Mitofusin 2 Is Required for the Maturation of Embryonic Stem Cell-Derived Cardiomyocytes via a GRP75-Dependent Suppression of the ROS/PI3K/AKT/mTOR Axis

Abstract

Aims:

Pluripotent stem cell-derived cardiomyocytes (PSC-CMs) have the potential for use in cell-based therapy, disease modeling, and drug toxicity testing. However, under the conventional differentiation protocol, PSC-CMs are immature and differ from adult cardiomyocytes in electrophysiological characteristics, calcium kinetics, cellular morphology, metabolism, and gene expression. MFN2 tethers sarcoplasmic reticulum (SR) and mitochondria and mediates their interaction via mitochondria-associated endoplasmic reticulum membranes, which tunes the cytosolic Ca²⁺ and reactive oxygen species (ROS) signaling. We aim to investigate if MFN2 would regulate murine embryonic stem cell-derived cardiomyocyte (mESC-CM) maturation, and if yes, what are the underlying mechanisms.

Results:

MFN2 knockdown caused detrimental effects on mESC-CM maturation in terms of structure, cytosolic calcium kinetics, electrophysiology, and metabolism. Mechanistically, MFN2 knockdown increased proliferative capacity, increased ROS and activated PI3K/AKT/mTOR activity, and these were all reversed by the ROS scavenger N-acetylcysteine. Meanwhile, MFN2 knockdown decreased the IP3R-VDAC coupling mediated by GRP75. Importantly, GRP75 overexpression restored the decreased IP3R-VDAC coupling, reversed the increased cellular ROS, and reversed the increased PI3K/AKT/mTOR activity caused by MFN2 knockdown. Rapamycin, an mTOR inhibitor, reduced the increased proliferative capacity and restored the impaired electrophysiology caused by MFN2 knockdown.

Innovation:

The current study is the first study to reveal that MFN2-mediated SR-mitochondrial interaction is required for the mESC-CM maturation through the ROS/PI3K/AKT/mTOR axis.

Conclusion:

MFN2 is required for the maturation of mESC-CMs through GRP75-dependent, mTOR-mediated suppression of proliferative capacity via the ROS/PI3K/AKT pathway. Our findings advance the understanding of PSC-CM maturation and provide novel insight for strategies to promote PSC-CM maturation. Antioxid. Redox Signal. 44, 799–821.

Keywords

pluripotent stem cell-derived cardiomyocytes cardiomyocyte maturation mitofusin 2 mitochondria sarcoplasmic reticulum

Introduction

Pluripotent stem cell-derived cardiomyocytes (PSC-CMs) have the potential for use in cell-based therapy, disease modeling, and drug toxicity testing. However, under the conventional differentiation protocol of PSC-CMs, PSC-CMs are still immature, which hampers their further clinical applications. PSC-CMs are immature in structure, calcium handling, electrophysiological characteristics, metabolism, and gene expression. Although many achievements have been made in understanding the mechanism underlying cardiomyocyte maturation, the knowledge is still insufficient. Here, we explored the mechanism involved in mouse embryonic stem cell-derived cardiomyocyte (mESC-CM) maturation to shed light on the potential target for enhancing maturation.

In cardiomyocytes, the sarcoplasmic reticulum (SR) and mitochondria are important organelles that are crucial for regulating cytosolic Ca²⁺ kinetics, excitation–contraction (E-C) coupling, and energy production. Interestingly, SR is closely and physically in contact with mitochondria. Endoplasmic reticulum (ER)-mitochondrial communications are optimized by the mitochondrial-associated ER membranes (MAMs). MAMs are involved in Ca²⁺ transfer, lipid synthesis, autophagy, and apoptosis (Yang et al., 2023). During E-C coupling, the excessive Ca²⁺ released from SR will be buffered by mitochondria. At the same time, Ca²⁺ in the mitochondrial matrix serves to optimize the function of enzymes involved in the tricarboxylic acid (TCA) cycle (Wang et al., 2020) and promote mitochondrial function.

Mitofusin 2 (MFN2) and glucose-related protein 75 (GRP75) are the primary MAM-resident proteins. MFN2 is located in both the SR/ER membrane and the outer mitochondrial membrane (OMM). It physically tethers SR/ER with OMM through interaction between the SR/ER MFN2 and OMM MFN2/MFN1 (de Brito and Scorrano, 2008). GRP75, on the one hand, interacts with the SR/ER inositol trisphosphate receptor (IP3R), a major SR/ER Ca²⁺ release channel; on the other hand, GRP75 interacts with OMM voltage-dependent anion channel (VDAC), a mitochondrial Ca²⁺ uptake channel. This IP3R-GRP75-VDAC complex has been reported to facilitate the Ca²⁺ transfer from SR/ER to mitochondria (Honrath et al., 2017). Mitochondrial Ca²⁺ homeostasis was in turn reported to regulate reactive oxygen species (ROS) generation; low mitochondrial Ca²⁺ was found to lead to less reduced form of nicotinamide adenine dinucleotide (NADH) and nicotinamide adenine dinucleotide phosphate (NADPH), which consequently led to higher oxidative stress (Bertero and Maack, 2018).

Indeed, it was reported that GRP75 knockdown decreased mitochondrial Ca²⁺ and increased cellular ROS, while GRP75 overexpression increased mitochondrial Ca²⁺ and decreased cellular ROS (Li et al., 2022). Additionally, MFN2 knockdown was reported to increase cellular ROS level (Averill-Bates, 2024; Luo et al., 2021; Ren et al., 2022; Xue et al., 2018). Consistently, ROS production was associated with MAMs (Zhao et al., 2022). Interestingly, MFN2 has been reported to have altered expression in the case of cardiac hypertrophy and heart failure (Chen et al., 2021; Ren et al., 2022). For instance, Ren et al. demonstrated that downregulation of MFN2 caused an increase in distance between SR and mitochondria as revealed by electron microscope tomography; this disruption in SR-mitochondria connection dysregulated Ca²⁺ level and ROS generation, and contributed to the sino-atrial nodal dysfunction in heart failure (Ren et al., 2022). GRP75 has also been reported to mediate the hypoxia-reoxygenation (HR) injury, and GRP75 knockdown attenuated the cell death after HR injury by preventing mitochondrial Ca²⁺ overload (Paillard et al., 2013). Zhang et al. reported that in oxygen–glucose deprivation-induced cardiomyocytes, GRP75 knockdown contributed to the decreased SR-mitochondrial Ca²⁺ transfer and whole cell Ca²⁺ concentration (Zhang et al., 2024). These findings related to MFN2 emphasize the indispensable role of MAMs in regulating cytosolic Ca²⁺ kinetics, ROS generation, and cardiac contractility; in addition, these studies revealed that GRP75 executes the promotion of SR-mitochondrial Ca²⁺ transfer in MAMs.

Importantly, ROS serves as a second messenger; the appropriate ROS signaling is proven to participate in cardiomyocyte maturation/differentiation (Law et al., 2013; Liang et al., 2020; Momtahan et al., 2019), while excessive ROS level leads to oxidative stress and may lead to dysfunctional cardiomyocytes (Hafstad et al., 2013). However, whether MFN2 and GRP75 are involved in the maturation of cardiomyocytes is unexplored.

In this study, whether MFN2 is involved in regulating the maturation of ESC-CMs was investigated. We hypothesized that MFN2 regulates SR-mitochondrial communication and ROS signaling in the IP3R-GRP75-VDAC-dependent manner. The mechanism underlying the positive role of MFN2 on ESC-CM maturation was also investigated. The novel information generated in this study (major findings are summarized in Fig. 1) shall be useful not only in understanding the biology of cardiomyocyte maturation, but it will also be useful for providing insight into generating mature PSC-CMs for drug screening and regenerative medicine

FIG. 1.

Summary figure showing the major findings in this study. MFN2 is required for the mESC-CM maturation through GRP75-dependent suppression of the ROS/PI3K/AKT/mTOR axis. Our study reveals that MFN2 promotes the SR-mitochondrial interaction through the IP3R-GRP75-VDAC coupling. This GRP75-dependent coupling in turn negatively regulates the ROS/PI3K/AKT/mTOR axis, where mTOR positively regulates the proliferative capacity and negatively regulates the maturation of mESC-CMs. AKT, protein kinase B; GRP75, glucose-related protein 75; IP3R, inositol 1,4,5-trisphosphate; mESC-CM, mouse embryonic stem cell-derived cardiomyocyte; MFN2, Mitofusin 2; mTOR, mammalian target of rapamycin; PI3K, phosphoinositide 3 kinase; ROS, reactive oxygen species; SR, sarcoplasmic reticulum; VDAC, voltage dependent anion channel.

Results

Knockdown of MFN2 impaired the structural maturation of ESC-CMs

Firstly, we tested the expression of MFN2 during cardiomyocyte maturation. We reasoned that the expression of MFN2 would increase if MFN2 serves to facilitate the SR-mitochondrial Ca²⁺ communication and thereby cytosolic Ca²⁺ kinetics and mitochondrial function. “ESC” represents a stage before differentiation; “EB” represents a stage before the appearance of beating embryoid bodies (EBs) at day 7; “EDS” represents the early differentiation stage from day (7 + 2) to day (7 + 4); “IDS” represents the intermediate differentiation stage from day (7 + 5) to day (7 + 8); “LDS” represents the late differentiation stage from day (7 + 9) to day (7 + 18) (Hescheler et al., 1997) (Fig. 2A). The expression level of MFN2 protein at different developmental stages (ESC, EB, EDS beating EB, and LDS beating EB) was tested. The results showed that the protein level of MFN2 significantly increased during maturation from the EB stage to the LDS and from the EDS to the LDS (Fig. 2B and C). The increasing protein level may hint the presence of a time window from early stage to late stage for MFN2 to promote mESC-CM maturation. Therefore, the functional role of MFN2 during the mESC-CM maturation was studied with mESC-CMs isolated on day (7 + 4) (i.e., EDS). Adenoviral vector pAd-CMV-GFP-U6-shMFN2 was used to knockdown MFN2 in isolated mESC-CMs with 4 days of infection from day (7 + 5) to day (7 + 8) (i.e., IDS) and the experiments were conducted on day (7 + 9) (i.e., LDS) (Fig. 2A). Western blot results showed a significant decrease in MFN2 expression in the shMFN2 group (Supplementary Fig. S1A and B).

FIG. 2.

Knockdown of MFN2 impaired structural maturation of mESC-CMs. (A) Schematic diagram showing the different stages of mESC-CM differentiation/maturation. (B) Representative Western blot showing the expression of MFN2 during mESC-CM development. EB represents a stage before the appearance of beating EB at day 7; EDS represents the early differentiation stage from day (7 + 2) to day (7 + 4); IDS represents the intermediate differentiation stage from day (7 + 5) to day (7 + 8); LDS represents the late differentiation stage from day (7 + 9) to day (7 + 18). (C) Quantification of MFN2 normalized to vinculin. Data were obtained from isolated beating EBs from 5 independent differentiation batches. Data were presented as mean ± SEM. One-way analysis of variance (ANOVA) followed by multiple comparison tests was applied for statistical analysis, *p < 0.05. (D) Representative confocal images showing the nuclei (DAPI; blue) and α-actinin (green) in mESC-CMs from shCtrl (pAdTrack-CMV-mito-R-GECO1-U6-shCtrl) and shMFN2 (pAdTrack-CMV-mito-R-GECO1-U6-shMFN2) groups. (E–G) Quantification of (E) cell area, (F) % of cells with organized sarcomere, and (G) sarcomere length in shCtrl and shMFN2 groups. Data were obtained from 42 to 47 cells from isolated beating EBs from 3 independent differentiation batches in (E) and (F); the data point in (F) represents the % of cells with organized sarcomere from each independent differentiation batch; data were obtained from 17 to 38 cells from three independent differentiation batches in (G); cells without striated α-actinin pattern were not calculated. (H) Quantification of expression of selected cardiac structual genes normalized to that of shCtrl group after knockdown of MFN2; the dash line represents the level of shCtrl group. Data were obtained from isolated beating EBs from four independent differentiation batches. (I) Representative confocal images showing the staining of nucleus (DAPI, blue), α-actinin (green), and Ki67 (far red, pseudo-colored as purple) in shCtrl and shMFN2 groups. Yellow arrows indicate the Ki67-positive mESC-CMs. (J) Quantification of the % of Ki67-positive mESC-CMs in shCtrl and shMFN2 groups. mESC-CMs with Ki67 signals condensed in nucleoli were considered Ki67-positive. Data were obtained from isolated beating EBs from four independent differentiation batches. (K) Quantification of the % of cTNT-positive mESC-CMs as determined by flow cytometry in shCtrl and shMFN2 groups. Data were obtained from isolated beating EBs from three independent differentiation batches. For (D–K), experiments were conducted on mESC-CMs at differentiation day (7 + 9). Data were presented as mean ± SEM. Student’s t-test was applied for statistical analysis, *p < 0.05; **p < 0.01; ***p < 0.001. n.s., no significance. cTNT, cardiac troponin; DAPI, 4'4’,6-diamidino-2-phenylindole; EBs, embryoid bodies; EDS, early differentiation stage.

Cellular structural maturation is one of the features of cardiomyocyte maturation. We evaluated the cell size, sarcomere organization, and sarcomere length in the shCtrl (control group) and shMFN2 groups to examine the degree of cellular structural maturation (Fig. 2D). The results showed a decreased cell size (Fig. 2E) and loss of organized sarcomere (Fig. 2F) in the shMFN2 group compared with that of the shCtrl group. However, there was no change in the sarcomere length (Fig. 2G). Consistent with these structural changes, MFN2 knockdown decreased the expression of multiple genes related to cardiac structure and structural maturation [cardiac α-actin (ACTC1), troponin T2 (TNNT2), α-actinin-2 (ACTN2), myosin heavy chain 6 (MYH6), and myosin light chain 2 (MYL 2), myosin light chain 3 (MYL 3), and myosin light chain 7 (MYL 7)] (Fig. 2H). The decrease in cardiac gene expression can be attributed by an attenuation of cardiac maturation and/or a change in the number of cardiomyocytes present in the culture. On the other hand, MFN2 was reported to suppress cell proliferation and growth in different cell types (Ashraf and Kumar, 2022; Wang et al., 2010; Xin et al., 2021; Xu et al., 2017). To explore if cardiomyocyte proliferation has been affected, mESC-CMs were stained with 4'4’,6-diamidino-2-phenylindole (DAPI), anti-α-actinin, and anti-Ki67, where Ki67 is a commonly used proliferative activity marker (Gerdes et al., 1984). The immunostaining results showed that there were more Ki67-positive mESC-CMs (cells that were α-actinin-positive) in shMFN2 group than in shCtrl group (Fig. 2I and J), suggesting that MFN2 is required for the suppression of cellular proliferative capacity in mESC-CMs. Surprisingly, the flow cytometry results showed that there was no significant difference in the percentage of cardiac troponin (cTNT)-positive cells in shCtrl and shMFN2 groups (Fig. 2K), hinting that other factors in addition to MFN2 are required for the completion of proliferation. In addition, no change in the percentage of cardiomyocytes in the differentiation culture suggests the change in cardiac gene expression (Fig. 2H) was due to the decrease in maturation. Interestingly, knockdown of MFN2 also exerted similar effects on human ESC-CMs (hESC-CMs). In hESC-CMs, MFN2 knockdown led to a loss of organized sarcomere (Supplementary Fig. S2A and C) and a decrease of sarcomere length (Supplementary Fig. S2A and D) without altering the cell size (Supplementary Fig. S2A and B). Consistently, MFN2 knockdown decreased the expression of genes related to cardiac structure and structural maturation in hESC-CMs including MYL 2, troponin I type 3 (TNNI 3) and myosin heavy chain (MYH 7), while the expression of TNNT2 did not significantly change (Supplementary Fig. S2E). In addition, MFN2 knockdown did not change the percentage of cTNT-positive cells (Supplementary Fig. S2F). In short, our results suggest that MFN2 is required for cellular structural maturation of ESC-CMs.

Knockdown of MFN2 impaired cytosolic Ca²⁺ kinetics and electrophysiology of ESC-CMs

Diastolic and systolic Ca²⁺ concentration of mESC-CMs at day (7 + 9) were measured to be 58.8 and 250.9 nM, respectively (Supplementary Fig. S3A—C), which is similar to the recording of intracellular calcium changes in mESC-CMs from the previous publication (Sauer et al., 2001). Enhanced cytosolic Ca²⁺ kinetics and electrophysiology are important features of the maturation of cardiomyocytes, which promise proper cardiac excitation and contraction. To examine the role of MFN2 during the maturation of these processes, we stained mESC-CMs with fluo4-AM to monitor the cytosolic Ca²⁺ transient in the shCtrl and shMFN2 groups. Knockdown of MFN2 decreased the maximum upstroke velocity (Vmax)-upstroke, and Vmax-decay and did not alter the basal and amplitude of cytosolic Ca²⁺ transient (Fig. 3A and B). The results suggest that MFN2 is required for promoting cytosolic Ca²⁺ kinetics.

FIG. 3.

Knockdown of MFN2 impaired calcium handling and electrophysiology of mESC-CMs. (A) Representative cytosolic CaTs recorded from mESC-CMs infected with pAdTrack-CMV-mito-R-GECO1-U6-shCtrl or pAdTrack-CMV-mito-R-GECO1-U6-shMFN2 with staining of Fluo-4-AM. (B) Quantification of the Vmax-upstroke, Vmax-decay, amplitude, and basal of cytosolic CaTs from shCtrl and shMFN2 groups. Data were obtained from 28 to 30 cells from isolated beating EBs from three independent differentiation batches. (C) Representative AP traces recorded from mESC-CMs infected with pAdTrack-CMV-GFP-U6-shCtrl or pAdTrack-CMV-GFP-U6-shMFN2. (D) Quantification of the amplitude, MDP, DDR and Vmax-upstroke of APs. Data were obtained from 9 to 11 cells from isolated beating EBs from three independent differentiation batches. (E) Quantification of expression of selected Ca²⁺ handling genes and ion channel genes normalized to that of shCtrl group after knockdown of MFN2; the dash line represents the level of shCtrl group. Data were obtained from isolated beating EBs from five independent differentiation batches. Experiments were conducted on mESC-CMs at differentiation day (7 + 9). Data were presented as mean ± SEM. Student’s t-test was applied for statistical analysis, *p < 0.05; **p < 0.01; ***p < 0.001. AP, action potential; CaTs, Ca²⁺ transients; DDR, diastolic depolarization rate; GFP, green fluorescent protein; MDP, maximum diastolic potential; Vmax-upstroke, maximum upstroke velocity.

In addition, knockdown of MFN2 decreased the diastolic depolarization rate (DDR) and Vmax-upstroke, but it did not alter the maximum diastolic potential (MDP) and amplitude of action potential (AP) (Fig. 3C and D). Furthermore, quantitative polymerase chain reaction (qPCR) was conducted to examine the expression of genes related to the electrophysiology of cardiomyocytes. Intriguingly, MFN2 knockdown did not alter the expression of most of the selected genes related to Ca²⁺ kinetics [inositol 1,4,5-trisphosphate receptor type 1, inositol 1,4,5-trisphosphate receptor type 2, ryanodine receptor 2 (RYR2), and sarcoplasmic/endoplasmic reticulum Ca²⁺-ATPase 2a (SERCA2a)], nor did it alter the expression of potassium voltage-gated channel subfamily H member 2 (KCNH2) (Fig. 3E). Nevertheless, the expression of inositol 1,4,5-trisphosphate receptor type 3 decreased after the knockdown of MFN2. In line with the results in the mESC-CMs, MFN2 knockdown led to a decrease of Vmax-upstroke and Vmax-decay in hESC-CMs (Supplementary Fig. S2G and H). However, MFN2 knockdown decreased the expression of genes related to Ca²⁺ handling and electrophysiology in hESC-CMs including SERCA2a and KCNH2, while that of RYR2 did not change (Supplementary Fig. S2E). Altogether, our results suggest that MFN2 is required for the maturation of ESC-CMs in terms of cytosolic Ca²⁺ kinetics and electrophysiology.

Knockdown of MFN2 impaired the metabolic maturation of ESC-CMs

Metabolic maturation is another parameter reflecting the maturation of cardiomyocytes. More mature cardiomyocytes are expected to have enhanced oxidative phosphorylation and use fatty acid as the main source of substrate for energy production. By measuring the oxygen consumption rate in real-time, MFN2 knockdown was found to decrease the basal respiration, maximum respiration, spare respiration, and ATP production (Fig. 4A and B). Additionally, MFN2 knockdown caused a significant decrease in mitochondrial occupancy (Fig. 4C and D) (Supplementary Fig. S4) and a decrease in the expression of selected mtDNA-encoded genes [mitochondrially encoded cytochrome B (mtCYB), mitochondrially encoded ATP synthase membrane subunit 6, and mitochondrially encoded cytochrome C oxidase I (mtCO1)] (Fig. 4E) and mitochondrial transcription factor A (Fig. 4F). Taken together, knockdown of MFN2 impaired mitochondrial biogenesis, expression of mtDNA-encoded genes, and mitochondrial function. To further explore the role of MFN2 in metabolic maturation, the expression of selected genes related to fatty acid oxidative phosphorylation was examined. The expressions of multiple genes, including carnitine palmitoyltransferase II (CPT2), carnitine palmitoyltransferase 1B (CPT1B), very long-chain specific acyl-CoA dehydrogenase (ACADVL), and acetyl-CoA acetyltransferase 2, were decreased after MFN2 knockdown (Fig. 4G). In line with the findings in mESC-CMs, MFN2 knockdown decreased the expression of genes related to metabolic maturation in hESC-CMs including CPT1B, CPT2, ACADVL, and CD36 (Supplementary Fig. S2E). In short, our results suggest that MFN2 is required for the metabolic maturation of ESC-CMs.

FIG. 4.

Knockdown of MFN2 impaired metabolic maturation of mESC-CMs. (A) Representative real-time respiration measurements of mESC-CMs infected with pAdTrack-CMV-GFP-U6-shCtrl or pAdTrack-CMV-GFP-U6-shMFN2 responding to oligomycin (Oligo), FCCP, and rotenone/antimycin (R/A). (B) Quantification of basal respiration, maximum respiration, spare respiratory capacity, and ATP production. Data were normalized to that of the control group. Data were obtained from isolated beating EBs from three independent differentiation batches. (C) Representative confocal images showing MitoTracker red, α-actinin, and GFP in shCtrl and shMFN2 groups indicating mitochondria, sarcomere, and successful infection respectively. (D) Quantification of mitochondrial occupancy of shCtrl and shMFN2 groups. Data were obtained from 28 cells from isolated beating EBs from three independent differentiation batches. (E) Quantification of expression of selected mtDNA-encoded genes normalized to that of shCtrl group after knockdown of MFN2; the dash line represents shCtrl group. Data were obtained from isolated beating EBs from five independent differentiation batches. (F) Quantification of expression of mitochondrial transcription factors normalized to that of shCtrl group after knockdown of MFN2; the dash line represents shCtrl group. Data were obtained from isolated beating EBs from five independent differentiation batches. (G) Quantification of expression of selected fatty acid oxidative phosphorylation genes normalized to that of shCtrl group after knockdown of MFN2; the dash line represents shCtrl group. Data were obtained from isolated beating EBs from six independent differentiation batches. Experiments were conducted on mESC-CMs at differentiation day (7 + 9). Data were presented as mean ± SEM. Student’s t-test was applied for statistical analysis, *p < 0.05; **p < 0.01; ***p < 0.001. ATP, adenosine triphosphate; mtDNA, mitochondrial DNA.

Knockdown of MFN2 increased cellular ROS level, and activated PI3K/AKT/mTOR pathway, while ROS scavenger reversed the effect of MFN2 knockdown

MFN2 knockdown was found to increase proliferative capacity as reported in the previous section (Fig. 2I and J). Previous studies revealed that mTOR signaling is a core signaling pathway to regulate cell growth and proliferation (Laplante and Sabatini, 2009). Furthermore, the inhibition of mTOR signaling was reported to promote hiPSC-CM maturation (Garbern et al., 2020). Here, we speculated that MFN2 can suppress cell proliferative activity through suppressing mTOR activity in mESC-CMs. Supporting this speculation, the phosphorylation of mTOR (S2448) largely increased after MFN2 knockdown (Fig. 5A) while there was no significant change in the total mTOR (Fig. 5B).

FIG. 5.

Knockdown of MFN2 activated PI3K/AKT/mTOR through enhancing cellular ROS level in mESC-CMs. (A) (Left) Representative Western blot showing the level of phosphorylated mTOR in pAdTrack-CMV-mito-R-GECO1-U6-shCtrl and pAdTrack-CMV-mito-R-GECO1-U6-shMFN2 groups; (right) quantification of the level of phosphorylated mTOR normalized to β-actin. Data were obtained from isolated beating EBs from 3 independent differentiation batches. (B) (Left) Representative Western blot showing the level of total mTOR after knockdown of MFN2; (right) quantification of the level of total mTOR normalized to β-actin. Data were obtained from isolated beating EBs from three independent differentiation batches. (C) Representative confocal images showing the staining of cellular ROS (CellROX^TM Green, green) in shCtrl and shMFN2 groups. mESC-CMs were identified by cytosolic CaTs through staining with Rhod-2-AM. (D) Quantification of cellular ROS intensity of shCtrl and shMFN2 groups. Data were obtained from 14 cells from isolated beating EBs from three independent differentiation batches. (E–H) Representative Western blot showing the level of (E, left panel, indicated by arrow) phosphorylated PI3K p85 (Tyr458), (F, left panel) total PI3K p85, (G, left panel, indicated by arrow) phosphorylated AKT (Ser308), and (H, left panel) total AKT after knockdown of MFN2; quantification of the level of (E, right panel) phosphorylated PI3K p85 (Tyr458), (F, right panel) total PI3K p85, (G, right panel) phosphorylated AKT (Ser308), and (H, right panel) total AKT normalized to β-actin. Data were obtained from isolated beating EBs from 3–5 independent differentiation batches. (I–N) Representative Western blot showing the level of (I, left panel, indicated by arrow) phosphorylated PI3K p85 (Tyr458), (J, left panel) total PI3K p85, (K, left panel) phosphorylated AKT (Ser308), and (L, left panel) total AKT, (M, left panel) phosphorylated mTOR, and (N, left panel) total mTOR in ‘shMFN2 + solvent’ and ‘shMFN2 + NAC’ groups; quantification of the level of (I, right panel) phosphorylated PI3K p85 (Tyr458), (J, right panel) total PI3K p85, (K, right panel) phosphorylated AKT (Ser308), and (L, right panel) total AKT, (M, right panel) phosphorylated mTOR, and (N, right panel) total mTOR normalized to β-actin. Data were obtained from isolated beating EBs from three independent differentiation batches. For (I–N), N-acetylcysteine (NAC) (70601K, Adamas Life, Shanghai, China) was added into the medium to a final concentration of 2 mM to treat the cells for 4 h before harvest. Experiments were conducted on mESC-CMs at differentiation day (7 + 9). Data were presented as mean ± SEM. Student’s t-test was applied for statistical analysis, *p < 0.05; **p < 0.01, ***p < 0.001.

mTOR is the major downstream target of the phosphoinositide 3 kinase (PI3K)/Protein kinase B (AKT) pathway in regulating the cell proliferation, while the PI3K/AKT pathway is known to be activated by cellular ROS (Averill-Bates, 2024; Koundouros and Poulogiannis, 2018; Zhang et al., 2016). Intriguingly, knockdown of MFN2 increased the cellular ROS level in mESC-CMs (Fig. 5C and D) (Supplementary Fig. S5). It was reported that MFN2 exert anti-proliferative effect via PI3K/AKT in breast cancer (Ma et al., 2015), pancreatic cancer (Xue et al., 2018), and in case of liver fibrosis in rats (Chen et al., 2022). On the other hand, cellular ROS was reported to activate PI3K/AKT/mTOR pathway in M1 peritoneal macrophage (Han et al., 2019) and this pathway was found to exert anti-inflammatory effect (Shen et al., 2020). Our Western blot results showed that MFN2 knockdown increased the level of phosphorylated PI3K p85 (Tyr458) and phosphorylated AKT (Thr308) (Fig. 5E and G) while the protein level of total PI3K p85 and AKT remained unchanged (Fig. 5F and H). Interestingly, treatment of n-acetylcysteine (NAC), a ROS scavenger, reduced the upregulated level of phosphorylated PI3K p85 (Tyr458), phosphorylated AKT (Thr308), and phosphorylated mTOR (Fig. 5I,K, and M) caused by MFN2 knockdown while the protein level of total PI3K p85, AKT, and mTOR remained unchanged (Fig. 5J,L, and N). On the other hand, apart from blocking cell proliferative capacity by inhibiting the PI3K/AKT/mTOR pathway, MFN2 was also found to block the RAS/ERK 1/2 pathway and attenuate cell proliferation (Liu et al., 2019). However, our Western blot results showed no statistically significant difference in the level of phosphorylated ERK 1/2 (Supplementary Fig. S6A and B), total ERK 1/2 (Supplementary Fig. S6A and B), and RAS (Supplementary Fig. S6C and D) after MFN2 knockdown. Altogether, our results suggest that MFN2 negatively regulates the cell proliferative capacity and the ROS/PI3K/AKT/mTOR pathway.

Overexpression of GRP75 suppressed the increased cellular ROS level and reversed the activation of PI3K/AKT/mTOR pathway caused by MFN2 knockdown

MFN2 serves as a primary tether protein between ER and mitochondria (Chen et al., 2012; Dorn et al., 2015) while this intracellular organelle communication is essential for mitochondrial Ca²⁺ uptake and therefore optimization of mitochondrial functions as well as proper ROS signaling (Kohlhaas et al., 2010). The deficiency of MFN2 may lead to loss of MAM integrity. IP3R-GRP75-VDAC1 is the canonical and widely studied complex in the MAMs; it is documented to facilitate Ca²⁺ transfers from ER to mitochondria (Atakpa-Adaji and Ivanova, 2023; Paillard et al., 2013). Therefore, we hypothesized that MFN2 is required for the GRP75-mediated IP3R-VDAC1 coupling by maintaining the MAM integrity and SR-mitochondrial Ca²⁺ communication. To test this hypothesis, mESC-CMs were stained with MitoTracker deep red, ER-tracker blue, and Rhod-2 AM to indicate mitochondria, SR, and cells with calcium transients (i.e., mESC-CMs since only cardiomyocytes would have spontaneous calcium transients), respectively. MFN2 knockdown led to a decrease of SR-mitochondria overlapping (Fig. 6A and B), suggesting a potential loss of MAMs.

FIG. 6.

MFN2 positively regulated the IP3R-VDAC coupling through GRP75. (A) Representative confocal images showing the staining of mitochondria and SR of mESC-CMs from pAd-CMV-GFP-U6-shCtrl and pAd-CMV-GFP-U6-shMFN2 groups using MitoTracker deep red (pseudo-colored as red) and ER-tracker blue (pseudo-colored as green), respectively. mESC-CMs were identified by CaTs through staining with Rhod-2-AM. (B) Quantification of SR-mitochondria overlapping with Mander’s colocalization coefficient. Data were obtained from 11–12 cells from isolated beating EBs from 3 independent differentiation batches. (C) (Upper) Representative Western blot showing the expression of GRP75 after knockdown of MFN2; (lower) quantification of the expression of GRP75 (MAM/cytosolic GRP75 and total GRP75) normalized to β-actin. Data were obtained from isolated beating EBs from 3 independent differentiation batches. (D) Representative confocal images showing the staining of nucleus (DAPI, blue), F-actin (phalloidin, far red, pseudo-colored as gray), and IP3R2-VDAC1 coupling by PLA (red) of mESC-CMs from shCtrl and shMFN2 groups. (E) Quantification of the number of PLA punta from (D); Data were obtained from 13 to 14 cells from isolated beating EBs from three independent differentiation batches. (F) (Upper) Representative Western blot showing the expression of GRP75 in ‘shMFN2 + OE vector’ and ‘shMFN2 + OE GRP75′ groups where MFN2 knockdown was done by pAdTrack-CMV-GFP-U6-shMFN2 and GRP75 overexpression was done by pAdTrack-CMV-BFP-CMV-GRP75; (lower) quantification of the expression of GRP75 (MAM/cytosolic GRP75 and total GRP75) normalized to β-actin. Data were obtained from isolated beating EBs from three independent differentiation batches. (G) Representative confocal images showing the staining of nucleus (DAPI, blue), F-actin (phalloidin, far red, pseudo-colored as gray), and IP3R2-VDAC1 coupling by PLA (red) of mESC-CMs from ‘shMFN2 + OE vector’ and ‘shMFN2 + OE GRP75′ groups. (H) Quantification of number of PLA punta from (G); Data were obtained from 12 to 17 cells from isolated beating EBs from 3 independent differentiation batches. Experiments were conducted on mESC-CMs at differentiation day (7 + 9). Data were presented as mean ± SEM. Student’s t-test was applied for statistical analysis, *p < 0.05; ***p < 0.001. ER, endoplasmic reticulum; MAM, mitochondrial associated membrane; PLA, proximity ligation assay.

GRP75 is endowed with a mitochondrial targeting signal peptide (Szabadkai et al., 2006), and the cleaved GRP75 is imported into the mitochondrial matrix and has a lower molecular weight compared with the cytosolic GRP75. Therefore, two bands of GRP75 can be observed in the Western blot analysis of multiple studies (Bozidis et al., 2010; Li et al., 2018; Pilotto et al., 2022). The heavier band (upper band) was found to concentrate in the MAM fraction (Bozidis et al., 2010; Pilotto et al., 2022). The heavier form of GRP75 did not resist Proteinase K (Bozidis et al., 2010; Szabadkai et al., 2006), suggesting that this heavier form of GRP75 is cytosolic. It was found that the “cytosolic” GRP75 executes ER-mitochondrial Ca²⁺ transferring (Szabadkai et al., 2006). Taken together, the GRP75 in the MAM region has a higher molecular weight compared with the mitochondrial matrix GRP75; in the Western blot analysis, the upper band is MAM GRP75/cytosolic GRP75/cytosolic, while the lower band is mitochondrial matrix GRP75.

MFN2 knockdown decreased the protein level of GRP75 (both MAM GRP75/cytosolic GRP75 and total GRP75) (Fig. 6C). In addition, in our study, overexpression of GRP75 in mESC-CMs (Supplementary Fig. S7A) and HEK293 FT cells (Supplementary Fig. S7B) both led to an increase in the upper band of GRP75; this upper band decreased after knockdown of MFN2 (Supplementary Fig. S7A) or knockdown of GRP75 (Supplementary Fig. S7B); Further, the intensity of this upper band of GRP75 changed in proportion to the amount of transfected GRP75 plasmid (Supplementary Fig. S7B). All these data suggested that the upper band represents GRP75. In short, MFN2 knockdown decreased the protein level of GRP75 (both MAM GRP75/cytosolic GRP75 and total GRP75).

For the three isoforms of IP3Rs, the expression of IP3R2 was reported to be the highest among the three in cardiomyocytes (Wojcikiewicz, 1995). Knockdown of MFN2 did not change the expression of IP3R2 protein but decreased that of IP3R1 and IP3R3 proteins (Supplementary Figs. S8—F). It is likely that MFN2 knockdown may have decreased the IP3R1-VDAC1 and IP3R3-VDAC1 coupling due to the decreased protein level of these IP3Rs. While the expression of IP3R2 was unaltered by MFN2 knockdown, proximity ligation assay (PLA) revealed that the coupling of IP3R2-VDAC1 decreased after MFN2 knockdown. The puncta number generated from PLA was less in shMFN2 group when compared with that of shCtrl group (Fig. 6D and E).

GRP75 protein was efficiently overexpressed in MFN2 knocked down mESC-CMs (Fig. 6F). Consistent with the role of GRP75 in mediating the coupling of IP3R and VDAC, overexpression of GRP75 in shMFN2 group (‘shMFN2 + OE GRP75′ group) increased the coupling of IP3R2-VDAC1 as reflected by the increase in PLA signal puncta when compared with ‘shMFN2 + OE vector’ group (Fig. 6G and H). The results suggest there is an enhanced SR-mitochondria communication upon overexpression of GRF75.

Some previous studies have reported that the expression level of GRP75 affects cellular ROS level (Li et al., 2022; Tiwary et al., 2021). Consistent with previous studies, overexpression of GRP75 in the background of MFN2 knockdown decreased the enhanced cellular ROS level caused by MFN2 knockdown (Fig. 7A and B). Additionally, overexpression of GRP75 in the background of MFN2 knockdown decreased the enhanced level of phosphorylated PI3K p85 (Tyr458) and phosphorylated AKT (Thr308) caused by MFN2 knockdown (Fig. 7C and E) without affecting the protein level of total PI3K p85 and AKT (Fig. 7D and F). Consistent with the above findings, it was recently reported that inhibition of PI3K/AKT pathway promoted cardiomyocyte maturation (Garay et al., 2022). Importantly, the level of phosphorylated mTOR was restored by overexpression of GRP75 in the background of MFN2 knockdown (Fig. 7G), while the protein level of total mTOR remained unchanged (Fig. 7H). The results suggest MFN2 negatively regulates the cellular ROS level and PI3K/AKT/mTOR pathway through GRP75-dependent ER-mitochondrial communication.

FIG. 7.

Overexpression of GRP75 restored the increased cellular ROS and reversed the activated PI3K/AKT/mTOR caused by the knockdown of MFN2. (A) Representative confocal images showing the staining of cellular ROS (CellROX^TM Green, green) in ‘shMFN2 + OE vector’ and ‘shMFN2 + OE GRP75′ groups where MFN2 knockdown was done by pAdTrack-CMV-mito-R-GECO1-U6-shMFN2 and GRP75 overexpression was done by pAdTrack-CMV-BFP-CMV-GRP75. mESC-CMs were identified by cytosolic CaTs through staining with Rhod-2-AM. (B) Quantification of cellular ROS intensity of ‘shMFN2 + OE vector’ and ‘shMFN2 + OE GRP75′ groups. Data were obtained from 17to 20 cells from isolated beating EBs from 3 independent differentiation batches. (C–H) Representative Western blot showing the level of (C, left panel, indicated by arrow) phosphorylated PI3K p85 (Tyr458), (D, left panel) total PI3K p85, (E, left panel, indicated by arrow) phosphorylated AKT (Ser308), (F, left panel) total AKT, (G, left panel) phosphorylated mTOR, and (H, left panel) total mTOR in ‘shMFN2 + OE vector’ and ‘shMFN2 + OE GRP75′ groups; quantification of the level of (C, right panel) phosphorylated PI3K p85 (Tyr458), (D, right panel) total PI3K p85, (E, right panel) phosphorylated AKT (Ser308), (F, right panel) total AKT, (G, right panel) phosphorylated mTOR, and (H, right panel) total mTOR normalized to β-actin. Data were obtained from isolated beating EBs from 3 to 4 independent differentiation batches. Experiments were conducted at mESC-CMs differentiation day (7 + 9). Student’s t-test was applied for statistical analysis, * refers to p < 0.05; ** refers to p < 0.01; *** refers to p < 0.001.

MFN2 is required for mESC-CMs maturation through mTOR activity

Regarding the above hypothesis and findings, we further hypothesized that MFN2 is required for cardiomyocyte maturation through suppression of mTOR-mediated cell proliferation. Treatment of rapamycin, an mTORC1 inhibitor, in shCtrl group decreased the phosphorylation of mTOR (S2448) without changing the total mTOR (Supplementary Fig. S9A—D). In addition, rapamycin treatment increased the DDR, but it did not alter the MDP, Vmax-upstroke and amplitude of AP (Supplementary Fig. S9E and F). When the mESC-CMs in shMFN2 group were treated with rapamycin, rapamycin treatment was found to attenuate the phosphorylation of mTOR (Fig. 8A) while there was no significant change in the total mTOR (Fig. 8B). The results confirmed that rapamycin was working as expected and that mTORC1 inhibition can be reflected by the negative phosphorylation status of mTOR in mESC-CMs. Importantly, the administration of rapamycin attenuated cellular proliferation status caused by MFN2 knockdown as revealed by a lower proportion of α-actinin-positive cells being Ki67-positive (Fig. 8C and D). Moreover, the impaired electrophysiology caused by the knockdown of MFN2 was restored in terms of DDR by rapamycin (Fig. 8E and F). In short, our results suggest that MFN2 is involved in the maturation of mESC-CMs through mTOR-mediated suppression of cell proliferation to some extent.

FIG. 8.

Rapamycin restored the phosphorylation of mTOR and electrophysiology of mESC-CMs caused by knockdown of MFN2. (A) (Left panel) Representative Western blot showing the level of phosphorylated mTOR after treatment of rapamycin upon knockdown of MFN2 by pAdTrack-CMV-mito-R-GECO1-U6-shMFN2; (right panel) quantification of the phosphorylated mTOR normalized to β-actin. Data were obtained from isolated beating EBs from three independent differentiation batches. (B) (Left panel) Representative Western blot showing total mTOR after treatment of rapamycin upon knockdown of MFN2; (right panel) quantification of total mTOR normalized to β-actin. Data were obtained from isolated beating EBs from three independent differentiation batches. (C) Representative confocal images showing the staining of nucleus (DAPI, blue), α-actinin (green), and Ki67 (far red, pseudo-colored as purple) in ‘shMFN2 + DMSO’ and ‘shMFN2 + Rapamycin’ groups. Yellow arrows indicate the Ki67-positive mESC-CM-CMs. (D) Quantification of the % of Ki67-positive mESC-CMs in ‘shMFN2 + DMSO’ and ‘shMFN2 + Rapamycin’ groups. Data were obtained from isolated beating EBs from 4 independent differentiation batches. (E) Representative AP traces recorded from ‘shMFN2 + DMSO’ and ‘shMFN2 + Rapamycin’ groups. (F) Quantification of the amplitude, MDP, DDR, and Vmax-upstroke of APs. Data were obtained from 12 cells from isolated beating EBs from 3 independent differentiation batches. Rapamycin was added into the medium to a final concentration of 100 nM for 72 h before experiment, and the medium-containing rapamycin was changed every day till further experiments. Experiments were conducted on mESC-CMs at differentiation day (7 + 9). Data were presented as mean ± SEM. Student’s t-test was applied for statistical analysis, *p < 0.05; **p < 0.01; ***p < 0.001.

Discussion

In this study, whether MFN2 participates in the maturation of ESC-CMs and the underlying mechanism were explored. The major findings in this study are as follows: (1) MFN2 regulates the maturation of ESC-CMs, (2) MFN2 regulates the maturation of mESC-CMs via the IP3R-GRP75-VDAC1-dependent mTOR activity, and (3) the regulation of mTOR activity by MFN2/GRP75 is related to cellular ROS and PI3K/AKT activity. Altogether, we found that MFN2 is required for the maturation of ESC-CMs through IP3R-GRP75-VDAC1-dependent, mTOR-mediated suppression of proliferative capacity.

MFN2 was previously shown to direct cardiac metabolic maturation through mitochondrial biogenesis and mitophagy (Gong et al., 2015; Papanicolaou et al., 2012). In our current investigation, in addition to metabolic maturation, MFN2 has also been found to promote other aspects of the maturation of cardiomyocytes; moreover, the regulatory effect of MFN2 on maturation was found to be GRP75-dependent and mediated by mTOR activity.

The first novel finding in our study is that MFN2 is required for the maturation of ESC-CMs. When MFN2 was knocked down, maturation of ESC-CMs was attenuated. It is believed that MFN2 knockdown prevents cardiomyocytes from maturing instead of simply delaying their maturation since MFN2 knockdown led to direct defects in mitochondrial function and Ca²⁺ handling, which are cardiomyocyte maturation parameters. In addition, these defects in maturation parameters are not likely to be compensated. In support of this notion, previous studies have reported the decrease in expression of MFN2 in the case of cardiac hypertrophy and heart failure (Chen et al., 2021; Ren et al., 2022), suggesting that a decrease in MFN2 would lead to incomplete heart function even after the hearts have gained maturation properties and the effects cannot be compensated.

Intriguingly, MFN2 knockdown was found to increase the proliferative capacity of mESC-CMs as indicated by the increase in the Ki67-positive cell portion. Indeed, it has been known that immediately after birth, cardiomyocytes exit the cell cycle and most of them will not proliferate. It was observed that only a very small portion of adult cardiomyocytes can proliferate at a slow rate (Pasumarthi and Field, 2002; Rumyantsev, 1977). With the progressive loss of cell proliferative activity, the cardiomyocytes eventually gain complete phenotypic maturation after terminal differentiation (Singh et al., 2023). These results suggest that the maturation of cardiomyocytes is associated with cell cycle exit. On the other hand, the utilization of fatty acid as the main source of substrate for energy production and active mitochondrial biogenesis characterize cardiomyocyte metabolic maturation. Recently, emerging results have shown that inhibition of fatty acid oxidation mediated by CPT1B, and inhibition of mitochondrial protein translation mediated by mitochondrial ribosomal protein S5 enable heart regeneration (Gao et al., 2023; Li et al., 2023). These interesting findings suggest a tiny portion of adult cardiomyocytes probably have a limited capacity to reenter the cell cycle and proliferate. In a previous study, YAP-mediated inhibition of cardiomyocyte proliferation was found to strongly correlate with cardiomyocyte maturation (Boogerd et al., 2023). Similarly, both inhibition of PI3K/AKT (Garay et al., 2022) and inhibition of mTOR have been reported to inhibit proliferation while concomitantly promote cardiomyocyte maturation (Garbern et al., 2020; Paltzer et al., 2024). Regarding the downstream effectors of mTOR, STAT3 and cyclin D1 have been suggested to be the downstream effectors of mTOR and promote cell cycle progression in cancer cells (Liu et al., 2019); while in hiPSC-CMs, mTOR inhibition has been reported to promote p53-mediated initiation of quiescence and positively regulate maturation (Garbern et al., 2020). Overall, it is believed that for the maturation of PSC-CMs (Garbern et al., 2020), the exit of the cell cycle is a prerequisite. In our current study, MFN2 was found to enhance mESC-CM maturation by inhibiting the proliferative capacity of cardiomyocytes.

Interestingly, upon MFN2 knockdown, despite an increase in the Ki67-positive signal, no increase in the number of cardiomyocytes was detected. We reasoned that as MFN2 knockdown already led to dysfunctional mitochondrial dynamics and impaired mitochondrial distribution (Filadi et al., 2018), and that proper mitochondrial distribution is needed prior to cytokinesis, the impaired mitochondrial distribution caused by MFN2 knockdown would hamper cytokinesis. In addition, in our current study, MFN2 knockdown was found to increase the phosphorylation of mTOR at Ser2448, an activation marker of mTOR (Sekulić et al., 2000), in mESC-CMs. Garbern et al. showed that inhibition of mTOR signaling would increase cardiomyocyte maturation through the promotion of cardiomyocytes’ quiescence without affecting the absolute number or purity of cardiomyocytes (Garbern et al., 2020). It hints that the suppression of generating new cardiomyocytes is dispensable for the maturation of PSC-CMs, and that suppression of mTOR-mediated cell cycle progression would be sufficient to enhance maturation.

Indeed, MFN2 is known to tether the SR/ER and mitochondria and regulates the communication of these two organelles (Konstantinidis et al., 2012). Changing the expression of MFN2 led to either a decrease in the expression of some isoforms of IP3Rs (IP3R1 and IP3R3) or a decrease in the physical coupling between IP3R2 and VDAC1 as shown by PLA. It is therefore speculated that MFN2 through decreasing the communication between SR and mitochondria, decreases the signaling mediated via the IP3R-GRP75-VDAC pathway.

The increase of cellular ROS level is known to activate PI3K/AKT activity which in turn activates mTOR activity (Averill-Bates, 2024; Koundouros and Poulogiannis, 2018; Zhang et al., 2016). In our study, MFN2 knockdown was found to increase the cellular ROS level and activate PI3K/AKT/mTOR activity, and the effect of MFN2 knockdown was reversed by the ROS scavenger or by the overexpression of GRP75. This suggests that ROS acts as upstream of PI3K/AKT/mTOR to activate this pathway. On the other hand, it is also possible that PI3K/AKT phosphorylation promotes NADPH oxidase NOX2 assembly initiation and subsequent O²⁻ production (Akhiani and Martner, 2022); O²⁻ then acts to further enhance PI3K/AKT phosphorylation, forming a positive feedback loop. More importantly, our results suggest that MFN2 inhibits PI3K/AKT/mTOR pathway through the GRP75 protein level and the cellular ROS level, thereby suppressing the proliferative capacity of. cardiomyocytes. Low mitochondrial Ca²⁺ was found to lead to less reduced form of NADH and NADPH, which consequently led to higher oxidative stress (Bertero and Maack, 2018). We therefore speculated that MFN2 knockdown led to low mitochondrial Ca²⁺, while overexpression of GRP75 increased mitochondrial Ca²⁺. Further experiments would be needed to testify this speculation. Nonetheless, the ability of GRP75 to reverse the effect of MFN2 knockdown clearly indicates the importance of SR-mitochondrial communication in regulating the activity of PI3K/AKT and the downstream mTOR.

Innovation

Pluripotent stem cell-derived cardiomyocytes (PSC-CMs) have the potential for use in cell-based therapy, disease modeling, and drug toxicity testing but remain immature under the conventional differentiation protocol. Our study identifies MFN2 as a novel regulator of ESC-CM maturation, acting via a GRP75-dependent suppression of ROS/PI3K/AKT/mTOR axis. The availability of FDA-approved drugs targeting the PI3K/AKT/mTOR axis provides a translatable strategy to improve PSC-CM maturity for research and clinical applications.

Materials and Methods

Electronic laboratory notebook was not used.

mESC culture, mESC-CM differentiation, isolation of mESC-CMs, hESC culture, and hESC-CM differentiation

D3 mESC line (https://www.atcc.org/products/crl-1934; ATCC, Manassas, VA, USA) was cultured as previously described (Ding et al., 2023; Liu et al., 2021). Briefly, mESCs were grown on gamma-ray-irradiated mouse embryonic fibroblasts (MEFs), with Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, CA, USA) containing 15% heat-inactivated fetal bovine serum (FBS) (Hyclone, GE Healthcare, South Logan, UT, USA), 2 mM l-glutamine (Invitrogen), 0.1 mM non-essential amino acids (NEAA) (Invitrogen), 1% v/v penicillin-streptomycin (Invitrogen), 0.1 mM β-mercaptoethanol (Invitrogen), and 1000 U/mL leukemia inhibitory factor (Chemicon, Millipore, Billerica, MA, USA) to maintain the undifferentiated status of mESCs. EB method was utilized for differentiation. Cells were digested with 0.05% trypsin (Invitrogen) and resuspended in ESC medium, followed by being plated on a culture dish pre-coated with 0.1% gelatin (Sigma, St. Louis, Missouri, USA) to remove MEFs. Cells were then resuspended in differentiation medium containing DMEM (Invitrogen) with 15% heat-inactivated FBS (Hyclone), 2 mM l-glutamine (Invitrogen), 0.1 mM NEAA (Invitrogen), 1% v/v penicillin-streptomycin (Invitrogen), and 0.1 mM β-mercaptoethanol (Invitrogen), and were made into hanging drops with 800 cells per 20 µL medium. On differentiation day 2, EBs were washed down to non-attaching petri dishes, followed by incubation for another 5 days. On day 7, EBs were attached to dishes pre-coated with 0.1% gelatin and checked daily for the appearance of beating phenotypes. Isolation of mESC-CMs was conducted as previously described (Liu et al., 2021). Briefly, beating EBs were dissected out and dissociated with 1 mg/mL collagenase B (Roche Diagnostics, Basel, Switzerland) in NB buffer containing 120 mM NaCl, 5.4 mM KCl, 5 mM MgSO₄, 5 mM Na pyruvate, 20 mM glucose, 20 mM taurine, 10 mM HEPES, and 30 μMCaCl₂, and pH was adjusted to 6.9 by NaOH. Collagenase B was removed by centrifugation and cells were resuspended with KB buffer containing 85 mM KCl, 30 mM K₂HPO₄, 5 mM MgSO₄, 1 mM EGTA, 5 mM pyruvic acid, 5 mM creatine, 20 mM taurine, 20 mM glucose, and 87 μM of Na-ATP (Sigma), and pH was adjusted to 7.2 by NaOH. Thereafter, cells were plated on glass slides/confocal dishes/culture dishes with differentiation medium added for further experiments.

HESC line H7 (WiCell, https://www.wicell.org/product/wa07/) were cultured and differentiated according to previously established protocol (Tsoi et al., 2022). In brief, undifferentiated H7 cells were cultured in Essential 8 medium plus supplement (Thermo Fisher Scientific, Maltham, MA, USA) on 6 well plates coated with Matrigel (Corning, Kennebunk, ME, USA) at 37°C and 5% CO₂. Cardiac differentiation was initiated when H7 cells reached 60–80% confluency 3–4 days after seeding. Media was changed to RPMI 1640 (Thermo Fisher Scientific) supplemented with B27 minus insulin (50X, Thermo Fisher Scientific) on day 0. CHIR 99021 (6 µM, Cayman Chemical, Ann Arbor, MI, USA) was applied from days 0–2 of differentiation, followed by application of IWP-2 (5 µM, Cayman Chemical) and XAV 939 (5 µM, Cayman Chemical) from day 2–4. Cells were cultured in RPMI 1640 (Thermo Fisher Scientific) supplemented with B27 minus insulin (50X, Thermo Fisher Scientific) from day 4–6 and maintained in B27 with insulin (Thermo Fisher Scientific) supplemented RPMI 1640 (Thermo Fisher Scientific) from day 8 onwards. Media was refreshed every 3–4 days. Experiments conducted on H7 hESC-CMs were at day 30.

Molecular cloning

Adenovirus shuttle plasmid pAdTrack-CMV-GFP-U6 (Ding et al., 2023) was used as the backbone for shRNA subcloning. It harbors a U6 promoter to drive shRNA transcription; it also has a CMV promoter driving the expression of GFP which can be used as a fluorescent marker. To construct the MFN2 knockdown plasmid or GRP75 knockdown plasmids, a similar method was utilized as previously described (Liu et al., 2021) with modification of target sequences. The target sequences, shMFN2-0609 (GCGGGTTTATTGTCTAGAAAT) and shGRP75 (TGTGCCTCGTTATCAAGAGAA), were used to knockdown MFN2 and GRP75, respectively. The following primers with 5′ end and 3′ end phosphorylation were synthesized and annealed:

shMFN2-0609-F: 5′-CCGGGCGGGTTTATTGTCTAGAAATCTCGAGATTTCTAGACAATAAACCCGCTTTTTG-3′;

shMFN2-0609-R: 5′-TCGACAAAAAGCGGGTTTATTGTCTAGAAATCTCGAGATTTCTAGACAATAAACCCGC-3′;

shGRP75-F: 5′-CCGGTGTGCCTCGTGAACTCGAGTTCTCTTGATAATATCAAGACGAGGCACATTTTTG-3′;

shGRP75-R: 5′- TCGACAAAAATGTGCCTCGTTATCAAGAGAACTCGAGTTCTCTTGATAACGAGGCACA-3′.

Thereafter, the annealed primers were ligated into adenoviral shuttle plasmid pAdTrack-CMV-GFP-U6 at AgeI and XhoI restriction sites to obtain pAdTrack-CMV-GFP-U6-shMFN2/shGRP75. The plasmid pAdTrack-CMV-GFP-U6-shCtrl harboring control non-targeting shRNA sequence (shCtrl) was made previously (Ding et al., 2023); this plasmid served as the knockdown control.

To use Fluo-4-AM (Invitrogen) to measure cytosolic Ca²⁺ kinetics while still allowing the identification of transduced cells, GFP of pAdTrack-CMV-GFP-U6-shCtrl and pAdTrack-CMV-GFP-U6-shMFN2 were replaced by mito-R-GECO1 from pcDNA3.1(-)-CMV-mito-R-GECO1 (#46021, Addgene, Watertown, MA, USA). CMV-mito-R-GECO1 was amplified by PCR Platinum Pfx DNA Polymerase (Thermo Fisher Scientific) with the following primers:

CMV-mito-R-GECO1-F-KpnI:

5′-GTAATACTGGTACCGCGGCCGCGACATTGATTATTGACTA-3′;

CMV-mito-R-GECO1-R-HpaI:

5′-AACGGGTTACTTCGCTGTCATCATTTG-3′.

PCR products were then subcloned into adenoviral shuttle plasmid pAdTrack-CMV-GFP-U6-shCtrl and pAdTrack-CMV-GFP-U6-shMFN2 at KpnI and HpaI restriction sites to obtain pAdTrack-CMV-mito-R-GECO1-U6-shCtrl and pAdTrack-CMV-mito-R-GECO1-U6-shMFN2, respectively.

To overexpress GRP75, GRP75 mRNA was reversely transcribed into GRP75 cDNA by SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). Thereafter, GRP75 cDNA was amplified by PCR using Platinum Pfx DNA Polymerase (Thermo Fisher Scientific) with the following primers:

GRP75-F-KpnI: 5′-ACTGACGGTACCATGATAAGCGCCAGCAGAGC-3′;

GRP75-R-KpnI: 5′-ACTGACGGTACCTTACTGTTTCTCTTCCTTCTG-3′.

The PCR products were then subcloned into adenoviral shuttle plasmid pAdTrack-CMV-BFP-CMV (Ding et al., 2023; Liu et al., 2021) at the KpnI restriction site to obtain pAdTrack-CMV-BFP-CMV-GRP75.

Adenovirus infection and lentivirus infection

AdEasy Adenoviral Vector System Kit (Agilent Technologies, Santa Clare, CA, USA) was used to prepare adenovirus according to the manufacturer’s protocol as previously described (Liu et al., 2021). Briefly, adenoviral shuttle plasmids with gene-of-interest were linearized and transformed into E. coli BJ5183AD (which already contains adenoviral backbone plasmid) cells by electroporation. Candidate recombinants were picked and cultured in LB medium followed by plasmids extraction with an alkaline lysis plasmid isolation approach. Diagnostic restriction digestion was used to screen for positive recombinants followed by transformation into E. coli DH5α cells for amplification. Thereafter, recombinant plasmids were transfected into HEK-293-AD cells (https://www.agilent.com/en/product/protein-expression/protein-expression-vectors-kits/viral-mediated-delivery-systems/ad-293-cells-232994; Agilent Technologies) with Lipofectamine 2000 (Invitrogen). Several days after transfection, HEK-293-AD cells were subjected to three rounds of freeze/thaw by alternating the tube between absolute an ethanol bath at −80°C and a 37°C water bath, with vigorous vortex for 3 min after each thaw. Cellular debris was collected by centrifuge. The supernatant (primary virus stock) was used to infect HEK-293-AD cells, and infection was repeated two more times in order to obtain viruses with higher titer. Cells were infected with viruses for 6 h and cultured in a normal medium for 4 days before being harvested for subsequent experiments.

Lentivirus harboring shMFN2 was used to knockdown MFN2 in hESC-CMs. The MISSION pLKO.1-shMFN2 (TRCN0000082687, Sigma) or pLKO.1-shCtrl [obtained from Dr. Chan (Chan et al., 2020)] was co-transfected with psPAX2 (#12260, Addgene, Watertown, MA, USA) and pMD2.G (#12259, Addgene) in HEK-293-FT cells (https://www.thermofisher.com/order/catalog/product/hk/en/R70007; Thermo Fisher Scientific) using Lipofectamine 2000 reagent (Invitrogen). The culture supernatant with lentiviruses was harvest after 48 h and filtered through a 0.45 μm filter. The supernatant was used to infect hESC-CMs at day 25 for 1 day. The cells were selected under 0.5 μg/mL puromycin (Sigma-Aldrich) for 4 days.

Confocal Ca²⁺ imaging

Isolated mESC-CMs were infected with indicated viruses and stained with 5 μM Fluo-4-AM (Invitrogen) in culture medium. The cells were then washed with and bathed in pre-warmed Tyrode’s solution for cytosolic Ca²⁺ measurement. The Tyrode’s solution contained 1 mM MgCl₂, 1.8 mM CaCl₂, 5.4 mM KCl, 10 mM glucose, 10 mM HEPES, and 140 mM NaCl, pH 7.4 (adjusted by NaOH). Leica SP8 confocal microscope (Leica, Wetzlar, Germany) was used for Ca²⁺ imaging in XYT mode. For the cytosolic Ca²⁺ transients (CaTs), a 488 nm laser was used for excitation, while a filter of 510—560 nm wavelength was used for detecting emission. ImageJ (NIH, Bethesda, MD, USA) and Excel were used to analyze the signals from CaT imaging.

Cellular Ca²⁺ content determination

The cellular Ca²⁺ concentration was determined following the protocol provided by the calcium calibration buffer kit (C3008MP, Thermo Fisher Scientific). In brief, the cellular Ca²⁺ content of ESC-CMs at day (7 + 9) were determined by the following equation.

{[C a^{2 +}]}_{f ree} = K d [(F - F_{m i n}) / (F_{m a x} - F)]

F: Fluorescence of the indicator at experimental calcium concentration

F_min: Fluorescence in the absence of calcium (pH 7.2 at 37°C)

F_max: Fluorescence of the indicator at saturated calcium concentration (28.0 μM Ca²⁺, pH 7.2 at 37°C)

Kd: Dissociation constant.

The ESC-CMs were stained with 5 μM Fluo 4-AM for 15 min, and the intensity was recorded in buffer containing 10 mM EGTA in 100 mM KCl, 30 mM MOPS, pH 7.2 at 37°C. Kd was calculated via nonlinear regression based on the fluorescence intensities corresponding to a series of calcium ion concentrations (Supplementary Fig. S3A).

Western blotting

Western blot was done as previously described (Liu et al., 2021). Twenty-five μg or 40 μg protein of each group was loaded to SDS-PAGE gel and transferred to 0.45 μm polyvinylidene fluorid membranes (Millipore, Burlington, MA, USA). 5% (w: v) non-fat dry milk or 3% BSA was used to block membranes for 1 hour at room temperature, followed by incubation with primary antibodies overnight. The membranes were washed with TBST three times and incubated with secondary antibodies for 1 hour at room temperature. Signals were developed with Clarity Western ECL Substrate (Bio-Rad, Hercules, CA, USA), and pictures were taken by ChemiDoc Touch (Bio-Rad). Following primary antibodies were used: anti-MFN2 (1:1000, AB56889, Abcam, Cambridge, UK), anti-IP3R1 (1:1000, ACC-019, Alomone, Jerusalem, Israel), anti-IP3R2 (1:1000, SC-398434, Santa Cruz Biotechnology, Dallas, TX, USA), anti-IP3R3 (1:1000, 610312, BD Biosciences, Milpitas, CA, USA), anti-β-tubulin (1:1000, 15115S, Cell Signaling Technology, Danvers, MA, USA), anti-β-actin (1:1000, AB8226, Abcam), anti-α-actinin (1:1000, AB9465, Abcam), anti-vinculin (1:1000, AB18058, Abcam), anti-mTOR (1:1000, 2983S, Cell Signaling Technology), anti-p-mTOR (Ser2248) (1:1000, 5536S, Cell Signaling Technology), and anti-GRP75 (1:1000, ab2799, Abcam), anti-p-PI3K p85(1:1000, 4228T, Cell Signaling Technology), anti-PI3K p85 (1:1000, 4257T, Cell Signaling Technology), anti-p-AKT (1:1000, 13038T, Cell Signaling Technology), anti-AKT (1:1000, 9272, Cell Signaling Technology). The following secondary antibodies were used: HRP-conjugated goat anti-rabbit secondary antibody 1:3000 (P044801, Dako, Zug, Switzerland) and HRP-conjugated goat anti-mouse secondary antibody 1:3000 (P044701, Dako).

qPCR

The qPCR was conducted as previously described (Liu et al., 2021). Trizol reagent (Thermo Fisher Scientific) was used to extract total RNA from mESC-CMs at day (7 + 9) or hESC-CMs at day 30. TURBO DNA-free DNase Treatment and Removal Reagents (Thermo Fisher Scientific) were used to remove genomic DNA. Reverse transcription was done by SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). TB Green Premix Ex Taq (Tli RNaseH Plus) (TaKaRa, Kyoto, Japan) was used for real-time PCR with CFX96 Real-Time PCR Detection System (Bio-Rad). Relative quantification of target gene expression was performed using the 2^−ΔΔCt method. Expression of selected genes was normalized to that of the housekeeping gene. The relative gene expression was normalized to that of the control group. Primers for qPCR were designed with Primer-Blast software from NCBI. Sequences of primers are shown in Table 1.

Table 1.

Primers for qPCR

Primer name	Sequence (5′-3′)
HPRT forward	TGACACTGGAAAAACAATGCA
HPRT reverse	GGTCCTTTTCACCAGCAAGCT
MFN2 forward	TACTTGGTGGCTGCAGTTTG
MFN2 reverse	GCAGAACTTTGTCCCAGAGC
MYH6 forward	AACCAGAGTTTGAGTGACAGAATG
MYH6 reverse	ACTCCGTGCGGATGTCAA
MYL2 forward	CTCCAAAGAGGAGATCGACCAG
MYL2 reverse	TGTTTATTTGCGCACAGCCC
TNNT2 forward	GCCAAAGATGCTGAAGAAGGT
TNNT2 reverse	GCACCAAGTTGGGCATGAAG
ACTC1 forward	TAGCACGCCTACAGAACCCA
ACTC1 reverse	CACAAAGATGCTGAAGAAGGT
ACTN2 forward	GTCAACACTCCCAAACCCGA
ACTN2 reverse	CTCCAACAGCTCACTCGCTA
MYL3 forward	GCCTATGCTCCAGCACATCT
MYL3 reverse	GTCAGTCTCTCACCCAGCGT
MYL7 forward	GGCACAACGTGGCTCTTCTAA
MYL7 reverse	TGCAGATGATCCCATCCCTGT
SCN5A forward	TGTTCCCATCGCAGTGGCTGA
SCN5A reverse	ACTTGGGATTCCTGCTGTTTGC
KCNH2 forward	ACAGGCTGGAAACCCGGCTA
KCNH2 reverse	CGCCACGAACTGGGAAACCTGA
RYR2 forward	CACCAGTACGACACAGGCTT
RYR2 reverse	TGCGTTTGATGCTCTCATGC
ITPR3 forward	TGAGATCAGCGAGCCGGTGT
ITPR3 reverse	ACCTGCATTGGTCAGCTCGGT
ITPR2 forward	ACCCTGAGGAAGGTTCTGCCAC
ITPR2 reverse	ACCCTGAGGAAGGTTCTGCCAC
ITPR1 forward	ACCCTGAGGAAGGTTCTGCCAC
ITPR1 reverse	ACCCTGAGGAAGGTTCTGCCAC
SERCA2A forward	ACCTTTGCCGCTCATTTTCC
SERCA2A reverse	GCTGCACACACTCTTTACCG
MTCYTB forward	ACACGCAAACGGAGCCTCAAT
MTCYTB reverse	TGCTGTGGCTATGACTGCGA
MTATP6 forward	AGCTCACTTGCCCACTTCCTTCC
MTATP6 reverse	TGTAAGCCGGACTGCTAATGCCA
MTND1 forward	TTCTGCCAGCCTGACCCATAGC
MTND1 reverse	ATGGGCCGGCTGCGTATTCTA
MTCO1 forward	TCACTACCAGTGCTAGCCGCA
MTCO1 reverse	AGAGAATTGGGTCCCCTCCTCCA
TFAM forward	GCAAAGGATGATTCGGCTCAGGGAA
TFAM reverse	TCGTCCAACTTCAGCCATCTGCT
TFB1M forward	CTTGAGGCTGACAGACAAGA
TFB1M reverse	AACCACCAGAAGCTCAGCAA
TFB2M forward	CCTTGGTCAGCAGGTGTTCCT
TFB2M reverse	CGCAGGAGTACAGATCGAACAGA
CPT2 forward	TGACAGCCAGTTCAGGAAGACAG
CPT2 reverse	GCCTGAGATGTAGCTGGTGTGC
CPT1B forward	TGGGCACCTCTGGGAGTTTGT
CPT1B reverse	GGGTGGCAACGTGGTGTTTG
MTCO2 forward	ACCTGGTGAACTACGACTGCT
MTCO2 reverse	TTAGTCGGCCTGGGATGGCA
CD36 forward	ACTGTGGCTAAATGAGACTGGGAC
CD36 reverse	GCCATCTCTACCATGCCAAGGA
ACADVL forward	AGTCGCAGTGGTGAACTGGCA
ACADVL reverse	AGGGACCTTGAGGCTCTGGACA
ACAT2 forward	TGACAAGGAGATTGTGCCAGTGC
ACAT2 reverse	CGCCATCGTTCATTCCTGATGCG
h-MFN2 forward	CGGGAAGGTGAAGTCAGGA
h-MFN2 reverse	AAGAGCAGGGACATTGCGTT
TUBB forward	CACTTGGGACCCGCTGCACATA
TUBB reverse	GCCGTTGTTCTAGGGCATGGCA
h-CPT1B forward	TGGTGCTCAAGTCATGGTGG
h-CPT1B reverse	TGAGCACAAGGTCCATGACA
h-CPT2 forward	AGAAGCAGCAATGGGCCAG
h-CPT2 reverse	TCGTGGACAGGACATTGTGG
h-ACADVL forward	TTTGATGGAGTACGGGTGCC
h-ACADVL reverse	GTGGCATGATCTACCGCCTT
h-CD36 forward	TTCTGCATCTGCTCCTGCAA
h-CD36 reverse	TGGTTTCTACAAGCTCTGGTTCTTA
h-MYH7 forward	ACACTTGAGTAGCCCAGGCACA
h-MYH7 reverse	TTGCCACCCTCTCGAGACAC
h-MYL2 forward	TTGACCCTGAAGGCAAAGGG
h-MYL2 reverse	CGAACATCTGGTCAACCTCCT
h-TNNI3 forward	CCAAGAACATCACGGAGATTGCAG
h-TNNI3 reverse	TTTCCTTCTCGGTGTCCTCCT
h-TNNT2 forward	CAAACCAAAGCCCAGGTCGT
h-TNNT2 reverse	ATCAGCGCCTGCAACTCATT
h-RYR2 forward	CTAATGTCTGGGTGGGCTGG
h-RYR2 reverse	TGCTGCGTTTGATGCTTTCA
h-KCNH2 forward	GCCATGTGACCTTGAGTGAC
h-KCNH2 reverse	TGATGAACTTACGGCCCTTC
h-ATP2A forward	ATGCCTGCAACTCGGTCATT
h-ATP2A reverse	ATCGATGTCCGGCTTGGTTT

ACADVL, very long-chain specific acyl-CoA dehydrogenase; ACAT2, acetyl-CoA acetyltransferase 2; ACTC1, cardiac α-actin; ACTN2, α-actinin-2; CPT1B, carnitine palmitoyltransferase 1B; CPT2, carnitine palmitoyltransferase II; h-, human-; ITPR1, inositol 1,4,5-trisphosphate receptor type 1; ITPR2, inositol 1,4,5-trisphosphate receptor type 2; ITPR3, inositol 1,4,5-trisphosphate receptor type 3; KCNH2, potassium voltage-gated channel subfamily H member 2; mtATP6, mitochondrially encoded ATP synthase membrane subunit 6; MYH6, myosin heavy chain 6; MYL 2, myosin light chain 2; MYL 3, myosin light chain 3; MYL 7, myosin light chain 7; qPCR, quantitative polymerase chain reaction; RYR2, ryanodine receptor 2; SERCA2a, sarcoplasmic/endoplasmic reticulum Ca2+-ATPase 2a; TFAM, mitochondrial transcription factor A; TNNT2, troponin T2.

Electrophysiology

The ruptured whole-cell patch clamp was used to measure membrane potential as previously described (Ding et al., 2023). Briefly, glass capillary (World Precision Instruments, Sarasota, FL, USA) was used to pull microelectrodes by a pipette puller (Sutter Instrument, Novato, CA, USA). The microelectrodes were polished with a microforge (Narishige, Tokyo, Japan). The microelectrodes were filled with the internal solution, which typically shows 3–6 MΩ. Both microelectrodes and solutions were freshly prepared before experiments. The internal solution contained 10 mM NaCl, 50 mM KCl, 80 mM KOH, 1 mM MgCl₂, 10 mM HEPES, and 3 mM MgATP, pH 7.2 (adjusted with KOH). The external solution was Tyrode’s solution. The signal was amplified by Axopatch 200B amplifier (Molecular Devices, Sunnyvale, CA, USA) and recorded by the microelectrode. The signals were recorded by pClamp 10.4 software (Molecular Devices). AP data were analyzed with Cardiac Action Potential Analysis Software (CAPA) Package. The CAPA is distributed by Science Consulting Cardiac Cellular Electrophysiology UG (Essen, Germany).

SR-mitochondrial overlapping

Isolated mESC-CMs were stained with ER-tracker blue (Thermo Fisher Scientific), MitoTracker deep red (Thermo Fisher Scientific), and Rhod 2-AM (Invitrogen) to indicate ER, mitochondria, and Ca²⁺, respectively. mESC-CMs were identified with CaTs. The zoom-in images were deconvoluted with Huygens Essential (Scientific volume imaging, Hilversum, the Netherlands) and used for calculation of Mender’s coefficient with Fiji plugin, JAcoP (NIH).

Immunofluorescence

Briefly, the cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% triton-X100. After that, cells were blocked by phosphate buffered saline with tween-20 with 5% (w: v) non-fat dry milk and 0.1% normal goat serum. Epitopes were detected by incubation with the following primary antibodies: anti-α-actinin (1:200, ab9465, Abcam), anti-ki67 (1:200, NB110-89717SS, Novus Biologicals, Centennial, CO, USA). Secondary antibodies used were Alexa Fluor 405 goat anti-mouse IgG cross-adsorbed secondary antibody (1:100, A31553, Thermo Fisher Scientific), Alexa Fluor 488 goat anti-mouse IgG (1:100, A11001, Thermo Fisher Scientific), and Alexa Fluor 647 goat anti-rabbit IgG (1:100, A22287, Thermo Fisher Scientific). The following dyes were used according to the experiment requirement: MitoTracker red (Thermo Fisher Scientific), DAPI (Sigma), Phalloidin 647 (Thermo Fisher Scientific), Phalloidin 594 (A12381, Thermo Fisher Scientific). Cells were imaged with Leica SP8 confocal microscope (Leica).

Mitochondrial occupancy was calculated by mitochondrial area/cell size analyzed by Fiji plugin, JAcoP (NIH).

Proximity ligation assay (PLA)

The PLA experiment was conducted following the manufacturer’s instructions using the PLA kit (DUO92101, Sigma) and the Deep red reagent (DUO92013, Sigma). Briefly, cells were fixed with 4% paraformaldehyde (Sigma), permeabilized with 0.1% triton-X100, blocked by the blocking solution provided, and incubated with the primary antibodies overnight. After that, the epitopes were detected by a pair of antibodies labeled with oligonucleotides, which, when present within 40 nm, would undertake rolling circle amplification to generate a specific fluorescent signal after the addition of labeled probes. The primary antibodies used in the PLA were: anti-IP3R2 (sc-398434, Santa Cruz) and anti-VDAC1 (55259-1-AP, Proteintech, Manchester, United Kingdom).

Cellular ROS detection

The cells were stained with 5 μM CellROX^TM Green reagent (C10444, Thermo Fisher Scientific) and Rhod 2-AM (R1244MP, Thermo Fisher Scientific) for 15 min to indicate cellular ROS and Ca²⁺ transient respectively in groups of

‘pAdTrack-CMV-mito-R-GECO1-U6-shCtrl’,

‘pAdTrack-CMV-mito-R-GECO1-U6-shMFN2’,

‘pAdTrack-CMV-mito-R-GECO1-U6-shMFN2 + pAdTrack-CMV-BFP-CMV’, and

‘pAdTrack-CMV-mito-R-GECO1-U6-shMFN2 + pAdTrack-CMV-BFP-CMV-GRP75′.

The intensity of cell ROS was the mean intensity of individual cell analyzed with Fiji plugin, JAcoP (NIH).

Flow cytometry analysis

The cells were rinsed with PBS, dissociated with 0.05% trypsin (Invitrogen) at 37°C for 3 min, and transferred to 1.5 mL conical tube. The pellet was collected by centrifugation. The cells were washed once with PBS and thoroughly resuspended in Fixation/Permeabilization solution (554715, BD Biosciences) for 20 min at 4°C. The fixation buffer was removed after centrifugation. The fixed/permeabilized cells were washed once in 1 × BD Perm/Wash^TM buffer (554715, BD Biosciences). The cells were then either stained with BD Horizon^TM BV421 Mouse cardiac Troponin T (1:200, 565618, BD Biosciences) or BD Horizon^TM BV421 Mouse IgG1, κ Isotype Control (1:200, 5624438, BD Biosciences) for 30 min at 4°C in dark, after which they were washed once in 1 × BD Perm/Wash^TM buffer (554715, BD Biosciences). The immunostained cells were resuspended and vortexed thoroughly before subjected to flow cytometry analysis on a BD FACSMelody^TM cell sorter. A minimum of 10,000 events was acquired, and data were analyzed by FlowJo software (v10.6).

The gating strategy was as follows (Chan et al., 2020): (1) Gating on forward scatter area (FSC-A) vs. side scatter area (SSC-A) plots to exclude low FSC-A/SSC-A cell debris and high FSC-A/SSC-A aggregates, retaining the main cell population; (2) Singlet cells were selected by gating on forward scatter width (FSC-W) vs. forward scatter height (FSC-H) plots. The percentage of positive cells was based on gated singlet with background contribution of < 0.1%.

Drugs and dyes

Following drugs and concentration were used in this study: 100 nM rapamycin (MCE, Monmouth, NJ, USA), 2 mM N-acetylcysteine (NAC) (70601K, Adamas Life, Shanghai, China). Rapamycin was added into the medium to desired concentration 72 h before experiment, and the medium-containing rapamycin was changed every day till further experiments. NAC was added into the medium to desired concentration to treat the cells for 4 h before harvest.

Statistical analysis

Three or more biological repeats were performed for each experiment. Data were presented as mean ± SEM. Data between the two groups were compared by unpaired Student’s t-test. Multiple group comparison was conducted by one-way analysis of variance followed by Tukey’s multiple comparison tests. p < 0.05 was considered as statistically significant.

Authors’ Contributions

Z.L., K.C.C., Y.Q., and H.S.L. conducted the experiments. Z.L. analyzed the data. Z.L., S.Y.T., X.W., and E.N.Y.P. designed the experiments. Z.L. and S.Y.T. wrote the article.

Footnotes

Acknowledgment

The authors would like to thank Mr. Lung Yiu and Dr. Qianqian Ding for their technical support.

Author Disclosure Statement

The authors declare that they have no competing interests.

Funding Information

This work was supported by the General Research Fund (grant number 14120820) from the University Grants Committee (UGC) of the Hong Kong SAR; Direct Grant for Research, Faculty of Science, the Chinese University of Hong Kong (CUHK) (grant numbers: 4053610, 4053629); and the Innovative Technology Fund of Innovation Technology Commission: Funding Support from the State Key Laboratory of Agrobiotechnology (CUHK). Z.L., Y.Q., and K.C.C. were supported by the postgraduate studentships from the CUHK.

Availability of Data and Materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Supplemental Material

Abbreviations

References

Akhiani

, Martner

. Role of phosphoinositide 3-kinase in regulation of NOX-derived reactive oxygen species in cancer. Antioxidants (Basel), 2022; 12(1):67.

Ashraf

, Kumar

. Mfn2-mediated mitochondrial fusion promotes autophagy and suppresses ovarian cancer progression by reducing ROS through AMPK/mTOR/ERK signaling. Cell Mol Life Sci, 2022; 79(11):573.

Atakpa-Adaji

, Ivanova

. IP(3)R at ER-mitochondrial contact sites: Beyond the IP(3)R-GRP75-VDAC1 Ca(2+) funnel. Contact (Thousand Oaks), 2023; 6:25152564231181020.

Averill-Bates

. Reactive oxygen species and cell signaling. Review. Biochim Biophys Acta Mol Cell Res, 2024; 1871(2):119573.

Bertero

, Maack

. Calcium signaling and reactive oxygen species in mitochondria. Circ Res, 2018; 122(10):1460–1478.

Boogerd

, Perini

, Kyriakopoulou

, et al. Cardiomyocyte proliferation is suppressed by ARID1A-mediated YAP inhibition during cardiac maturation. Nat Commun, 2023; 14(1):4716.

Bozidis

, Williamson

, Wong

, et al. Trafficking of UL37 proteins into mitochondrion-associated membranes during permissive human cytomegalovirus infection. J Virol, 2010; 84(15):7898–7903.

Chan

, So

, Yau

, et al. Adipose-derived stem cells and cancer cells fuse to generate cancer stem cell-like cells with increased tumorigenicity. J Cell Physiol, 2020; 235(10):6794–6807.

Chen

, Liu

, Qin

, et al. Mitochondrial fusion protein Mfn2 and its role in heart failure. Front Mol Biosci, 2021; 8:681237.

10.

Chen

, Csordás

, Jowdy

, et al. Mitofusin 2-containing mitochondrial-reticular microdomains direct rapid cardiomyocyte bioenergetic responses via interorganelle Ca(2+) crosstalk. Circ Res, 2012; 111(7):863–875.

11.

Chen

, Lin

, Yu

, et al. Mitofusin-2 restrains hepatic stellate cells’ proliferation via PI3K/Akt signaling pathway and inhibits liver fibrosis in rats. J Healthc Eng, 2022; 2022:6731335.

12.

DE Brito

, Scorrano

. Mitofusin 2 tethers endoplasmic reticulum to mitochondria. Nature, 2008; 456(7222):605–610.

13.

Ding

, Liu

, Qi

, et al. TRPA1 promotes the maturation of embryonic stem cell-derived cardiomyocytes by regulating mitochondrial biogenesis and dynamics. Stem Cell Res Ther, 2023; 14(1):158.

14.

Dorn

2ND , Song

, Walsh

. Functional implications of mitofusin 2-mediated mitochondrial-SR tethering. J Mol Cell Cardiol, 2015; 78:123–128.

15.

Filadi

, Pendin

, Pizzo

. Mitofusin 2: From functions to disease. Cell Death Dis, 2018; 9(3):330.

16.

Gao

, Liang

, Lu

, et al. Reduced mitochondrial protein translation promotes cardiomyocyte proliferation and heart regeneration. Circulation, 2023; 148(23):1887–1906.

17.

Garay

, Givens

, Abreu

, et al. Dual inhibition of MAPK and PI3K/AKT pathways enhances maturation of human iPSC-derived cardiomyocytes. Stem Cell Reports, 2022; 17(9):2005–2022.

18.

Garbern

, Helman

, Sereda

, et al. Inhibition of mTOR signaling enhances maturation of cardiomyocytes derived from human-induced pluripotent stem cells via p53-induced quiescence. Circulation, 2020; 141(4):285–300.

19.

Gerdes

, Lemke

, Baisch

, et al. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J Immunol, 1984; 133(4):1710–1715.

20.

Gong

, Song

, Csordas

, et al. Parkin-mediated mitophagy directs perinatal cardiac metabolic maturation in mice. Science, 2015; 350(6265):aad2459.

21.

Hafstad

, Nabeebaccus

, Shah

. Novel aspects of ROS signalling in heart failure. Basic Res Cardiol, 2013; 108(4):359.

22.

Han

, Kou

, Zheng

, et al. ROS generated by upconversion nanoparticle-mediated photodynamic therapy induces autophagy via PI3K/AKT/mTOR signaling pathway in M1 peritoneal macrophage. Cell Physiol Biochem, 2019; 52(6):1325–1338.

23.

Hescheler

, Fleischmann

, Lentini

, et al. Embryonic stem cells: A model to study structural and functional properties in cardiomyogenesis. Cardiovasc Res, 1997; 36(2):149–162.

24.

Honrath

, Metz

, Bendridi

, et al. Glucose-regulated protein 75 determines ER-mitochondrial coupling and sensitivity to oxidative stress in neuronal cells. Cell Death Discov, 2017; 3:17076.

25.

Kohlhaas

, Liu

, Knopp

, et al. Elevated cytosolic Na+ increases mitochondrial formation of reactive oxygen species in failing cardiac myocytes. Circulation, 2010; 121(14):1606–1613.

26.

Konstantinidis

, Lederer

, Rizzuto

, et al. Mitofusin 2 joins the sarcoplasmic reticulum and mitochondria at the hip to sustain cardiac energetics. Circ Res, 2012; 111(7):821–823.

27.

Koundouros

, Poulogiannis

. Phosphoinositide 3-kinase/Akt signaling and redox metabolism in cancer. Front Oncol, 2018; 8:160.

28.

Laplante

, Sabatini

. mTOR signaling at a glance. J Cell Sci, 2009; 122(Pt 20):3589–3594.

29.

Law

, Leung

, Yau

, et al. Regulation of multiple transcription factors by reactive oxygen species and effects of pro-inflammatory cytokines released during myocardial infarction on cardiac differentiation of embryonic stem cells. Int J Cardiol, 2013; 168(4):3458–3472.

30.

, Zhang

, Cheng

, et al. PINK1 and PARK2 suppress pancreatic tumorigenesis through control of mitochondrial iron-mediated immunometabolism. Dev Cell, 2018; 46(4):441–455.e8.

31.

, Qi

, Su

, et al. GRP75-faciliated mitochondria-associated ER membrane (MAM) integrity controls cisplatin-resistance in ovarian cancer patients. Int J Biol Sci, 2022; 18(7):2914–2931.

32.

, Wu

, Günther

, et al. Inhibition of fatty acid oxidation enables heart regeneration in adult mice. Nature, 2023; 622(7983):619–626.

33.

Liang

, Wu

, Chen

, et al. Roles of reactive oxygen species in cardiac differentiation, reprogramming, and regenerative therapies. Oxid Med Cell Longev, 2020; 2020:2102841.

34.

Liu

, Sun

, Yuan

, et al. Mfn2 inhibits proliferation and cell-cycle in Hela cells via Ras-NF-κB signal pathway. Cancer Cell Int, 2019; 19:197.

35.

Liu

, Zhao

, Ding

, et al. TRPC7 regulates the electrophysiological functions of embryonic stem cell-derived cardiomyocytes. Stem Cell Res Ther, 2021; 12(1):262.

36.

Luo

, Yue

, Jia

, et al. Reduced electron transport chain complex I protein abundance and function in Mfn2-deficient myogenic progenitors lead to oxidative stress and mitochondria swelling. Faseb J, 2021; 35(4):e21426.

37.

, Chang

, Yu

, et al. Pro-apoptotic and anti-proliferative effects of mitofusin-2 via PI3K/Akt signaling in breast cancer cells. Oncol Lett, 2015; 10(6):3816–3822.

38.

Momtahan

, Crosby

, Zoldan

. The role of reactive oxygen species in in vitro cardiac maturation. Trends Mol Med, 2019; 25(6):482–493.

39.

Paillard

, Tubbs

, Thiebaut

, et al. Depressing mitochondria-reticulum interactions protects cardiomyocytes from lethal hypoxia-reoxygenation injury. Circulation, 2013; 128(14):1555–1565.

40.

Paltzer

, Aballo

, Bae

, et al. mTORC1 regulates the metabolic switch of postnatal cardiomyocytes during regeneration. J Mol Cell Cardiol, 2024; 187:15–25.

41.

Papanicolaou

, Kikuchi

, Ngoh

, et al. Mitofusins 1 and 2 are essential for postnatal metabolic remodeling in heart. Circ Res, 2012; 111(8):1012–1026.

42.

Pasumarthi

, Field

. Cardiomyocyte cell cycle regulation. Circ Res, 2002; 90(10):1044–1054.

43.

Pilotto

, Schmitz

, Maharjan

, et al. PolyGA targets the ER stress-adaptive response by impairing GRP75 function at the MAM in C9ORF72-ALS/FTD. Acta Neuropathol, 2022; 144(5):939–966.

44.

Ren

, Gopireddy

, Perkins

, et al. Disruption of mitochondria-sarcoplasmic reticulum microdomain connectomics contributes to sinus node dysfunction in heart failure. Proc Natl Acad Sci U S A, 2022; 119(36):e2206708119.

45.

Rumyantsev

. Interrelations of the proliferation and differentiation processes during cardiact myogenesis and regeneration. Int Rev Cytol, 1977; 51:186–273.

46.

Sauer

, Theben

, Hescheler

, et al. Characteristics of calcium sparks in cardiomyocytes derived from embryonic stem cells. Am J Physiol Heart Circ Physiol, 2001; 281(1):H411–H21.

47.

Sekulić

, Hudson

, Homme

, et al. A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res, 2000; 60(13):3504–3513.

48.

Shen

, Guo

, Wang

, et al. ROS-dependent inhibition of the PI3K/Akt/mTOR signaling is required for Oroxylin A to exert anti-inflammatory activity in liver fibrosis. Int Immunopharmacol, 2020; 85:106637.

49.

Singh

, Yucel

, Garay

, et al. Proliferation and maturation: Janus and the art of cardiac tissue engineering. Circ Res, 2023; 132(4):519–540.

50.

Szabadkai

, Bianchi

, Várnai

, et al. Chaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels. J Cell Biol, 2006; 175(6):901–911.

51.

Tiwary

, Nandwani

, Khan

, et al. GRP75 mediates endoplasmic reticulum-mitochondria coupling during palmitate-induced pancreatic β-cell apoptosis. J Biol Chem, 2021; 297(6):101368.

52.

Tsoi

, Deng

, Kwok

, et al. Temporal control of the WNT signaling pathway during cardiac differentiation impacts upon the maturation state of human pluripotent stem cell derived cardiomyocytes. Front Mol Biosci, 2022; 9:714008.

53.

Wang

, Cheng

, Lu

, et al. Mitofusin-2 is a novel direct target of p53. Biochem Biophys Res Commun, 2010; 400(4):587–592.

54.

Wang

, Tao

, Vaeth

, et al. Calcium regulation of T cell metabolism. Curr Opin Physiol, 2020; 17:207–223.

55.

Wojcikiewicz

. Type I, II, and III inositol 1,4,5-trisphosphate receptors are unequally susceptible to down-regulation and are expressed in markedly different proportions in different cell types. J Biol Chem, 1995; 270(19):11678–11683.

56.

Xin

, Li

, Wu

, et al. Mitofusin-2: A new mediator of pathological cell proliferation. Front Cell Dev Biol, 2021; 9:647631.

57.

, Chen

, Li

, et al. MFN2 suppresses cancer progression through inhibition of mTORC2/Akt signaling. Sci Rep, 2017; 7:41718.

58.

Xue

, Meng

, Lu

, et al. Mitofusin2 induces cell autophagy of pancreatic cancer through inhibiting the PI3K/Akt/mTOR signaling pathway. Oxid Med Cell Longev, 2018; 2018:2798070.

59.

Yang

, Zhuang

, Song

, et al. Mitochondria-associated endoplasmic reticulum membrane: Overview and inextricable link with cancer. J Cell Mol Med, 2023; 27(7):906–919.

60.

Zhang

, Liu

, Sheng

, et al. Potential targets for the treatment of MI: GRP75-mediated Ca(2+) transfer in MAM. Eur J Pharmacol, 2024; 971:176530.

61.

Zhang

, Wang

, Vikash

, et al. ROS and ROS-mediated cellular signaling. Oxid Med Cell Longev, 2016; 2016:4350965.

62.

Zhao

, Li

, et al. The role of mitochondria-associated membranes mediated ROS on NLRP3 inflammasome in cardiovascular diseases. Front Cardiovasc Med, 2022; 9:1059576.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

9.66 MB

Mitofusin 2 Is Required for the Maturation of Embryonic Stem Cell-Derived Cardiomyocytes via a GRP75-Dependent Suppression of the ROS/PI3K/AKT/mTOR Axis

Abstract

Aims:

Results:

Innovation:

Conclusion:

Keywords

Introduction

Results

Knockdown of MFN2 impaired the structural maturation of ESC-CMs

Knockdown of MFN2 impaired cytosolic Ca2+ kinetics and electrophysiology of ESC-CMs

Knockdown of MFN2 impaired the metabolic maturation of ESC-CMs

Knockdown of MFN2 increased cellular ROS level, and activated PI3K/AKT/mTOR pathway, while ROS scavenger reversed the effect of MFN2 knockdown

Overexpression of GRP75 suppressed the increased cellular ROS level and reversed the activation of PI3K/AKT/mTOR pathway caused by MFN2 knockdown

MFN2 is required for mESC-CMs maturation through mTOR activity

Discussion

Innovation

Materials and Methods

mESC culture, mESC-CM differentiation, isolation of mESC-CMs, hESC culture, and hESC-CM differentiation

Molecular cloning

Adenovirus infection and lentivirus infection

Confocal Ca2+ imaging

Cellular Ca2+ content determination

Western blotting

qPCR

Electrophysiology

SR-mitochondrial overlapping

Immunofluorescence

Proximity ligation assay (PLA)

Cellular ROS detection

Flow cytometry analysis

Drugs and dyes

Statistical analysis

Authors’ Contributions

Footnotes

Acknowledgment

Author Disclosure Statement

Funding Information

Availability of Data and Materials

Supplemental Material

Abbreviations

References

Supplementary Material

Knockdown of MFN2 impaired cytosolic Ca²⁺ kinetics and electrophysiology of ESC-CMs

Confocal Ca²⁺ imaging

Cellular Ca²⁺ content determination