Clotrimazole-Mediated Autophagy to Protect Against Cisplatin-Induced Ototoxicity via the AMPK/mTOR/TFEB Pathway in Mice

Abstract

Background:

Cisplatin is an effective chemotherapeutic agent, but its clinical use is limited by dose-dependent ototoxicity that leads to irreversible sensorineural hearing loss. Accumulating evidence implicates impaired autophagy–lysosomal homeostasis in cisplatin-induced ototoxicity. Transcription factor EB (TFEB), a master regulator of autophagy and lysosomal biogenesis, represents a promising therapeutic target. Clotrimazole, an FDA-approved antifungal drug with emerging cytoprotective properties, has not been investigated for its potential to mitigate cisplatin-induced ototoxicity.

Methods:

We evaluated the protective effects of clotrimazole using House Ear Institute-Organ of Corti 1 cells, cochlear explants, and an adult C57BL/6J mouse model of transtympanic cisplatin ototoxicity. Apoptosis, reactive oxygen species (ROS), and autophagy flux were assessed using biochemical assays and imaging. RNA-sequencing was performed to identify transcriptional pathways regulated by clotrimazole. TFEB dependence was verified using small interfering RNA knockdown and pharmacological inhibition of AMP-activated protein kinase (AMPK). Cochlear function was assessed using auditory brainstem responses (ABRs), and hair-cell and synapse survival were quantified by immunofluorescence.

Results:

Clotrimazole significantly reduced cisplatin-induced apoptosis, ROS generation, and calcium overload. Transcriptomic profiling and functional assays revealed robust activation of autophagy. Clotrimazole promoted AMPK activation, suppressed mTORC1 signaling, and enhanced TFEB nuclear translocation. TFEB or AMPK inhibition abrogated these protective effects. In vivo, intratympanic clotrimazole preserved hair cell survival, maintained ribbon synapses, and significantly reduced ABR threshold shifts.

Conclusions:

Clotrimazole protects against cisplatin-induced ototoxicity by activating the AMPK–mTOR–TFEB axis and restoring autophagy lysosomal homeostasis. These findings support TFEB-targeted autophagy activation as a promising therapeutic strategy for preventing cisplatin-induced hearing loss. Antioxid. Redox Signal. 44, 928–950.

Graphical Abstract

This is a visual representation of the abstract.

Keywords

ototoxicity clotrimazole cisplatin TFEB autophagy

Introduction

Sensorineural hearing loss is a common sensory impairment worldwide and markedly reduces patients’ quality of life (Tucci et al., 2010). It results from aging, genetic factors, noise exposure, and ototoxic medications (Kros and Steyger, 2019; Lieu et al., 2020). Cisplatin is a life-saving drug used in cancer chemotherapy to treat various solid tumors but can cause irreversible sensorineural hearing loss as a side effect in 20%–80% of patients (Clemens et al., 2017; Ghosh, 2019). Cisplatin-induced ototoxicity is characterized by direct damage to cochlear hair cells (HCs) and spiral ganglion neurons, (SGNs) resulting in apoptosis, oxidative stress, and mitochondrial dysfunction (Chu et al., 2016; Yu et al., 2020). Recent studies indicate that cisplatin disrupts mechanisms of ion transport and interferes with calcium homeostasis and potassium recycling pathways in the cochlea, which contribute to its ototoxic effects (Drögemöller et al., 2019). A deeper understanding of these mechanisms is essential for developing effective otoprotective strategies during cisplatin-based chemotherapy.

Innovation

We found that clotrimazole effectively protects against cisplatin-induced ototoxicity by reducing HC damage, suppressing apoptosis, and mitigating oxidative stress. In addition, clotrimazole activates TFEB-mediated autophagic flux through the AMPK/mTOR pathway, thereby restoring mitochondrial function and enhancing cellular clearance. These findings demonstrated that, through its dual role in cytoprotection and autophagy regulation, clotrimazole represents a promising therapeutic candidate for preventing cisplatin-induced hearing loss.

Autophagy has emerged as a critical cellular process involved in cochlear responses to cisplatin-induced injury (Li et al., 2022). Autophagy maintains cellular homeostasis through lysosome-dependent degradation of damaged organelles and proteins (Dikic and Elazar, 2018; Gouda et al., 2025). Cisplatin-induced injury has been shown to upregulate autophagy in cochlear SGNs both in vitro and in vivo. This enhanced autophagic flux alleviates oxidative stress and suppresses apoptotic pathways (Liu et al., 2021; Yang et al., 2018). Importantly, the impaired autophagy is a component of the drug-related damage in cochlea (He et al., 2017; Zhang et al., 2023). Transcription factor EB (TFEB) is a master regulator of autophagy and lysosomal biogenesis (Martini-Stoica et al., 2016). Pharmacological activation or genetic overexpression of TFEB protects cochlear hair cells from oxidative stress (Li et al., 2022; Suzuki et al., 2024; Wei et al., 2025). These findings suggest that TFEB-dependent autophagy represents a promising therapeutic target for cisplatin-induced ototoxicity.

Clotrimazole (CTZ), a broad-spectrum antifungal agent, has also been shown to exhibit anticancer properties with few side effects (Benzaquen et al., 1995; Lóránd and Kocsis, 2007; Navarro et al., 2006). An imidazole compound in the azole drug class with the molecular formula C₁₂H₁₇ClN₂ and a molecular weight of 344.8 g/mol (Crowley and Gallagher, 2014). It inhibits calcium channels and reduces intracellular calcium overload (Bartolommei et al., 2006; Ito et al., 2002; Jan et al., 2000). Calcium overload triggers calcium-dependent proteases, nitric oxide synthase, and reactive oxygen species (ROS) production, ultimately leading to mitochondrial damage (Cekic et al., 2013; Isaev et al., 2002). Accordingly, clotrimazole has been reported to protect multiple cell types against injury (Isaev et al., 2002). Clotrimazole also enhances therapeutic efficacy in combination anticancer regimens (Wang et al., 2019, 2021). However, its protective role in cisplatin-induced cochlear injury remains unclear.

In this study, we investigated whether clotrimazole protects cochlear hair cells from cisplatin-induced damage. We further explored the underlying molecular mechanisms, with a focus on autophagy-related signaling pathways.

Results

Clotrimazole alleviated cisplatin-induced apoptosis in HEI-OC1 cells

Exposure to 20 µM cisplatin for 24 h reduced House Ear Institute-Organ of Corti 1 (HEI-OC1) cell viability by ∼50%, providing a stable damage while retaining a sufficient number of cells (Li et al., 2022). To identify an effective protective concentration, HEI-OC1 cells were co-treated with cisplatin and increasing doses of clotrimazole (0–50 µM) for 24 h. CCK-8 assay showed that cisplatin treatment significantly decreased cell viability, whereas clotrimazole at concentrations of 10–20 µM significantly alleviated this effect (Fig. 1a, cell viability analysis). Furthermore, clotrimazole concentrations below 20 µM did not cause damage and modestly promoted cell proliferation at 10 µM (Fig. 1b, clotrimazole dose–response viability). Based on these dose–response results, 10 µM clotrimazole was selected for subsequent cell experiments. To determine whether clotrimazole can protect HEI-OC1 cells against cisplatin-induced apoptosis, apoptosis-related markers were further examined. Immunofluorescence staining for cleaved caspase 3 (cleaved-Casp3) revealed a reduction in the number of apoptotic cells induced by cisplatin after clotrimazole treatment (Fig. 1c and d, apoptotic cell quantification). Consistently, Western blotting confirmed that clotrimazole decreased the levels of cleaved-Casp3 and cleaved PARP (c-PARP) while increasing Bcl-2-associated X protein (Bcl-2) levels compared with cisplatin group. (Fig. 1e–h, apoptosis-related protein expression). Collectively, these results demonstrated that clotrimazole significantly attenuated cisplatin-induced apoptosis in HEI-OC1 cells.

FIG. 1.

Protective effects of clotrimazole on cisplatin-induced apoptosis in HEI-OC1 cells. (a) CCK-8 assay showing the viability of HEI-OC1 cells treated with cisplatin (Cis, 20 µM) in the presence of increasing concentrations of clotrimazole (CTZ; 0, 10, 20, 30, and 50 µM) (n = 3). CTZ dose-dependently improved cell viability in cis-treated cells. (b) CCK-8 assay showing the viability of HEI-OC1 cells treated with CTZ alone (0, 10, 20, 30, and 50 µM) (n = 3), indicating no significant cytotoxicity at the tested concentrations. (c) Cleaved Caspase-3 (cleaved Casp3; red) and DAPI (blue) double staining showing that CTZ significantly reduced cisplatin-induced apoptotic cell number (n = 3). (d) Quantitative analysis of cleaved Casp3-positive cells in (c) (n = 3). (e) Western blotting analysis showing that CTZ treatment significantly reduced the expression of cleaved Casp3 and cleaved PARP, while increasing the expression of Bcl-2 in HEI-OC1 cells (n = 3). (f–h) Quantitative analysis of Western blotting results for cleaved Casp3 (f), Bcl-2 (g), and cleaved PARP (h) expression levels (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001 vs. Cis group. Data are presented as mean ± SD. One-way Analysis of Variance (ANOVA) followed by multiple comparison test. Scale bar: 50 µm. HEI-OC1, House Ear Institute-Organ of Corti 1.

Given the protective effects of clotrimazole on cell viability and apoptosis-related proteins, we next examined its impact on cell death and mitochondrial function. Cisplatin increased the ratio of dead cells and decreased the ratio of viable cells, whereas clotrimazole co-treatment significantly reversed these effects (Fig. 2a–c, live/dead cell analysis). Flow cytometry further confirmed that clotrimazole significantly inhibited cisplatin-induced cell death and apoptosis in HEI-OC1 cells (Fig. 2d and e, apoptosis quantification). To determine whether mitochondrial integrity was preserved, mitochondrial membrane potential was assessed using TMRE staining. Cisplatin significantly decreased TMRE intensity, while clotrimazole increased it (Fig. 2f, mitochondrial function assessment), indicating partial relief of mitochondrial dysfunction. To further evaluate intracellular calcium homeostasis, calcium-sensitive probe CA520 was used for fluorescence imaging (Fig.2g, intracellular calcium assessment). Cisplatin increased intracellular calcium levels, while clotrimazole co-treatment reduced calcium accumulation and alleviated calcium overload. Collectively, these findings suggest that clotrimazole mitigates cisplatin-induced apoptosis and mitochondrial dysfunction by preserving mitochondrial integrity and calcium homeostasis.

FIG. 2.

Protective effects of clotrimazole on cisplatin-induced apoptosis in HEI-OC1 cells. (a) Representative live/dead staining images showing that cisplatin (Cis) increased the proportion of dead cells and reduced viable cells, whereas clotrimazole (CTZ) co-treatment markedly improved cell survival. (b) and (c) Quantitative analysis of live cell proportion (b) and dead cell proportion (c) from (a) (n = 3 independent experiments), demonstrating that CTZ significantly reversed Cis-induced cytotoxicity. (d) Results of flow cytometry showing the apoptosis rates in the different treatment groups. (e) Quantification of total apoptotic cells (early + late apoptosis) from (d) (n = 3), confirming that CTZ significantly inhibited Cis-induced apoptosis in HEI-OC1 cells. (f) Representative TMRE staining images and quantitative analysis of mitochondrial membrane potential in different treatment groups (n = 3). Cis treatment markedly reduced TMRE fluorescence intensity, indicating mitochondrial depolarization, while CTZ partially restored mitochondrial membrane potential. (g) Representative fluorescence images and quantitative analysis of intracellular calcium levels detected using the calcium-sensitive probe CA520 (n = 3). Cis increased intracellular calcium accumulation, whereas CTZ co-treatment significantly reduced calcium overload and improved calcium homeostasis. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001 vs. Cis group. Data are presented as mean ± SD. One-way ANOVA followed by multiple comparison test. Scale bars: 50 µm in (a) and 10 µm in (f) and (g). HEI-OC1, House Ear Institute-Organ of Corti 1.

Clotrimazole treatment protected hair cells in whole-organ cultured cochlea against cisplatin injury in vitro

To determine whether the protective effects of clotrimazole observed in HEI-OC1 cells translate to the organ level, cochlear explant cultures were established from postnatal day 3 (P3) mice. Explants were assigned to four groups: control, clotrimazole alone, cisplatin alone, and cisplatin + clotrimazole. Based on preliminary dose–response viability assays in organotypic cultures, 40 µM clotrimazole was selected as the optimal concentration for cochlear explant experiments. After counting HCs labeled with Myosin VIIa, we found that cisplatin led to significant loss of HCs and blurred the boundary between inner and outer HCs. However, clotrimazole co-treatment preserved most of the HCs in all turns (Fig. 3a and b, HC survival analysis). Consistently, Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining revealed a marked increase in apoptotic HCs following cisplatin exposure. This increase was significantly attenuated by clotrimazole (Fig. 3b and d, TUNEL-positive HC quantification). Together, these results demonstrate that clotrimazole protects cochlear HCs by antagonizing cisplatin-induced apoptosis in cochlear explants.

FIG. 3.

Effects of clotrimazole on cisplatin-induced damage to cochlear hair cells. (a) Representative immunofluorescence images of cochlear explants from postnatal day 3 (P3) mice stained with Myosin VIIa (hair cell marker, red) and DAPI (blue) under different treatment conditions. Cisplatin (Cis) induced significant loss of hair cells (HCs) and disrupted the morphological boundary between inner and outer HCs across cochlear turns, whereas clotrimazole (CTZ) co-treatment markedly preserved HC integrity and organization. (b) Representative immunofluorescence images of Myosin VIIa (red) and TUNEL (green) staining. Cisplatin markedly increased TUNEL-positive apoptotic HCs, while CTZ co-treatment significantly reduced apoptosis in cochlear explants. (c) Quantitative analysis of Myosin VIIa-positive HCs from (a) across different cochlear turns (n = 3 independent explants per group). CTZ significantly attenuated Cis-induced HC loss. Two-way ANOVA followed by multiple comparisons test (n = 3). (d) Quantification of TUNEL-positive HCs from (b) (n = 3). CTZ significantly reduced Cis-induced HC apoptosis. One-way ANOVA followed by multiple comparison test (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001 vs. cisplatin group. Data are presented as mean ± SD. Scale bar: 10 µm.

Clotrimazole reduced cisplatin-induced oxidative stress in cochlear hair cells and HEI-OC1 cells

Oxidative stress is a major upstream cause of cisplatin-induced HC death and apoptosis. Clotrimazole has been shown to attenuate Tumor Necrosis Factor (TNF)-induced mitochondrial ROS (mtROS) production in adult ventricular myocytes (Roberge et al., 2014). Given the cytoprotective effects of clotrimazole, we next examined whether clotrimazole reduces cisplatin-induced ROS accumulation. Total ROS and mtROS levels were assessed using Dichlorodihydrofluorescein Diacetate (DCFH-DA) Green and MitoSOX Red staining in HEI-OC1 cells and cochlear hair cells. Cisplatin significantly increased mtROS levels, whereas clotrimazole reduced mtROS accumulation in cochlear explants (Supplementary Fig. S1A and B, mtROS imaging and quantification). Consistent results were observed in HEI-OC1 cells (Supplementary Fig. S1C, mtROS quantification). Compared with control group, the cisplatin group significantly elevated mtROS levels, whereas clotrimazole co-treatment significantly attenuated this increase (Supplementary Fig. S1D, mtROS quantification). In addition, the results of immunofluorescence staining for DCFH-DA showed that cisplatin increased ROS production in HEI-OC1 cells, which was mitigated by co-treatment with clotrimazole (Supplementary Fig. S1E, total ROS fluorescence).

Clotrimazole preserved the antitumor effects of cisplatin while exhibiting its own antitumor activity

Many agents that antagonize cisplatin-induced ototoxicity provide protection to both HCs and tumor cells, limiting their application. Given the reported antitumor properties of clotrimazole (Zuccolini et al., 2023), we next evaluated whether clotrimazole interferes with cisplatin-mediated cytotoxicity in tumor cells. Cell viability was assessed using CCK-8 assays in three tumor cell lines. The cervical cancer tumor HeLa cell line is one of the earliest and best known immortalized cell lines (Hsu et al., 1976). In HeLa cells, cisplatin significantly reduced cell viability, and clotrimazole co-treatment did not affect its antitumor effect (Supplementary Fig. S2A, cell viability analysis). Notably, clotrimazole alone inhibited HeLa cell proliferation in a concentration-dependent manner from 10 to 50 µM (Supplementary Fig. S2B, cell viability analysis). The human laryngeal cancer HEp-2 cell line is widely used in virology research (Cheng et al., 2023). Clotrimazole did not attenuate the cytotoxic effects of cisplatin in HEp-2 cells. At concentrations above 20 µM, clotrimazole alone significantly suppressed HEp-2 cell viability (Supplementary Fig. S2C and D, cell viability analysis). The human osteosarcoma 143B cell line is known for its high proliferation and metastatic potential (Liu et al., 2024). Similar to the HEp-2 cell line, clotrimazole did not affect the antitumor effects of cisplatin in 143B cells, and at concentrations above 30 µM, clotrimazole showed a significant antitumor proliferative effect (Supplementary Fig. S2E and F, cell viability analysis). Collectively, these results indicate that clotrimazole preserves the antitumor efficacy of cisplatin while exerting independent antiproliferative effects in multiple tumor cell lines.

Clotrimazole treatment protected HCs against cisplatin injury in vivo

Given the protective effects of clotrimazole observed in vitro and in cochlear explants, we next evaluated its efficacy in an in vivo mouse model. Adult C57BL/6J mice were used to assess whether clotrimazole could protect against cisplatin-induced hearing loss. To achieve targeted cochlear drug delivery while minimizing systemic toxicity, clotrimazole was administered via intratympanic injection. As shown in Figure 4a (experimental design of intratympanic treatment), mice received bilateral intratympanic injections of one of the following solutions: saline, 1 mg/mL cisplatin, 1 mg/mL cisplatin combined with 200 µM clotrimazole, or 1 mg/mL cisplatin combined with 400 µM clotrimazole. Auditory brainstem responses (ABRs) were recorded before and 3 and 7 days postinjection.

FIG. 4.

Clotrimazole effectively protects auditory function and hair cells in vivo. (a) Schematic diagram of local cisplatin (Cis)-induced ototoxicity and the experimental design. (b) Auditory brainstem response (ABR) thresholds measured at baseline (left) and threshold shifts at 3 days (middle) and 7 days (right) after intratympanic injection (n = 6 mice per group). Cis significantly elevated hearing thresholds, while co-treatment with clotrimazole (CTZ) (200 µM) markedly attenuated threshold shifts across most tested frequencies. Two-way ANOVA followed by multiple comparisons test. (c) Representative whole-mount cochlear images stained with Myosin VIIa (green) and CtBP2 (red), showing hair cell and synapse preservation in CTZ-treated groups. (d) Quantification of hair cell survival across cochlear turns (n = 5 mice per group). CTZ significantly reduced Cis-induced hair cell loss. Two-way ANOVA followed by multiple comparisons test. (e) Quantification of CtBP2 puncta per inner hair cell (IHC) across cochlear turns (n = 5 mice per group). CTZ significantly preserved synaptic ribbon numbers compared with the Cis group. Two-way ANOVA followed by multiple comparisons test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001 vs. cisplatin group. Data are presented as mean ± SD. Scale bar: 10 µm.

Baseline ABR thresholds were comparable among all groups prior to treatment (Fig. 4b, ABR threshold analysis). Cisplatin significantly elevated hearing thresholds at all frequencies. At 3 days post-treatment, mice receiving cisplatin plus 200 µM clotrimazole showed significant protection across all frequencies, whereas mice treated with cisplatin plus 400 µM clotrimazole exhibited significant protection primarily at 4–32 kHz. At 7 days post-treatment, the cisplatin plus 200 µM clotrimazole group continued to show robust protection of hearing thresholds at 4–32 kHz, while the cisplatin plus 400 µM clotrimazole group showed a narrower protection at 4–22.6 kHz. Together, these results indicate that 200 µM clotrimazole represents an optimal protective concentration for in vivo cochlear protection. To correlate functional preservation with cochlear morphology, cochleae were collected at 3 days post-treatment for immunofluorescence analysis. HCs and synapses were labeled using Myosin VIIa and CtBP2, respectively. The results showed that clotrimazole significantly protected the HCs in the middle and basal turns from loss and simultaneously protected the synapses in all turns (Fig. 4c–e, HCs and synapse quantification). Collectively, these results suggest that intratympanic injection of clotrimazole significantly attenuated cisplatin-induced hearing loss, HC loss, and synaptic loss in vivo.

To investigate the pharmacokinetic characteristics of clotrimazole in mice, clotrimazole (10 mg/mL) was administered via intratympanic injection. Cochlear and serum samples were collected at 0.5, 2, 6, 12, and 24 h after dosing for concentration analysis (Supplementary Fig. S3, concentration–time curves). Pharmacokinetic parameters of clotrimazole in the cochlea and serum are summarized in Supplementary Tables S1 and S2. Clotrimazole concentrations detected in both compartments were markedly lower than the administered dose, indicating substantial dilution during tissue distribution and systemic circulation. Compared with serum, clotrimazole exhibited a longer mean residence time in the cochlea and reached its peak concentration in the cochlea at a T_max of 1.5 h, suggesting rapid cochlear distribution and sustained local retention. The terminal elimination half-life (T_1/2) of clotrimazole in the cochlea was 8.21 ± 0.83 h, suggesting relatively slow elimination from cochlear tissue. In contrast, serum clotrimazole concentrations were low and declined rapidly, indicating limited systemic exposure following intratympanic administration.

To further evaluate potential systemic toxicity following intratympanic administration of clotrimazole, liver and kidney function parameters were assessed in mice (Supplementary Table S3). Although alkaline phosphatase (ALP) and urea levels were significantly decreased in the injection group compared with the control group, the values remained within the normal physiological range for mice. Moreover, other indicators of hepatic and renal function, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), and creatinine (CREA), showed no significant differences between groups, suggesting that intratympanic clotrimazole administration did not induce obvious hepatic or renal toxicity.

Clotrimazole enriched autophagy-related gene expression

To investigate the molecular mechanisms underlying the protective effects of clotrimazole against cisplatin-induced ototoxicity, RNA-seq analysis was performed in HEI-OC1 cells. Cells from the control, cisplatin, and cisplatin plus clotrimazole groups were analyzed (n = 3 biological replicates per group). Principal component analysis demonstrated good separation and consistency among groups (Fig. 5a and Supplementary Fig. S4A). Differentially expressed genes were visualized using volcano plots (Supplementary Fig. S4B and C), with gene lists provided in Supplementary Tables S4, S5, S6, and S7. To identify biological processes affected by cisplatin exposure, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed between the control and cisplatin groups (Supplementary Fig. S4D and E).

FIG. 5.

RNA-seq analysis of the effects of clotrimazole treatment. (a) Principal component analysis (PCA) showing distinct clustering and good reproducibility among control, cisplatin (Cis), and Cis + clotrimazole (CTZ) groups (n = 3 biological replicates per group). (b) Heat map of global gene expression profiles demonstrating differential clustering between the Cis and Cis + CTZ groups. (c) Heat map of autophagy-related genes showing coordinated transcriptional changes following CTZ treatment. (d) GO and KEGG pathway enrichment analyses indicating significant modulation of autophagy- and calcium ion regulation–related pathways after CTZ treatment. (e) Gene Set Enrichment Analysis (GSEA) of autophagy-related GO terms, showing significant enrichment in the Cis + CTZ group, with normalized enrichment scores (NES) and nominal P values indicated. GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

In addition to the control versus cisplatin comparison, we mainly focused on transcriptional differences between the cisplatin and cisplatin plus clotrimazole groups to identify pathways associated with clotrimazole-mediated protection. Global gene expression profiling revealed distinct clustering between these two groups, as shown in the heat map (Fig. 5b). Further analysis revealed a significant enrichment of autophagy-related genes following clotrimazole treatment. Figure 5c shows the specific clustering patterns of autophagy-related genes, indicating coordinated transcriptional regulation. GO and KEGG pathway analyses further showed that clotrimazole significantly modulated pathways related to autophagy and calcium ion regulation (Fig. 5d). To further validate pathway-level changes, Gene Set Enrichment Analysis was performed. Autophagy-related gene sets were significantly enriched in the clotrimazole-treated group, with corresponding normalized enrichment scores and nominal p values indicated in Figure 5e. These findings suggest that clotrimazole-mediated protection is associated with transcriptional activation of autophagy-related pathways.

Clotrimazole promoted autophagy in HEI-OC1 cells and cochlea

To validate the transcriptomic findings indicating enhanced autophagy following clotrimazole, we next examined the expression of autophagy-related genes by qPCR. Compared with the control group, clotrimazole significantly upregulated multiple genes involved in autophagosome formation and lysosomal function (Fig. 6a, autophagy-related gene expression). Cisplatin treatment also increased the expression of several autophagy-related genes, while the combination of cisplatin and clotrimazole further enhanced their expression levels (Fig. 6b). Notably, p62 (SQSTM1) transcription was also significantly increased following clotrimazole treatment.

FIG. 6.

Clotrimazole enhances autophagy flux in HEI-OC1 cells. (a) qPCR analysis showing the transcriptional changes of autophagy-related genes (Atg5, Atg7, Map1lc3b, p62, Lamp2, and Becn1) in HEI-OC1 cells (n = 3). clotrimazole (CTZ) significantly upregulated genes involved in autophagosome formation and lysosomal function. (b) qPCR analysis showing the transcriptional changes of autophagy-related genes (Atg5, Atg7, Map1lc3b, p62, Lamp2, and Becn1) in HEI-OC1 cells treated with control, cisplatin (Cis), or Cis + CTZ for 24 h (n = 3). (c) Representative images of mRFP-GFP-LC3B-transfected HEI-OC1 cells treated with control, Cis, CTZ, or Cis + CTZ for 24 h. Yellow puncta (GFP+/RFP+) indicate autophagosomes, and red puncta (RFP + only) indicate autolysosomes. CTZ co-treatment increased both autophagosomes and autolysosomes. (d) Representative images of mRFP-GFP-LC3B-transfected cells treated with control, Cis, Cis + CTZ, or Cis + CTZ + hydroxychloroquine (HCQ) for 24 h. HCQ inhibited autolysosome formation, confirming that CTZ enhances autophagic flux rather than merely inducing autophagosome accumulation. (e) Time-course analysis (6, 12, 24, and 48 h) of mRFP-GFP-LC3-transfected cells treated with control, Cis, or Cis + CTZ, showing dynamic changes in autophagosomes and autolysosomes. CTZ maintained sustained autophagic flux compared with Cis alone. (f–h) Quantification of autophagosomes (yellow puncta) and autolysosomes (red puncta) per cell corresponding to (c), (d), and (e), respectively (n = 5 cells per group). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001 vs. Cis group; ^#p < 0.05, ^##p < 0.01, ^###p < 0.001, ^####p < 0.0001 vs. Cis + CTZ group. Data are presented as mean ± SD. Two-way ANOVA followed by multiple comparisons test. Scale bars: 10 µm. HEI-OC1, House Ear Institute-Organ of Corti 1; qPCR, quantitative real-time PCR.

To further determine whether clotrimazole enhances autophagic flux at the functional level, HEI-OC1 cells were transfected with the mRFP-GFP-LC3 reporter. This system differentially labels autophagic structures where yellow puncta (GFP⁺/mRFP⁺) represent autophagosomes and red puncta (mRFP⁺ only) mark autolysosomes. This enables direct visualization of autophagy flux from autophagosome formation to lysosomal degradation. Cisplatin treatment for 24 h increased both autophagosomes and autolysosomes. Clotrimazole co-treatment further enhanced these increases, indicating augmented autophagic flux (Fig. 6c and f, autophagosome and autolysosome quantification). To confirm that clotrimazole promotes autophagic degradation rather than merely inducing autophagosome accumulation, hydroxychloroquine (HCQ) was used to inhibit lysosomal function. HCQ blocked autophagosome–lysosome fusion and attenuated clotrimazole-induced autolysosome formation (Fig. 6d and g, autophagosome and autolysosome quantification). These findings demonstrate that clotrimazole enhances both autophagosome formation and lysosomal degradation, thereby promoting autophagic flux.

To further characterize the temporal dynamics of autophagy flux, a time course analysis was performed at 6, 12, 24, and 48 h following treatment (Fig. 6e and h, autophagosome and autolysosome quantification). In the cisplatin group, autophagosomes numbers peaked at 24 h then declined, while autolysosome numbers reached their lowest level at 24 h and recovered by 48 h. These findings suggest a transient blockage of autophagy flux. In contrast, in the cisplatin + clotrimazole group, the number of autophagosomes peaked at 24 h and subsequently decreased, while the number of autolysosomes continued to increase and remained elevated at 48 h. This pattern indicating that clotrimazole maintained efficient autophagy flux. LysoTracker staining revealed that clotrimazole treatment significantly increased lysosomal fluorescence intensity, while bafilomycin A1 (BafA1) treatment markedly reduced LysoTracker fluorescence due to inhibition of lysosomal acidification (Supplementary Fig. S6A). These findings suggest that clotrimazole does not impair lysosomal function. These conclusions are further supported by the mRFP–GFP–LC3B reporter assay, which demonstrated increased autophagosome formation without impairment of autophagic flux.

To further confirm the activation of autophagy at the protein level, LC3-II and p62 expression were quantified by Western blotting. In HEI-OC1 cells, both the clotrimazole group and the cisplatin + clotrimazole group exhibited significantly increased p62 and LC3-II expression (Fig. 7a, LC3-II and p62 expression). Moreover, p62 and LC3-II levels increased in a dose-dependent manner with rising clotrimazole concentrations (Fig. 7b, LC3-II and p62 expression). To determine whether these changes were also present in vivo, cochleae were collected 7 days after intratympanic treatment. Western blot (WB) analysis revealed that cisplatin increased LC3-II levels while reducing p62 expression. Co-treatment with 200 µM clotrimazole further increased LC3-II levels and resulted in a further decrease in p62 expression (Supplementary Fig. S5A, LC3-II and p62 expression). Consistently, whole-mount immunofluorescence staining of the cochlear basilar membrane demonstrated increased LC3 expression in the clotrimazole-cotreated group (Supplementary Fig. S5B, LC3 immunofluorescence).

FIG. 7.

Clotrimazole reduces cisplatin-induced damage by enhancing autophagy. (a) Western blotting and quantitative analysis of LC3-II and p62 expression in HEI-OC1 cells under different treatments (n = 3). Clotrimazole (CTZ) increased LC3-II and p62 levels compared with cisplatin (Cis) alone. (b) Western blotting and quantitative analysis showing dose-dependent increases of LC3-II and p62 in HEI-OC1 cells treated with increasing concentrations of CTZ (0, 5, 10, 25, and 50 µM) (n = 3). (c) Western blotting and quantitative analysis of LC3-II and p62 in HEI-OC1 cells treated with CTZ in the presence or absence of the lysosomal inhibitor bafilomycin A1 (BafA1) (n = 3). CTZ further increased LC3-II accumulation under lysosomal blockade, indicating enhanced autophagosome formation. (d) Western blotting and quantitative analysis of cleaved Casp3 and cleaved PARP in HEI-OC1 cells treated with Cis, CTZ, and the autophagy inhibitor 3-methyladenine (3-MA) (n = 3). Inhibition of autophagy abolished the antiapoptotic effects of CTZ. (e) Immunofluorescence staining and quantitative analysis of cleaved Casp3 and αII-spectrin in cochlear explants treated with Cis, CTZ, and 3-MA (n = 3). 3-MA reduced CTZ-mediated hair cell protection. Scale bar: 10 µm. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001 vs. Cis group; ^#p < 0.05, ^##p < 0.01, ^###p < 0.001, ^####p < 0.0001 vs. Cis + CTZ group; ^†p < 0.05, ^††p < 0.01, ^†††p < 0.001, ^††††p < 0.0001 vs. CTZ group. Data are presented as mean ± SD. One-way ANOVA followed by multiple comparison test. Scale bars: 10 µm. HEI-OC1, House Ear Institute-Organ of Corti 1.

To distinguish whether clotrimazole-induced autophagosome accumulation results from enhanced autophagosome formation or impaired degradation, cells were treated with the lysosomal inhibitor BafA1. As expected, BafA1 caused accumulation of both LC3-II and p62, confirming effective blockade of autophagic degradation (Fig. 7c, LC3-II and p62 expression). Notably, clotrimazole co-treatment further increased LC3-II levels in the presence of BafA1, indicating that clotrimazole promotes autophagosome formation rather than suppressing autophagic flux. Although p62 protein levels were elevated, qPCR analysis demonstrated significant upregulation of p62 mRNA expression (Fig. 6a, qPCR of gene expression). This suggests that p62 accumulation is largely attributable to transcriptional induction rather than defective autophagic degradation.

To determine whether autophagy is required for the protective effects of clotrimazole, the autophagy inhibitor 3-methyladenine (3-MA) was applied. 3-MA abolished the antiapoptotic effects of clotrimazole, as evidenced by increased cleaved-Casp3 and cPARP expression (Fig. 7d, apoptosis-related proteins expression) and reduced HC survival in the basilar membrane (Fig. 7e, HC survival quantification). Together, these findings demonstrate that clotrimazole-mediated protection against cisplatin-induced injury is dependent on autophagy activation.

Clotrimazole protected cells from cisplatin-induced damage by activating TFEB-mediated autophagy

Since lysosomal function is critical in the autophagy process, we next evaluated whether clotrimazole modulates lysosomal function. Immunofluorescence staining was performed for LAMP1 and LAMP2, established markers of lysosomal integrity and activity. Cisplatin significantly reduced LAMP1 and LAMP2 expression, indicating lysosomal impairment (Fig. 8a and c, lysosomal marker staining). Clotrimazole co-treatment restored LAMP1 and LAMP2 expression levels. LAMP1 expression significantly increased at 10 and 25 µM, while LAMP2 expression showed sustained upregulation at 10, 25, and 50 µM (Fig. 8b and d, lysosomal marker staining). This suggested that clotrimazole preserves lysosomal function under cisplatin-induced stress. This preservation supports efficient autophagosome degradation and is consistent with the increased autolysosome formation observed in previous experiments.

FIG. 8.

Clotrimazole mitigates cisplatin-induced damage by activating TFEB-mediated autophagy. (a) Representative immunofluorescence images of LAMP1 and LAMP2 (lysosomal markers) in HEI-OC1 cells under different treatments. Cisplatin (Cis) reduced LAMP1/2 expression, whereas clotrimazole (CTZ) co-treatment restored lysosomal marker levels. (b) Immunofluorescence images of LAMP1 and LAMP2 in HEI-OC1 cells treated with increasing concentrations of CTZ (0, 5, 10, 25, and 50 µM), showing dose-dependent enhancement of lysosomal markers. (c) and (d) Quantitative analysis of LAMP1 and LAMP2 fluorescence intensity corresponding to (a) and (b), respectively (n = 3). (e) Western blotting and quantitative analysis of TFEB nuclear translocation in HEI-OC1 cells treated with increasing concentrations of CTZ (0, 10, and 25 µM) (n = 3). CTZ promoted TFEB nuclear accumulation. (f) Immunofluorescence staining and quantification of TFEB nuclear localization in HEI-OC1 cells under different treatments (n = 6), confirming CTZ-induced TFEB activation. (g) Western blotting and quantitative analysis of cleaved Casp3 in HEI-OC1 cells transfected with siTFEB or siCtrl (n = 3). TFEB knockdown attenuated the protective effects of CTZ against Cis-induced apoptosis. (h) Western blotting and quantitative analysis confirming TFEB knockdown efficiency (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001 vs. cisplatin group; ^#p < 0.05, ^##p < 0.01, ^###p < 0.001, ^####p < 0.0001 vs. Cis + CTZ group. Data are presented as mean ± SD. Data were analyzed using one-way ANOVA followed by multiple comparisons test (panels c, d, g and h) or two-way ANOVA followed by multiple comparisons test (panels e and f). Scale bars: 10 µm. HEI-OC1, House Ear Institute-Organ of Corti 1; TFEB, transcription factor EB.

As LAMP1 and LAMP2 are established transcriptional targets of TFEB (Zheng et al., 2018), a master regulator of lysosomal biogenesis, we next investigated whether clotrimazole-mediated lysosomal restoration involved TFEB activation. Nuclear and cytoplasmic fractionation followed by WB analysis revealed a significant increase in nuclear TFEB levels after clotrimazole treatment (Fig. 8e, TFEB nuclear translocation). Immunofluorescence staining further confirmed enhanced TFEB nuclear localization in HCs (Fig. 8f and Supplementary Fig. S5C, TFEB localization). To determine whether TFEB is required for the protective effects of clotrimazole, TFEB expression was silenced in HEI-OC1 cells using small interfering RNA (siRNA) (Fig. 8g and Supplementary Fig. S6B, apoptosis analysis). The results showed that cisplatin treatment and TFEB knockdown significantly increased cleaved Casp3 expression, supporting the critical role of TFEB in clotrimazole-mediated protection. The efficiency of TFEB knockdown was confirmed by Western blotting (Fig. 8h, TFEB expression).

Clotrimazole promoted TFEB nuclear translocation via the AMPK-mTOR pathway

As mTOR inhibition is a classical upstream regulator of TFEB activation, we first examined the phosphorylation status of mTOR and its downstream substrate p70S6K (Fig. 9a and b, mTOR pathway analysis). Notably, clotrimazole significantly suppressed phosphorylation of mTOR and p70S6K, suggesting inhibition of mTOR signaling. This effect was mediated through adenosine monophosphate-activated protein kinase (AMPK) activation, as clotrimazole markedly enhanced AMPK phosphorylation (Fig. 9c, AMPK expression).

FIG. 9.

Clotrimazole promotes TFEB nuclear translocation via the AMPK-mTOR pathway. (a) Western blotting and quantitative analysis of phosphorylated and total mTOR and p70S6K in HEI-OC1 cells under different treatments (n = 3). Clotrimazole (CTZ) reduced phosphorylation of mTOR and its downstream target p70S6K. (b) Western blotting and quantitative analysis showing dose-dependent modulation of AMPK and mTOR signaling in HEI-OC1 cells treated with increasing concentrations of CTZ (0, 5, 10, 25, and 50 µM) (n = (c) Immunofluorescence staining and quantification of phosphorylated AMPK (p-AMPK) in HEI-OC1 cells under different treatments (n = 3), confirming AMPK activation by CTZ. (d) Molecular docking model showing the predicted interaction between CTZ and AMPK. CTZ forms a stable binding complex with AMPK (binding energy −6.6 kcal/mol). The aromatic ring of CTZ establishes π-alkyl interactions with the side chains of Lys-148 and Arg-223, while a carbon–hydrogen bond with Ser-315 further stabilizes the complex within the AMPK binding pocket. (e) Immunofluorescence staining and quantitative analysis of Myosin VIIa-positive hair cells in cochlear explants treated with cisplatin (Cis), CTZ, and Compound C (n = 3). Compound C attenuated CTZ-mediated hair cell protection. (f) Western blotting and quantitative analysis of TFEB nuclear translocation in HEI-OC1 cells treated with CTZ in the presence or absence of the AMPK inhibitor Compound C (n = 3). AMPK inhibition abolished CTZ-induced TFEB nuclear accumulation. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, ^&&&&p < 0.0001 vs. cisplatin group; ^#p < 0.05, ^##p < 0.01, ^###p < 0.001, ^####p < 0.0001 vs. cisplatin + clotrimazole group; ^†p < 0.05, ^††p < 0.01, ^†††p < 0.001, ^††††p < 0.0001 vs. CTZ group. Data were analyzed using one-way ANOVA followed by multiple comparisons test (panels a, b, c, and f) or two-way ANOVA followed by multiple comparisons test (panel f). Data are presented as mean ± SD. Scale bars: 10 µm. AMPK, AMP-activated protein kinase; HEI-OC1, House Ear Institute-Organ of Corti 1; mTOR, mechanistic target of rapamycin; TFEB, transcription factor EB.

To investigate whether clotrimazole exerts its regulatory effects through direct activation of AMPK, molecular docking simulations were performed to analyze the interaction between clotrimazole and the AMPK protein. Molecular docking analysis revealed that clotrimazole forms a stable complex with AMPK, with a binding energy of −6.6 kcal/mol, indicating strong binding stability (Fig. 9d, molecular docking results). The docking results demonstrated the side chains of Lys-148 and Arg-223 form π-alkyl interactions with the aromatic ring region of clotrimazole, establishing noncovalent contacts. These hydrophobic interactions contributed to the structural stability of the complex and support the proper orientation of clotrimazole within the AMPK binding pocket. In addition, a carbon-hydrogen bond between Ser-315 and clotrimazole further enhances binding. Although relatively weak in energy, this interaction provided additional stabilization within the multipoint binding model. Together, these interactions demonstrated that clotrimazole exhibits strong binding stability with AMPK, suggesting its potential role in modulating AMPK activity.

To determine whether AMPK activation is required for TFEB regulation, the AMPK inhibitor Compound C was applied. Compound C reduced HCs survival in the basilar membrane (Fig. 9e, HCs survival analysis) and abolished clotrimazole-induced TFEB nuclear translocation (Fig. 9f and Supplementary Fig. S5D, TFEB localization). These findings show that clotrimazole triggers TFEB nuclear translocation through the AMPK-mTOR axis, ultimately promoting autophagy and cellular protection.

Discussion

Cisplatin remains a cornerstone chemotherapeutic agent for solid tumors. However, its clinical use is limited by ototoxicity, neurotoxicity, and nephrotoxicity (Rose et al., 2024). Currently, systemic sodium thiosulfate is the only approved agent for preventing cisplatin-induced ototoxicity. Its indication is restricted to pediatric patients with nonmetastatic cancer. Effective and broadly applicable otoprotective strategies remain urgently needed (Freyer et al., 2020; Orgel et al., 2022). An ideal otoprotective agent should preserve cochlear function without compromising the antitumor efficacy of cisplatin. In this study, we demonstrate that clotrimazole attenuates cisplatin-induced hearing loss while not interfering with its antitumor effects. Mechanistically, our data indicate that clotrimazole triggers autophagy through the AMPK-mTOR-TFEB signaling axis. Opening new avenues for pharmacological treatment of cisplatin-induced ototoxicity.

Cisplatin induces ototoxicity primarily through oxidative stress and apoptotic pathways in cochlear HCs. Mitochondrial dysfunction leads to excessive ROS production, which initiates apoptotic signaling and ultimately results in irreversible hair cell loss and hearing impairment (Tang et al., 2021; Liu et al., 2026). In this study, clotrimazole significantly inhibited cisplatin-induced apoptosis and suppressed total ROS and mitochondrial ROS accumulation. These protective effects were consistently observed in HEI-OC1 cells, cochlear explants, and in vivo models. Clotrimazole also alleviated mitochondrial dysfunction, supporting its role in preserving cellular integrity under cisplatin-induced stress. Previous studies have primarily emphasized the antitumor and antifungal effects of clotrimazole, which are associated with proapoptotic and oxidative stress-inducing properties (Robles-Escajeda et al., 2013; Song et al., 2024). In contrast, our research highlighted its unique otoprotective role. This dual functionality suggests that clotrimazole may represent a unique candidate capable of maintaining antitumor compatibility while providing targeted otoprotective effects.

We next examined the underlying mechanism by which clotrimazole exerts its protective role. Transcriptomic analysis identified autophagy-related pathways as major targets of clotrimazole treatment. Autophagy plays a central role in maintaining cochlear homeostasis and protecting hair cells from stress-induced damage (Zou et al., 2024). In cisplatin-induced ototoxicity, accumulating evidence supports a predominantly protective role of autophagy (Kocaturk et al., 2019; Yu et al., 2010). Our findings showed that clotrimazole enhanced autophagy and inhibited cisplatin-induced apoptosis in HCs. This effect was supported by increased lysosome formation and sustained lysosomal activity. TFEB-dependent lysosomal biogenesis represents a well-established mechanism coordinating autophagosome formation with degradative capacity (Settembre et al., 2011). In our study, clotrimazole increased nuclear TFEB levels and upregulated lysosomal markers, including LAMP1 and LAMP2. Although LC3-II and p62 levels were elevated, transcriptional upregulation of p62 suggests enhanced pathway activation rather than defective degradation (Filomeni et al., 2015). This interpretation is consistent with the flux assays and lysosomal function analyses. Genetic knockdown of TFEB in HEI-OC1 cells significantly attenuated the protective effects of clotrimazole, demonstrating the pivotal role of TFEB in this process. Consistent with our results, a previous study also showed that activating TFEB-mediated autophagy protected against cisplatin-induced damage in the cochlea (Li et al., 2022). Pharmacological activation of TFEB may therefore represent a viable strategy to mitigate cisplatin-induced ototoxicity.

Given the satisfactory treatment potency of clotrimazole, this study examined how clotrimazole modulates TFEB activity. The subcellular localization of TFEB is phosphorylation-dependent: cytoplasmic retention occurs when phosphorylated, while nuclear translocation of dephosphorylated TFEB promotes autophagy gene transcription (Napolitano and Ballabio, 2016) (Senapati et al., 2025; Settembre et al., 2012). Here, we found that clotrimazole suppressed mTORC1 signaling activity, as evidenced by decreased phosphorylation of mTOR and p70S6K. mTORC1 inhibition is a well-established trigger for TFEB nuclear translocation. This effect was mechanistically linked to enhanced AMPK phosphorylation. Activation of AMPK is known to inhibit mTORC1 and thereby facilitate TFEB activation (Mandic et al., 2025; Negoita et al., 2026). Consistent with this model, clotrimazole treatment increased nuclear TFEB levels and promoted lysosomal gene expression. Furthermore, molecular docking analysis suggested a potential interaction between clotrimazole and AMPK. Therefore, clotrimazole-increased TFEB transcriptional activity may be controlled by AMPK. Although the role of AMPK in hearing loss is controversial (Hill et al., 2016; Liang et al., 2021; Wu et al., 2020), our results suggested that activation of AMPK could have therapeutic potential in cisplatin-induced hearing loss.

Given that clotrimazole has been reported to modulate intracellular Ca²⁺ signaling as a calcium-related channel inhibitor (Bartolommei et al., 2006), regulation of calcium homeostasis may also contribute to its protective effects. Intracellular Ca²⁺ overload is an important pathological event in cisplatin-induced cellular injury and has been associated with mitochondrial dysfunction and apoptotic activation (Kouba et al., 2022). Calcium homeostasis has also been shown to influence autophagy through modulation of AMPK/mTOR signaling, a central pathway controlling TFEB activity and lysosomal biogenesis (Paquette et al., 2021). In the present study, CA520 staining demonstrated that clotrimazole significantly attenuated cisplatin-induced intracellular Ca²⁺ elevation. Consistently, GO and KEGG pathway analyses revealed significant enrichment of pathways related to calcium ion regulation and autophagy. Therefore, stabilization of intracellular Ca²⁺ levels by clotrimazole may contribute to AMPK/mTOR/TFEB pathway activation, thereby enhancing autophagic flux and promoting hair cell survival under cisplatin stress.

The safety profile of clotrimazole warrants careful consideration in translational settings. Systemic administration has been associated with gastrointestinal symptoms and transient elevations in liver enzymes (Crowley and Gallagher, 2014). However, these adverse effects are primarily reported under systemic exposure. In the present study, clotrimazole was delivered locally via intratympanic injection, which markedly limits systemic distribution. In addition, previous animal studies have reported that topically applied clotrimazole formulations can induce cochlear dysfunction and elevate ABR thresholds. These effects were largely attributed to organic solvents and occurred at concentrations substantially higher than those used here. (Perez et al., 2013). Notably, our dose–response analyses demonstrated that 200 µM clotrimazole achieved optimal otoprotective efficacy in vivo. This concentration achieved robust protection without detectable cochlear toxicity. Together, these findings suggest that clotrimazole may exert protective effects within a defined therapeutic window. Local delivery strategies may further reduce systemic risk while maintaining cochlear efficacy.

Moreover, our pharmacokinetic analysis demonstrates that intratympanic administration of clotrimazole results in rapid distribution into the cochlea, accompanied by prolonged retention within cochlear tissue, as reflected by its T_max, Mean Residence Time (MRT), and T_1/2. These findings indicate that clotrimazole achieves sustained local exposure in the cochlea rather than merely transient presence. Notably, despite the high administered concentration (10 mg/mL), clotrimazole concentrations detected in serum were highly diluted and declined rapidly over time, indicating limited extent and duration of systemic exposure. Evaluation of liver and kidney function parameters revealed no evidence of systemic toxicity following intratympanic administration. Intratympanic administration therefore represents a rational strategy to maximize otoprotection while limiting systemic risk.

From a translational perspective, local intratympanic delivery represents a clinically relevant and widely adopted strategy for inner ear therapy (Rybak et al., 2019). In this study, a relatively high concentration of clotrimazole (10 mg/mL) was used in mice to ensure measurable cochlear and plasma drug exposure for pharmacokinetic analysis; however, the actual effective protective dose is much lower (200 µM) in mice. High doses of clotrimazole may cause gastrointestinal side effects. In contrast, low-dose intratympanic injection is sufficient to antagonize cisplatin, supporting the use of low-dose local administration in clinical settings. In addition, sustained-release formulation strategies, such as hydrogels, nanoparticles, or biodegradable carriers, may further enhance cochlear drug retention and reduce the need for repeated administration (Guo et al., 2023; Le et al., 2023). Overall, these results support the potential of clotrimazole as a candidate therapeutic for the prevention of cisplatin-induced ototoxicity.

In summary, this study showed that clotrimazole significantly alleviates cisplatin-induced ototoxicity by activating the TFEB-mediated autophagy-lysosome pathway. This finding not only expands our understanding of the pharmacological effects of clotrimazole but also provides a novel potential strategy for the prevention and treatment of cisplatin-induced ototoxicity. Future studies should focus on long-term safety evaluation, dosing optimization, and formulation strategies to facilitate clinical translation.

Limitations

Despite the encouraging findings, several limitations should be acknowledged:

Model limitations. Although key mechanistic events were validated in the mouse cochlea, most mechanistic experiments were performed in vitro. These models do not fully capture the physiological complexity of the intact cochlea. Therefore, the protective effects and mechanisms observed here may not completely reflect responses in larger animals or humans, and further validation in more clinically relevant models will be necessary.

Dosing considerations. Although the efficacy and safety of low-dose CTZ were validated in both in vitro systems and mouse models, the optimal protective concentration identified in mice may not directly translate to humans due to anatomical differences of the inner ear and potential variations in pharmacokinetics and drug distribution.

Lack of long-term evaluation. The present study focused on short-term functional and molecular outcomes. Long-term auditory preservation and safety remain to be determined.

Limited systemic evaluation. Although pharmacokinetic analysis and assessments of liver and kidney function were performed to evaluate the systemic safety of CTZ in this study, more comprehensive and long-term safety evaluations remain necessary to fully characterize its systemic effects in the context of potential clinical application.

Materials and Methods

Animals

C57BL/6J male mice were purchased from SPF (Suzhou) Biotechnology Co., Ltd. (Suzhou, China). All experimental protocols were approved by the Institutional Animal Care and Use Committee of the Shanghai Jiao Tong University Affiliated Sixth People’s Hospital. Efforts were made to minimize animal number and pain as much as possible.

Antibodies and reagents

The following reagents and antibodies were obtained from the sources shown and used in the experiments: cleaved caspase 3 (9664; Cell Signaling Technology, Danvers, MA, USA), Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) (5174; Cell Signaling Technology), c-PARP (9544; Cell Signaling Technology), anti-myosin-VIIa rabbit antibody (25-6790; Proteus BioSciences, Ramona, CA, USA), αII-spectrin (cloneD8BI7, 803201; BioLegend, San Diego, CA, USA), anti-Bcl2 (A19693; ABclonal, Wuhan, Hubei, China), anti-ctbp2 (612044; BD Biosciences, Franklin Lakes, NJ, USA), 4',6-Diamidino-2-Phenylindole (DAPI) (ab104139; Abcam, Cambridge, UK), β-actin (4970; Cell Signaling Technology), cisplatin (P4394; Sigma-Aldrich, St. Louis, MO, USA), clotrimazole (S1606; Selleck, Houston, TX, USA), LC3B (T55992S; Abmart, Shanghai, China), p62 (39749; Cell Signaling Technology), LAMP1 (21997-1-AP; Proteintech, Rosemont, IL, USA), LAMP2 (ab125028; Abcam), 3-methyladenine (3-MA, HY-19312; MedChemExpress, Monmouth Junction, NJ, USA), TFEB (S-R296; Absin, Shanghai, China), hydroxychloroquine (HCQ, HY-B1370; MedChemExpress), p-p70S6K (9234; Cell Signaling Technology), p70S6K (2708; Cell Signaling Technology), pmTOR (F2584; Selleck, Houston, TX, USA), mTOR (F0169; Selleck, Houston, TX, USA), pAMPK (2535; Cell Signaling Technology), AMPK (ab32047; Abcam, Cambridge, UK), and Tubulin (ab6046; Abcam, Cambridge, UK). Bafilomycin A1(BafA1, HY-100558; MedChemExpress).

Cell culture

The HEI-OC1 cell line was kindly provided by Dr. Iris Heredia of the University of California, Los Angeles (UCLA) Technology Development Group. HEI-OC1 cells were cultured in high-glucose Dulbecco's Modified Eagle Medium (DMEM) (E600003; Sangon Biotech, Shanghai, China) supplemented with 10% fetal bovine serum (Gibco-BRL, Grand Island, NY, USA) and 1% ampicillin (Sangon Biotech) at 33°C in a 10% CO₂/90% air atmosphere. When the cells reached 80% confluence, they were subcultured using 0.25% trypsin/Ethylenediaminetetraacetic Acid (EDTA) (Sangon Biotech). To induce damage to HEI-OC1 cells, cisplatin was added at a final concentration of 20 µM and incubated for 24 h.

Organotypic culture of the postnatal murine cochlea

The cochleas were dissected from postnatal day (P) 3 C57BL/6J mice and cultured on cell culture dishes (627170; Greiner Bio-One, Frickenhausen, Germany) with collagen gel (BD Biocoat, 354236; BD Biosciences). The collagen gel was made with rat tail collagen (Type 1; BD Biosciences), 10× Eagle’s Basal Medium (BME, B9638; Sigma-Aldrich), and 2% sodium carbonate at a ratio of 9:1:1. The cochlear explants were cultured with 2 mL of DMEM/F12 growth medium (11320082; Gibco-BRL) supplemented with B-27™ (17504044; Gibco-BRL), N-2 (17502001; Gibco-BRL), and ampicillin (50 g/mL, A5354-10ML; Sangon Biotech) at 37°C in a 5% CO₂/95% air atmosphere. After culture overnight, the cochlear explants of the experimental group were exposed to cisplatin and other treatments for 24 h. After removing the medium, the cochlear explants were allowed to recover in normal culture medium for 36 h before proceeding with subsequent experiments.

Cell viability

HEI-OC1 cells were trypsinized with 0.25% trypsin/EDTA and collected by centrifugation at 200g for 3 min. The cells were then resuspended in culture medium and plated in 96-well plates at a density of 4000 cells per well. After overnight incubation, the culture medium was replaced with fresh medium containing cisplatin (20 μM) and varying concentrations of other drugs. Cell viability was assessed at 2 h using a CCK-8 assay kit (HY-K0301; MedChemExpress). Cell viability was determined by measuring the optical density (OD) at 450 nm with a microplate reader (BioTek, Winooski, VT, USA).

Hair cells and cochlear ribbon synapse counts

For quantification of cochlear explants and cochlear HCs in adult mice, cells labeled with myosin-VIIa or αII-spectrin were considered as surviving HCs. After different treatments, the labeled cells were quantified per 100 μm of three turns of the cochlea, and counts were repeated at least three times. For ribbon synapses in adult mice, anti-CtBP2 antibody was used to determine the number of CtBP2 per inner hair cell field. Only the middle part of the cochlear explant was counted for ribbon synapses.

Western blotting

The HEI-OC1 cells were lysed with RIPA lysis buffer (PC101; EpiZyme, Shanghai, China) supplemented with Protease Inhibitor Cocktail (GRF101; EpiZyme) and Phosphatase Inhibitor Cocktail (C500017; Sangon Biotech) for 30 min at 4°C. Protein concentrations were determined with a BCA Protein Quantification Kit (ZJ102; EpiZyme). Equal amounts of protein were loaded onto 6%–15% SDS-polyacrylamide gels (PG112, PG113; EpiZyme) and transferred onto BioTrace™ NT nitrocellulose membranes (66485; Pall Corporation, Port Washington, NY, USA). The membranes were blocked with 5% skimmed milk (PS112L; Sangon Biotech) in 1× Tris-Buffered Saline with Tween 20 (TBST) buffer (C520009-0001; Sangon Biotech) for 1 h at room temperature. After blocking, the membranes were incubated with primary antibodies overnight at 4°C. The next day, after three washes with 1× TBST buffer, themembranes were incubated with Horseradish Peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. Finally, the signals were developed using an Omni-ECL™ Femto Light Chemiluminescence Kit (SQ201; EpiZyme), and images were captured using a ChemiDocXRS imaging system (Bio-Rad, Richmond, CA, USA). Images were analyzed using ImageJ software (NIH, Bethesda, MD, USA).

Immunofluorescence staining

The HEI-OC1 cells and cochlear explants were fixed with 4% paraformaldehyde (Sangon Biotech) for 1 h. Following fixation, the specimens were permeabilized with 0.1% Triton-X 100 for 30 min and then incubated for 1 h at room temperature in blocking medium (Bovine Serum Albumin, BSA; Sigma-Aldrich). The specimens were incubated overnight at 4°C with primary antibodies. After washing with Phosphate-Buffered Saline (PBS), the samples were incubated with secondary antibodies (A32723, A32731, A32727, A32732; Thermo Fisher Scientific, Waltham, MA, USA) for 2 h at room temperature, shielded from light. The samples were then counterstained with DAPI (Sigma-Aldrich) and imaged using an LSM 710 confocal microscope (Zeiss, Oberkochen, Germany).

Cisplatin-induced hearing loss model

Experiments were performed using age-matched 6–8-week-old wild-type (WT) adult C57BL/6J mice with normal hearing. To evaluate the protective effects of clotrimazole in vivo, 1 mg/mL cisplatin and a combination of 1 mg/mL cisplatin with 200 µM or 400 µM clotrimazole were prepared. To achieve targeted cochlear drug delivery while minimizing systemic toxicity, clotrimazole, cisplatin, and normal saline were administered via intratympanic injection, as described previously (He et al., 2009; Jiang et al., 2023; Nacher-Soler et al., 2021). Each ear of mice with normal hearing was treated with saline, cisplatin, or cisplatin plus clotrimazole solution until the tympanic cavity was completely filled via transtympanic injection (Lou et al., 2024; Zhao et al., 2025). Bilateral ABRs were recorded before, 3 days after and 7 days after injection.

Electrophysiological evaluation

ABRs were conducted prior to injection to confirm the normal hearing ability of each adult C57BL/6J mouse. The body temperature was maintained at 37°C using a thermostatic heating pad after anesthetizing the mice with 1% sodium pentobarbital (75 mg/kg). The ABRs were performed using software and hardware from Tucker-Davis Technologies (TDT System III; Alachua, FL, USA). An MF1a broadband speaker emitted acoustic signals at a stimulation rate of 21.1/s, delivering the signals to a single ear through a plastic tube (closed field). Subdermal electrodes were placed at the vertex of the head (active), under the mastoid of one ear (reference), and under the mastoid of the contralateral ear (ground). The stimulus intensity series started at a maximum of 90 dB sound pressure level (SPL) and decreased in 5 dB steps until reaching a minimum of 0 dB SPL. The ABR threshold was determined as the lowest intensity at which a wave III response was no longer detectable across frequencies from 4 to 45.2 kHz.

Pharmacokinetic study of clotrimazole

For pharmacokinetic evaluation, clotrimazole solution (10 mg/mL) was administered via intratympanic injection. Blood samples and cochlear tissues were collected at 30 min, 2 h, 6 h, 12 h, and 24 h after administration, with three mice sampled at each time point. Blood samples were centrifuged in anticoagulant-free tubes to obtain serum, which was stored at −80°C until analysis. Cochleae were rapidly excised from each mouse, immediately frozen in liquid nitrogen, and stored at −80°C until further analysis. The concentrations of clotrimazole in serum and cochlear homogenates were determined using liquid chromatography–tandem mass spectrometry (LC-MS/MS). Chromatographic separation was performed on a Waters ACQUITY UPLC BEH C18 column (1.7 µm, 2.1 × 100 mm). The mobile phase consisted of solvent A (5 mM ammonium acetate in water) and solvent B (methanol). Clotrimazole was detected in positive ion mode using multiple reaction monitoring. The monitored precursor-to-product ion transitions were m/z 344.9 → 277.0 for quantification and m/z 344.9 → 164.9 for qualification. Calibration curves were established using an external standard method by plotting clotrimazole peak area versus concentration, and linear regression was performed using a weighted (1/x) least-squares approach. The evaluation of method accuracy and matrix effects demonstrated that the method was reliable and suitable for the quantitative determination of clotrimazole in biological samples.

Small interfering RNA gene silencing

TFEB-siRNA (OBiO Technology, Shanghai, China) was used to knock down TFEB expression in HEI-OC1 cells. Briefly, 2 × 10⁵ HEI-OC1 cells were cultured overnight in 6-well plates and then transfected with either TFEB-siRNA or control siRNA plasmid using transfection reagent (DN-001-10; D-Nano Therapeutics, Beijing, China) for 48 h, according to the manufacturer’s protocol. Transfection efficiency was assessed by Western blotting analysis. The following siRNAs were used to knock down TFEB expression: 5′-CCATGGCCATGCTACATAT-3′ and 5′-GCAGGCTGTCATGCATTAT-3′ (Li et al., 2022).

RNA sequencing

cDNA libraries were constructed after extracting total RNA using a VAHTS Universal V6 RNA-seq Library Prep for Illumina Kit (NR604-02; Vazyme, Nanjing, China) according to the manufacturer’s protocol. Then, an Illumina NovaSeq X Plus with 2X150 running circles was used to sequence the cDNA libraries (Illumina, San Diego, CA, USA). Raw fastq reads were mapped to the transcriptome by Spliced Transcripts Alignment to a Reference (STAR) and then assembled into transcripts by StringTie. We applied genes with read counts for further analysis of differential expression by Deseq2. Compared with the control sample, the genes with expression changes of twofold or higher were considered to be significantly up- or downregulated. TopGO was used for GO and KEGG pathway analyses. The cDNA/DNA/small RNA libraries were sequenced on the Illumina sequencing platform by OmicsMaster Biotechnology Co., Ltd (Guangzhou, China).

Flow cytometry

An ANXA5 (Annexin V) kit (556547; BD Biosciences) was used to analyze cell apoptosis. HEI-OC1 cells in different plates were trypsinized and collected by centrifugation at 200g for 5 min and then washed twice with PBS. The cells were resuspended in 1 × binding buffer at a concentration of 1 × 10⁶ cells/mL, and then 5 µL of PI and 5 µL of ANXA5-FITC were added. After incubation for 20 min at room temperature in the dark, the cells were analyzed by flow cytometry. All experiments were repeated at least three times.

mRFP-GFP-LC3 transfection

HEI-OC1 cells were cultured in medium supplemented with the recombinant adenovirus vector mRFP-GFP-LC3B (HBAP2100001; Hanbio Biotechnology, Shanghai, China) for 48 h, in accordance with the manufacturer’s guidelines. After this incubation period, the cells were used for further experiments. The presence of both GFP and mRFP fluorescence in puncta identified autophagosomes (yellow), while puncta exhibiting mRFP fluorescence without GFP indicated autolysosomes (red).

Quantitative real-time PCR

Total RNA was extracted from HEI-OC1 cells using the EZ-press RNA Purification Kit (EZBioscience, USA). The purified RNA was then converted into cDNA with the RNA to cDNA EcoDry Premix (Takara, Japan) according to the manufacturer’s instructions. Quantitative PCR was conducted using TB Green® Premix Ex Taq™ (Takara, RR420A, Japan) on a LightCycler 480 platform (Roche, USA). GAPDH was used as the internal reference gene, and relative mRNA expression levels were calculated using the comparative Ct (ΔΔCt) method. The primer sequences used for amplification were as follows:

GAPDH (F: AGGTCGGTGTGAACGGATTTG; R: TGTAGACCATGTAGTTGAGGTCA),

p62(F: AGGATGGGGACTTGGTTGC; R: TCACAGATCACATTGGGGTGC),

Lamp2(F: TGTATTTGGCTAATGGCTCAGC; R: TATGGGCACAAGGAAGTTGTC),

Becn1(F: ATGGAGGGGTCTAAGGCGTC; R: TCCTCTCCTGAGTTAGCCTCT),

Atg5(F: TGTGCTTCGAGATGTGTGGTT; R: GTCAAATAGCTGACTCTTGGCAA),

Atg7(F: GTTCGCCCCCTTTAATAGTGC; R: TGAACTCCAACGTCAAGCGG),

and Map1lc3b (F: CACTGCTCTGTCTTGTGTAGGTTG; R: TCGTTGTGCCTTTATTAGTGCATC).

Statistical analysis

All data are presented as the mean ± standard deviation (SD), and each experiment was conducted with at least three independent replicates. Statistical analyses were carried out using Prism software (GraphPad Software, La Jolla, CA, USA). The two-tailed, unpaired Student’s t test was used for comparisons between two groups to assess statistical significance. For comparisons involving more than two groups, one-way Analysis of Variance (ANOVA) or two-way ANOVA was performed, followed by multiple comparison test. In all analyses, p < 0.05 was taken to indicate statistical significance. Figures were created using Prism software.

Ethics Approval

All experimental protocols were approved by the Institutional Animal Care and Use Committee of the Shanghai Jiao Tong University Affiliated Sixth People’s Hospital. Efforts were made to minimize animal number and pain as much as possible.

Availability of Data and Materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. RNA-seq data are available under BioProject PRJNA1392104, with BioSample accessions SAMN54243721-SAMN54243732.

Authors’ Contributions

All authors reviewed the report and approved the final version. Y.J., Z.L., and W.D. contributed equally to this work. D.Y., W.L., P.W., and H.S. designed all experiments. Y.J., Z.L., and W.D. performed all experiments. Y.J. and Z.L. acquired and analyzed all of the data. Y.W., Y.Z., J.F., L.D., Q.Y., and X.W. helped with the data interpretation and the performance of experiences. We assigned the authorship order according to the amount of work carried out by each author.

Footnotes

Author Disclosure Statement

The authors declare that they have no competing interests.

Funding Information

This work was supported by the National Key R&D Program of China (No. 2023YFC2410200), the National Key Research and Development Project of the Ministry of Science and Technology (No. 2019YFC0119900), the International Cooperation and Exchange of the National Natural Science Foundation of China (No. 82020108008), the National Natural Science Foundation of China (No. 82171140, 82301311, and 82401345), and Shanghai Sixth People’s Hospital Basic Research Project (Youth Cultivation Project) (ynqn202211).

Supplemental Material

Abbreviations

References

Bartolommei

, Tadini-Buoninsegni

, Hua

, et al. Clotrimazole inhibits the Ca2+-ATPase (SERCA) by interfering with Ca2+ binding and favoring the E2 conformation. J Biol Chem, 2006; 281(14):9547–9551.

Benzaquen

, Brugnara

, Byers

, et al. Clotrimazole inhibits cell proliferation in vitro and in vivo. Nat Med, 1995; 1(6):534–540.

Cekic

, Alhan

, Usta

, et al. Effects of clotrimazol on the acute necrotizing pancreatitis in rats. Inflammation, 2013; 36(6):1576–1583.

Cheng

, Wang

, Yin

, et al. The nonstructural protein 1 of respiratory syncytial virus hijacks host mitophagy as a novel mitophagy receptor to evade the type I IFN response in HEp-2 cells. mBio, 2023; 14(6):e0148023.

Chu

, Sibrian-Vazquez

, Escobedo

, et al. Systemic delivery and biodistribution of cisplatin in vivo. Mol Pharm, 2016; 13(8):2677–2682.

Clemens

, DE Vries

ACH

, Am Zehnhoff-Dinnesen

, et al. Hearing loss after platinum treatment is irreversible in noncranial irradiated childhood cancer survivors. Pediatr Hematol Oncol, 2017; 34(2):120–129.

Crowley

, Gallagher

. Clotrimazole as a pharmaceutical: Past, present and future. J Appl Microbiol, 2014; 117(3):611–617.

Dikic

, Elazar

. Mechanism and medical implications of mammalian autophagy. Nat Rev Mol Cell Biol, 2018; 19(6):349–364.

DRöGEMöLLER

, Wright

GEB

, LO

, et al. Pharmacogenomics of cisplatin‐induced ototoxicity: Successes, shortcomings, and future avenues of research. Clin Pharmacol Ther, 2019; 106(2):350–359.

10.

Filomeni

, DE Zio

, Cecconi

. Oxidative stress and autophagy: The clash between damage and metabolic needs. Cell Death Differ, 2015; 22(3):377–388.

11.

Freyer

, Brock

, Chang

, et al. Prevention of cisplatin-induced ototoxicity in children and adolescents with cancer: A clinical practice guideline. Lancet Child Adolesc Health, 2020; 4(2):141–150.

12.

Ghosh

. Cisplatin: The first metal based anticancer drug. Bioorg Chem, 2019; 88:102925.

13.

Gouda

, Zhakupova

, Abdelaal

, et al. The interplay involving oxidative stress and autophagy: Mechanisms, implications, and therapeutic opportunities. Exp Mol Pathol, 2025; 143:104989.

14.

Guo

, Sun

, Ren

. Preparation of PLGA Nano inner ear drug delivery system and its transport mechanism in inner ears of rats. Appl Nanosci, 2023; 13(5):3503–3512.

15.

, Yin

, Wang

, et al. Effectiveness of different approaches for establishing cisplatin-induced cochlear lesions in mice. Acta Otolaryngol, 2009; 129(12):1359–1367.

16.

, Guo

, Shu

, et al. Autophagy protects auditory hair cells against neomycin-induced damage. Autophagy, 2017; 13(11):1884–1904.

17.

Hill

, Yuan

, Wang

, et al. Noise-induced loss of hair cells and cochlear synaptopathy are mediated by the activation of AMPK. J Neurosci, 2016; 36(28):7497–7510.

18.

Hsu

, Schacter

, Delaney

, et al. Genetic characteristics of the HeLa cell. Science, 1976; 191(4225):392–394.

19.

Isaev

, Stelmashook

, Dirnagl

, et al. Neuroprotective effects of the antifungal drug clotrimazole. Neuroscience, 2002; 113(1):47–53.

20.

Ito

, Tecchio

, Coustan-Smith

, et al. The antifungal antibiotic clotrimazole alters calcium homeostasis of leukemic lymphoblasts and induces apoptosis. Leukemia, 2002; 16(7):1344–1352.

21.

Jan

, Tseng

, Chou

, et al. Novel effects of clotrimazole on Ca2+ signaling in Madin Darby canine kidney cells. Life Sci, 2000; 66(23):2289–2296.

22.

Jiang

, Li

, Ma

, et al. Aucubin protects mouse cochlear hair cells from cisplatin-induced ototoxicity via activation of the PI3K/AKT/STAT3 pathway. Biochem Pharmacol, 2023; 209:115440.

23.

Kocaturk

, Akkoc

, Kig

, et al. Autophagy as a molecular target for cancer treatment. Eur J Pharm Sci, 2019; 134:116–137.

24.

Kouba

, Hague

, Ahidouch

, et al. Crosstalk between Ca(2+) signaling and cancer stemness: The link to cisplatin resistance. Int J Mol Sci, 2022; 23(18):10687.

25.

Kros

, Steyger

. Aminoglycoside- and cisplatin-induced ototoxicity: Mechanisms and otoprotective strategies. Cold Spring Harb Perspect Med, 2019; 9(11):a033548.

26.

, Yu

, Cho

, et al. Injectable poloxamer hydrogel formulations for intratympanic delivery of dexamethasone. J Korean Med Sci, 2023; 38(17):e135.

27.

, Yao

, Tian

, et al. Trehalose protects against cisplatin-induced cochlear hair cell damage by activating TFEB-mediated autophagy. Biochem Pharmacol, 2022; 197:114904.

28.

Liang

, Zhang

, Zhan

, et al. Metformin alleviates cisplatin-induced ototoxicity by autophagy induction possibly via the AMPK/FOXO3a pathway. J Neurophysiol, 2021; 125(4):1202–1212.

29.

Lieu

JEC

, Kenna

, Anne

, et al. Hearing loss in children: A review. JAMA, 2020; 324(21):2195–2205.

30.

Liu

, Jiao

, Wang

P-C

, et al. Oxidative stress and antioxidant therapeutic mechanisms. Pharmacol Ther, 2026; 278:108962.

31.

Liu

, Xu

, Wang

, et al. PRDX1 activates autophagy via the PTEN-AKT signaling pathway to protect against cisplatin-induced spiral ganglion neuron damage. Autophagy, 2021; 17(12):4159–4181.

32.

Liu

, Wang

, He

, et al. Diallyl trisulfide inhibits osteosarcoma 143B cell migration, invasion and EMT by inducing autophagy. Heliyon, 2024; 10(5):e26681.

33.

LóRáND

, Kocsis

. Recent advances in antifungal agents. Mini Rev Med Chem, 2007; 7(9):900–911.

34.

Lou

, Wu

, He

, et al. Hesperidin activates Nrf2 to protect cochlear hair cells from cisplatin-induced damage. Redox Rep, 2024; 29(1):2341470.

35.

Mandic

, Misirkic Marjanovic

, Janjetovic

, et al. Multifaceted role of AMPK in autophagy: More than a simple trigger? Am J Physiol Cell Physiol, 2025; 329(5):C1380–C1397.

36.

Martini-Stoica

, Xu

, Ballabio

, et al. The autophagy-lysosomal pathway in neurodegeneration: A TFEB perspective. Trends Neurosci, 2016; 39(4):221–234.

37.

Nacher-Soler

, Lenglet

, Coelho

, et al. Local cisplatin delivery in mouse reliably models sensorineural ototoxicity without systemic adverse effects. Front Cell Neurosci, 2021; 15:701783.

38.

Napolitano

, Ballabio

AA-O

. TFEB at a glance. J Cell Sci, 2016; 129(13):2475–2481.

39.

Navarro

, PEñA

, Colmenares

, et al. Synthesis and characterization of new palladium-clotrimazole and palladium-chloroquine complexes showing cytotoxicity for tumor cell lines in vitro. J Inorg Biochem, 2006; 100(1):152–157.

40.

Negoita

, Fraguas Bringas

, Hellberg

, et al. AMPK promotes TFEB transcriptional activity through dephosphorylation at both MTORC1-dependent and -independent sites. Autophagy, 2026:1–15.

41.

Orgel

, Villaluna

, Krailo

, et al. Sodium thiosulfate for prevention of cisplatin-induced hearing loss: Updated survival from ACCL0431. Lancet Oncol, 2022; 23(5):570–572.

42.

Paquette

, EL-Houjeiri

, Zirden

, et al. AMPK-dependent phosphorylation is required for transcriptional activation of TFEB and TFE3. Autophagy, 2021; 17(12):3957–3975.

43.

Perez

, Nazarian

, Sohmer

, et al. The effect of topically applied antimycotic agents on inner ear vestibular and cochlear function. Laryngoscope, 2013; 123(4):1033–1039.

44.

Roberge

, Roussel

, Andersson

, et al. TNF-α-mediated caspase-8 activation induces ROS production and TRPM2 activation in adult ventricular myocytes. Cardiovasc Res, 2014; 103(1):90–99.

45.

Robles-Escajeda

, MARTíNEZ

, Varela-Ramirez

, et al. Analysis of the cytotoxic effects of ruthenium-ketoconazole and ruthenium-clotrimazole complexes on cancer cells. Cell Biol Toxicol, 2013; 29(6):431–443.

46.

Rose

, Croonenberg

, Clemens

, et al. Cisplatin-induced hearing loss, oxidative stress, and antioxidants as a therapeutic strategy—A state-of-the-art review. Antioxidants, 2024; 13(12):1578.

47.

Rybak

, Dhukhwa

, Mukherjea

, et al. Local Drug Delivery for Prevention of Hearing Loss. Front Cell Neurosci, 2019; 13:300.

48.

Senapati

, Mahapatra

, Singh

, et al. mTOR inhibitors in targeting autophagy and autophagy-associated signaling for cancer cell death and therapy. Biochim Biophys Acta Rev Cancer, 2025; 1880(3):189342.

49.

Settembre

, DI Malta

, Polito

, et al. TFEB links autophagy to lysosomal biogenesis. Science, 2011; 332(6036):1429–1433.

50.

Settembre

, Zoncu

, Medina

, et al. A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. Embo J, 2012; 31(5):1095–1108.

51.

Song

, Zhang

, Geng

, et al. Clotrimazole inhibits growth of multiple myeloma cells in vitro via G0/G1 arrest and mitochondrial apoptosis. Sci Rep, 2024; 14(1):15406.

52.

Suzuki

, Hayashi

, Goto

, et al. Premature senescence is regulated by crosstalk among TFEB, the autophagy lysosomal pathway and ROS derived from damaged mitochondria in NaAsO(2)-exposed auditory cells. Cell Death Discov, 2024; 10(1):382.

53.

Tang

, Wang

, Jin

, et al. Cisplatin-induced ototoxicity: Updates on molecular mechanisms and otoprotective strategies. Eur J Pharm Biopharm, 2021; 163:60–71.

54.

Tucci

, Merson

, Wilson

. A summary of the literature on global hearing impairment: Current status and priorities for action. Otol Neurotol, 2010; 31(1):31–41.

55.

Wang

, Yang

, Edin

, et al. Targeted metabolomics identifies the cytochrome p450 monooxygenase eicosanoid pathway as a novel therapeutic target of colon tumorigenesis. Cancer Res, 2019; 79(8):1822–1830.

56.

Wang

, Xu

, Hu

, et al. Modulation of lactate-lysosome axis in dendritic cells by clotrimazole potentiates antitumor immunity. J Immunother Cancer, 2021; 9(5):e002155.

57.

Wei

, Zhang

, Cao

, et al. RONIN/HCF1-TFEB axis protects against D-galactose-induced cochlear hair cell senescence through autophagy activation. Adv Sci (Weinh), 2025; 12(29):e2407880.

58.

, Xiong

, Sha

. Noise-induced loss of sensory hair cells is mediated by ROS/AMPKα pathway. Redox Biol, 2020; 29:101406.

59.

Yang

, Sun

, Yin

, et al. PINK1 protects auditory hair cells and spiral ganglion neurons from cisplatin-induced ototoxicity via inducing autophagy and inhibiting JNK signaling pathway. Free Radic Biol Med, 2018; 120:342–355.

60.

, Gu

, Chen

, et al. Current strategies to combat cisplatin-induced ototoxicity. Front Pharmacol, 2020; 11:999.

61.

, Mcphee

, Zheng

, et al. Termination of autophagy and reformation of lysosomes regulated by mTOR. Nature, 2010; 465(7300):942–946.

62.

Zhang

, Fang

, Wang

, et al. Increased mitophagy protects cochlear hair cells from aminoglycoside-induced damage. Autophagy, 2023; 19(1):75–91.

63.

Zhao

, Wu

, Hu

, et al. The antioxidant ergothioneine alleviates cisplatin-induced hearing loss through the Nrf2 pathway. Antioxid Redox Signal, 2025; 42(1–3):97–114.

64.

Zheng

, Zhan

, Li

, et al. TFEB, a potential therapeutic target for osteoarthritis via autophagy regulation. Cell Death Dis, 2018; 9(9):858.

65.

Zou

, Xie

, Huang

, et al. Potential role of modulating autophagy levels in sensorineural hearing loss. Biochem Pharmacol, 2024; 222:116115.

66.

Zuccolini

, Barbieri

, Sbrana

, et al. IK channel-independent effects of clotrimazole and senicapoc on cancer cells viability and migration. Int J Mol Sci, 2023; 24(22):16285.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.03 MB

0.68 MB

0.31 MB

1.40 MB

0.14 MB

0.79 MB

0.62 MB