescence to Renilla luciferase luminescence. All transfections and assays were performed in at least three independent experiments, each with triplicate replicates.

RNA-seq analysis

Total RNA was extracted from myocardial tissue using the same method as in qPCR detection, ensuring RNA quality and purity. RNA quality was assessed using an Agilent 2100 Bioanalyzer to check integrity and concentration. Qualified RNA samples were sent to a professional sequencing company for RNA-seq analysis. The company constructed RNA libraries and performed high-throughput sequencing using an Illumina sequencing platform. After sequencing, raw data were quality-controlled to remove low-quality reads and adapter sequences. Processed data were aligned with the mouse reference genome for gene expression quantification and differential expression analysis. Gene ontology and KEGG pathway enrichment analyses were conducted to explore downstream target genes of THRA and related signaling pathways.

Measurement of fasting blood glucose

Fasting blood glucose levels were determined using a commercial Glucose Assay Kit (Beyotime, Catalog No. S0202M) based on the glucose oxidase (GOD) and peroxidase (POD) method. Briefly, serum samples from all experimental groups were prepared by centrifuging whole blood at 2000 ×g for 10 min. A standard curve was generated using glucose standards ranging from 0 to 0.4 mg/mL. For each reaction, 40 µL of serum or standard was mixed with 160 µL of the working reagent (containing GOD, POD, phenol, and 4-aminoantipyrine) in a 96-well plate. After incubation at 40°C for 10 min, the absorbance was measured at 510 nm using a microplate reader (Thermo, Model MULTISKAN MK3). The glucose concentration (mM) in each sample was calculated based on the standard curve.

Measurement of serum insulin

Serum insulin levels were quantified using an ultrasensitive Mouse Insulin ELISA Kit (Beyotime, Catalog No. PI602) as per manufacturer’s instructions. Briefly, serum samples and standards were added to antibody-precoated wells, followed by incubation with an HRP-conjugated detection antibody for 2 h at room temperature. After washing, 3,3′,5,5′-tetramethylbenzidine (TMB) substrate was added and incubated for 10 min. The reaction was stopped, and absorbance was measured at 450 nm. Insulin concentrations were determined from a standard curve.

DNA pull-down and mass spectrometry analysis

The promoter sequence of the THRA gene (2000 bp in length) was synthesized and biotin-labeled at the 5′ end. The biotin-labeled THRA promoter sequence (Bio-THRA-Pro) was mixed with streptavidin magnetic beads and incubated at 4°C for 2 h to allow full binding of Bio-THRA-Pro to the beads. Nuclear protein extracts from mouse myocardial tissue were added to the bead-Bio-THRA-Pro complex and incubated overnight at 4°C with gentle shaking. After incubation, the beads were washed thoroughly with wash buffer to remove unbound proteins. Elution buffer was added to elute proteins bound to Bio-THRA-Pro. The eluted proteins were subjected to SDS-PAGE electrophoresis, Coomassie Brilliant Blue staining, and the target bands were cut out. The bands were digested in-gel and then analyzed by mass spectrometry to identify transcription factors interacting with the THRA promoter. All operations were performed on ice or in a low-temperature environment to maintain protein activity and stability.

Ubiquitination by Co-IP assay

Protein ubiquitination was assessed by Co-IP. Myocardial tissue lysates from control (C) and hypothyroid (M) mice were incubated with an anti-Ub antibody overnight at 4°C, followed by incubation with Protein A/G magnetic beads. Normal IgG was used as a negative control. The immunoprecipitated complexes were washed extensively, eluted, and subjected to Western blot analysis using an anti-GATA4 and anti-Ub antibody. Input lysates were probed for GATA4 to confirm protein expression levels.

Data collection and management

In this study, we followed strict data recording and management procedures to ensure the accuracy and reliability of the research. All the experimental observations and results were immediately recorded by the experimental operators in the standardized paper experimental notebook during the experiment. These record books are reviewed by the project leader after the experiment to verify the completeness and consistency of the data. This study did not use electronic laboratory notebooks for data collection and recording.

Data statistics and analysis

All data were analyzed statistically using SPSS26.0 or GraphPad Prism 9.5 software, with results expressed as mean ± standard deviation (Mean ± SD). Intergroup comparisons were made using t-tests or ANOVA, and p values < 0.05 were considered statistically significant.

Authors’ Contributions

R.Z.: Conceptualization; data curation; formal analysis; and writing—original draft; and X.F.: Methodology; supervision; and writing—review and editing.

Footnotes

Acknowledgment

The authors wish to express their sincere appreciation to all those who have supported this work.

Author Disclosure Statement

The authors report no conflict of interest.

Funding Information

No funding was received for this article.

Data Availability Statement

The RNA-seq datasets generated during the current study are available at BioProject accession number PRJNA1262663 (http://www.ncbi.nlm.nih.gov/bioproject/1262663). The mass spectrometry proteomics data have been deposited to the iProX partner repository with the dataset identifier PXD064078 (URL:). Other datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Ethical Approval

All animal experiments were performed with the approval of the Animal Ethics Committee of The Second Affiliated Hospital of Zhengzhou University and the procedures for Care and Use of Laboratory Animals in cancer research.

Supplemental Material

Abbreviations

References

Alfadda

, Benabdelkamel

, Masood

, et al. Differences in the plasma proteome of patients with hypothyroidism before and after thyroid hormone replacement: A proteomic analysis. Int J Mol Sci, 2018; 19.

Belavgeni

, Meyer

, Stumpf

, et al. Ferroptosis and necroptosis in the kidney. Cell Chem Biol, 2020; 27(4):448–462.

Chaanine

, Hajjar

. AKT signalling in the failing heart. Eur J Heart Fail, 2011; 13(8):825–829.

Fang

, Ardehali

, Min

, et al. The molecular and metabolic landscape of iron and ferroptosis in cardiovascular disease. Nat Rev Cardiol, 2023; 20(1):7–23.

Hwang

, Doolittle

WKL

, Zhu

, et al. Thyroid hormone receptor α1: A novel regulator of thyroid cancer cell differentiation. Oncogene, 2023; 42(41):3075–3086.

Kim

, Ma

, Kitta

, et al. Anthracycline-induced suppression of GATA-4 transcription factor: Implication in the regulation of cardiac myocyte apoptosis. Mol Pharmacol, 2003; 63(2):368–377.

Köhrle

. Selenium, iodine and iron-essential trace elements for thyroid hormone synthesis and metabolism. Int J Mol Sci, 2023; 24(4):3393.

Lacámar

, Lecumberri

, Barquiel

, et al. Identification of resistance to exogenous thyroxine in humans. Thyroid, 2020; 30:1732–1744.

Lillo-Moya

, Rojas-Solé

, Muñoz-Salamanca

, et al. Targeting ferroptosis against ischemia/reperfusion cardiac injury. Antioxidants (Basel), 2021; 10(5):667.

10.

Miotto

, Rossetto

, Di Paolo

, et al. Insight into the mechanism of ferroptosis inhibition by ferrostatin-1. Redox Biol, 2020; 28:101328.

11.

Park

, Nagase

, Liu

, et al. Mechanism of anthracycline-mediated down-regulation of GATA4 in the heart. Cardiovasc Res, 2011; 90(1):97–104.

12.

Reichert

, de Freitas

, Sampaio-Silva

, et al. Ferroptosis mechanisms involved in neurodegenerative diseases. Int J Mol Sci, 2020; 21(22):8765.

13.

Rishi

, Huang

, Subramaniam

. Cancer: The role of iron and ferroptosis. Int J Biochem Cell Biol, 2021; 141:106094.

14.

Robinson

, Clements

, Williams

, et al. Bax inhibitor 1 in apoptosis and disease. Oncogene, 2011; 30(21):2391–2400.

15.

Rutigliano

, Bertolini

, Grittani

, et al. Effect of Combined Levothyroxine (L-T(4)) and 3-Iodothyronamine (T(1)AM) supplementation on memory and adult hippocampal neurogenesis in a mouse model of hypothyroidism. Int J Mol Sci, 2023; 24.

16.

Sabatino

, Iervasi

, Pingitore

. Thyroid hormone and heart failure: From myocardial protection to systemic regulation. Expert Rev Cardiovasc Ther, 2014; 12(10):1227–1236.

17.

Tylki-Szymańska

, Acuna-Hidalgo

, Krajewska-Walasek

, et al. Thyroid hormone resistance syndrome due to mutations in the Thyroid Hormone Receptor α Gene (THRA). J Med Genet, 2015; 52(5):312–316.

18.

Udovcic

, Pena

, Patham

, et al. Hypothyroidism and the heart. Methodist Debakey Cardiovasc J, 2017; 13(2):55–59.

19.

Wang

, Li

, He

, et al. Ferroptosis: Underlying mechanisms and involvement in neurodegenerative diseases. Apoptosis, 2024; 29(1–2):3–21.

20.

Wang

, Lv

, Zhao

. Research on ferroptosis as a therapeutic target for the treatment of neurodegenerative diseases. Ageing Res Rev, 2023; 91:102035.

21.

Wang

, Wu

. Ferroptosis: A new strategy for cardiovascular disease. Front Cardiovasc Med, 2023; 10:1241282.

22.

, Yan

, Luo

, et al. Ferroptosis and hydrogen sulfide in cardiovascular disease. Curr Med Chem, 2023; 30(16):1848–1859.

23.

, Pi

, Zhang

, et al. Effects of ferroptosis on cardiovascular diseases. Mediators Inflamm, 2023; 2023:6653202.

24.

Yang

, Hu

, Bian

, et al. Targeting cell death: Pyroptosis, ferroptosis, apoptosis and necroptosis in osteoarthritis. Front Cell Dev Biol, 2021; 9:789948.

25.

Yao

, Gao

, Liu

, et al. Diffuse myocardial injuries are present in subclinical hypothyroidism: A clinical study using myocardial T1-mapping quantification. Sci Rep, 2018; 8(1):4999.

26.

Zhang

, Zeng

, Zhang

, et al. Pterostilbene attenuates heart failure by inhibiting myocardial ferroptosis through SIRT1/GSK-3β/GPX4 signaling pathway. Heliyon, 2024; 10(3):e24562.

27.

Zhang

, Tian

, Li

, et al. Ferroptosis in cardiac hypertrophy and heart failure. Biomed Pharmacother, 2023; 168:115765.

28.

Zhao

, Sun

, Mao

, et al. Myocardial iron metabolism in the regulation of cardiovascular diseases in rats. Cell Physiol Biochem, 2010; 25(6):587–594.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.02 MB

0.01 MB