Direct conversion of adult human retinal pigmented epithelium cells to neurons with photoreceptor properties

Chemicals and plasmids

Dorsomorphin dihydrochloride was purchased from Tocris. Purmorphamine, CHIR99021, SB431542, and Y27632 were obtained from Reagents Direct. Recombinant human NGF, GDNF, BDNF, and TGFβ3 were obtained from PeproTech. FUW-tetO-LoxP, pMD2.G, and psPAX2 were purchased from Addgene. Human ASCL1 (GenBank accession BC031299) was obtained from Open Biosystems and then subcloned into FUW-tetO-LoxP. Human miRNA124 (MIMAT0000422) was amplified from human genomic DNA, then subcloned into FUW-tetO-LoxP. FUW-LoxP-M2rtTA was purchased from Addgene.

Cell culture

Adult primary human RPE (hRPE) cells were provided by Dr. Sally Temple at Neural Stem Cell Institute, Rensselaer, NY. These mature primary cells are directly isolated from postmortem human eyes. ¹³ Our experiments on these cells are not human subject research. All RPE cells were cultured on 10-cm dishes in RPE medium^14,15 that consisted of equal parts of MEM-α modification (Sigma-Aldrich, St. Louis, MO) and DMEM/F12 (Gibco), 5% fetal bovine serum (HyClone, Logan, UT), N1 (1×; Sigma-Aldrich), nonessential amino acids (1×, Gibco), sodium pyruvate (1×, Gibco), GlutaMAX-I (2 mM; Gibco), triiodothyronine (0.013 μg/L; Sigma-Aldrich), hydrocortisone (20 ng/mL; Sigma-Aldrich), taurine (250 μg/mL; Sigma-Aldrich), and nicotinamide (1 mM; Sigma-Aldrich). RPE cells were passaged using TrypLE (Invitrogen). Reprogrammed neurons were cultured on 12-well plates or glasses slides coated with matrigel (Sigma-Aldrich) in neural induction medium. ¹⁶

Direct conversion of hRPE cells by ASCL1 and microRNA124

All hRPE cells were cultured without antibiotics. Mycoplasma was not detected using PCR. Collection of lentivirus and infection of hRPE cells were conducted as described previously. ¹⁷ HEK293FT cells (Invitrogen) were cultured at 4–6 × 10⁶ cells in a 10 cm cell culture dish. They were transfected with 10 μg of FUW-tetO-LoxP-hASCL1, or 10 μg of FUW-tetO-LoxP-hmiRNA124, or 10 μg of FUW-LoxP-M2rtTA accompanied with 7.5 μg of psPAX2 and 2.5 μg of pMD2.G using Lipofectamine 2000 (Invitrogen). Lentiviruses were collected from 16 to 64 h after transfection. Elisa kit detecting p24 (ZeptoMetrix Corporation, Buffalo, NY) was used to titer virus.

After hRPE cells were passaged twice, they were plated at a density of 1 × 10⁴ cells/cm². One day later, the cells were infected for 16–20 h with the indicated combinations of lentivirus (human ASCL1, human miRNA124, and M2rtTA each at MOI 20) with 8 μg/mL polybrene (Sigma-Aldrich, St. Louis, MO). Medium containing the virus was removed after 16 h and replaced with DMEM/F12. After 24 h, the medium was changed to neural induction media (DMEM/F12, 1 × NEAA, 1 × N2 supplements, 1 × B27, 20 ng/mL NGF, 20 ng/mL GDNF, 20 ng/mL BDNF, 1 ng/mL TGFβ3, 1 μM dorsomorphin, 10 μM SB431542, 3 μM CHIR99021, 2 μM purmorphamine, 0.2 mM vitamin C, 10 μM ROCK inhibitor Y27632, and 1 μg/mL doxycycline). After six days, the medium was changed to neural maturation media (neural induction medium without dorsomorphin, SB431542, CHIR99021, purmorphamine, and doxycycline). Medium was changed every two days. Most experiments were performed on Day 8.

EdU labeling

At Day 6 after DOX induction of transgene overexpression, 10 µM EdU was added into medium to incubate with cells for 24 h. After cells were washed three times with medium, they were incubated in fresh medium until cells were fixed at Day 12 in PBS containing 4% paraformaldehyde for 20 min. Cell were permeabilized with 0.1% Triton X-100 for 20 min at room temperature, first stained with polyclonal TuJ1 antibody overnight, and then stained with anti-rabbit IgG Alexa Fluor 546 for 1 h at room temperature. EdU was detected in a solution containing 4 mM copper sulfate, 40 mM sodium ascorbate, and 20 µM Alexa Fluor 488 azide, 20 mM Tris, pH =7.6. Cells were counterstained with DAPI to identify nuclei.

Real-time quantitative RT-PCR

Total cellular RNA was extracted using RNeasy Mini kit (Qiagen). Reverse transcription was performed with iScript cDNA synthesis kit (Bio-Rad). RT-PCR was performed with iQ SYBR Green Supermix (Bio-Rad) using CFX96 Touch™ Real-time PCR detection System (Bio-Rad) for total reaction volumes of 20 µl. Each sample was done in triplicates. PCR conditions included an initial denaturation step of 4 min at 95°C, followed by 40 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C. The average threshold cycle (Ct) values were subtracted by the average Ct values for GAPDH. This difference denoted as ΔCt was used to derive the fold change, which is defined as 2^−ΔCt × 10⁶. Primers for the examined genes are listed in Table 1.

OPEN IN VIEWER

Table 1.

Sequence of primers used in qRT-PCR.

Genes	Primer sequence
PDC	Forward: TCAAAGGAACGAGTCAGCAGReverse: CTGCTGCAAGGCATGTTAAA
PDE6b	Forward: CAGTGATGAACACCGACACCReverse: ATTTGACCAGGTCCAGTTCG
Recoverin	Forward: TAACGGGACCATCAGCAAGReverse: CCTCGGGAGTGATCATTTTG
SAG	Forward: CTGATCCGCAAAGTACAGCAReverse: TCAGCGTCTTGGTCAAAGTG
GAPDH	Forward: ACCACAGTCCATGCCATCACReverse: TCCACCACCCTGTTGCTGTA
L/M-opsin	Forward: GTCACTGCATCCGTCTTCACAAATGGGReverse: ATCTCACATTGCCAAAGGGCTTGCAC
S-opsin	Forward: CTTCCTTATAGGGTTCCCACTCAATGCCReverse: GAAGTTGCCGAAGGGCTTACAGATGAC

Immunocytochemistry

Reprogrammed cells in multi-well plates were fixed in 4% paraformaldehyde in PBS for 20 min at room temperature. Cells were permeabilized with 0.1% Triton X-100 in PBS for 20 min. After incubation in 5% BSA in PBS for 1 h, cells were stained in primary antibody overnight at 4°C and then incubated in secondary antibody for 2 h at room temperature in dark. Information on primary and second antibodies is listed in Table 2. Fluorescence images were taken on a Leica AF6000 inverted fluorescence microscope. Positive cells were counted with five independent frames at 10× magnification for each condition.

OPEN IN VIEWER

Table 2.

Antibodies used in the study.

Antibody	Catalog #	Vender	Dilution
TuJ1	AB78078	Abcam	1:1000
Polyclonal TuJ1	PA5-85639	Invitrogen	1:1000
Mouse monoclonal MAP2	sc-74421	Santa Cruz	1:1000
Chicken polyclonal MAP2	ab5392	abcam	1:1000
Recoverin	AB5585	EMD Millipore	1:1000
Rhodopsin	MAB5356	EMD Millipore	1:1000
Opsin	AB5405	EMD Millipore	1:1000
NeuN	ab104224	abcam	1:1000
Donkey anti-Rabbit IgG (H + L), Alexa Fluor 488	A21206	Thermo Fisher	1:2000
Donkey anti-Rabbit IgG (H + L), Alexa Fluor 546	A10040	Thermo Fisher	1:2000
Donkey anti-Mouse IgG (H + L), Alexa Fluor 546	A10036	Thermo Fisher	1:2000
Donkey anti-Mouse IgG (H + L), Alexa Fluor 488	A21202	Thermo Fisher	1:2000
Goat anti-Chicken IgG (H + L), Alexa Fluor 546	A11040	Thermo Fisher	1:2000

Electron microscopy

Converted cells were harvested at Day 10 of reprogramming. Following centrifugation at 1000 r/min for 5 min, cell pellet was immersed in 2.5% glutaraldehyde, then fixed with 1% osmium tetroxide. A series of graded ethanol was used to dehydrate cells. Afterwards, cells were embedded in araldite, then stained with 4% uranyl acetate for 20 min and 0.5% lead citrate for 10 min. Ultra-thin sections (50 nm) were observed with a transmission electron microscope (1200 EX II; JEOL, Tokyo, Japan).

Electrophysiology

Voltage-dependent ionic currents were recorded in converted cells at Day 7 and Day 14 using a previous protocol. ¹⁶ Cells (held at −70 mV) were perfused with artificial cerebrospinal fluid (ACSF), and voltage levels were implemented from −90 to +50 mV at 10 mV increments. Whole-cell patch recordings were made using either β-escin or amphotericin forming perforated patches. Cells were held at −70 mV in voltage clamp or current clamped at −50 mV and bathed in Tyrode solution. Light stimuli were provided by a 1 s green LED stimulus (530 nm peak) of varying intensities. Neither current signals nor voltage responses were detected in response to light stimulation, but voltage-gated inward and outward currents were observed when cells were stepped to −30, −10, and +10 mV (n = 7).

Statistical analyses

All statistical analyses were performed with Origin (OriginLab, Northampton, MA). Data are expressed as mean ± SD (Standard deviation of measurement). The difference between two groups was assessed by two-tailed Student's t-tests. P-value <0.05 was considered to be statistically significant.

Direct conversion of hRPE cells to postmitotic neurons using ASCL1 and miRNA124

As shown in the timeline of the conversion (Figure 1(a)), adult hRPE 252 cells were plated on Day−3. On the following day, cells were infected with reprogramming lentiviruses expressing ASCL1 or miRNA124 for 16–20 h. Our previous studies have shown that cell cycle synchronization at G1 significantly facilitates the direct conversion of human fibroblasts to induced dopaminergic neurons ¹⁶ and induced serotonergic neurons. ¹⁸ Thus, we induced cell cycle arrest at the G1/S checkpoint by serum withdrawal for 24 h. At the onset of reprogramming (Day 0), the cells were cultured in neural induction medium ¹⁶ (DMEM/F12, 1 × NEAA, 1 × N2 supplements, 1 × B27, 20 ng/mL NGF, 20 ng/mL GDNF, 20 ng/mL BDNF, 1 ng/mL TGFβ3, 1 μM dorsomorphin, 10 μM SB431542, 3 μM CHIR99021, 2 μM purmorphamine, 0.2 mM vitamin C, 10 μM ROCK inhibitor Y27632) with 1 μg/mL doxycycline (DOX) to induce the overexpression of viral transgenes for six days. The cells were then maintained in neural maturation medium (neural induction medium without dorsomorphin, SB431542, CHIR99021, purmorphamine) in the absence of DOX.

OPEN IN VIEWER

Figure 1.

Reprogramming hRPE cells to neurons using ASCL1 and miRNA124.(a) Using the reprogramming timeline, hRPE cells were plated in RPE medium on Day −3. One day later (Day −2), cells were infected with reprogramming lentiviruses as indicated for 16–20 h. Then, cell cycle was synchronized to the G1 phase by serum withdrawal for 24 h. Reprogramming started at Day 0 by exposing synchronized hRPE cells in Neural Induction Medium and doxycycline (DOX) to induce the expression of viral transgenes. After six days, cells were maintained in neural maturation medium. (b–e) Representative images of hRPE 252 cells (b), and hRPE 252 cells converted by ASCL1 [A] (c), miRNA124 [m] (d), or ASCL1 plus miRNA124 [Am] (e) on Day 8. Scale bar, 50 μm. (f–l‴) Immunostaining at Day 8 for DAPI, Tuj1, and MAP2 (with a mouse monoclonal antibody) in hRPE cells (f–f‴), and hRPE transduced with ASCL1 (g–g‴), miRNA124 (h–h‴), or ASCL1 plus miRNA124 (i–i‴). Scale bar, 100 μm. (j) Quantification of the percentages of Tuj1⁺ cells in DAPI⁺ cells or MAP2⁺ cells in DAPI⁺ cells at Day 8. *^{, #} P < 0.05, unpaired, two-tailed Student’s t-tests, vs. to A or m, respectively. n = 6 wells from three independent experiments. (k–k″) Cells at Day 6 of conversion were treated with 10 µM EdU for 24 h and fixed at Day 12 for costaining of TuJ1 (kʹ), EdU (k″), and DAPI (k). (l–m‴) Fixed cells at Day 12 were costained with a chicken polyclonal antibody against MAP2 (l″ and m″) together with antibodies against Tuj1 (lʹ) or NeuN (mʹ), and DAPI (l‴ and m‴). (A color version of this figure is available in the online journal.)

We initially compared the individual and combined effects of ASCL1 and miRNA124 on reprogramming primary hRPE 252 cells. hRPE cells have cobble stone morphology and contain many pigment granules inside the cell body (Figure 1(b)). After eight days of reprogramming (Day 8), hRPE transduced by ASCL1 [A] (Figure 1(c)) or ASCL1 plus miRNA124 [Am] (Figure 1(e)) demonstrated neurite-like processes. In contrast, neurite-like processes were much less abundant in hRPE converted with miRNA124 [m] alone (Figure 1(d)). To assess reprogramming efficiency, we performed immunostainings for the pan-neuronal marker β3-tubulin (Tuj1) and the mature neuronal marker microtubule-associated protein 2 (MAP2) on Day 8. These markers would provide indications on how well reprogramming occurs, as Tuj1 expression emerges in immature neurons and MAP2 appears in mature neurons. Nuclear staining with DAPI highlights all cells in the culture for quantification purpose. The parental hRPE 252 cells did not express Tuj1 or MAP2 (Figure 1(f) and (f‴)). Meanwhile, cotransduction by ASCL1 and miRNA124 significantly increased the generation of Tuj1⁺ cells (90.6 ± 3.4% of all cells) and MAP2⁺ neurons (82.6 ± 3.9% of all cells) over the levels induced by ASCL1 alone (75.6 ± 3.2% for Tuj1⁺, 53.7 ± 4.9 for MAP2⁺) or miRNA124 alone (67.5 ± 4.4% for Tuj1⁺, 2.0 ± 0.8% for MAP2⁺) (P < 0.05, unpaired, two-tailed Student's t-tests; Figure 1(i) and (j)). Because miRNA124 enhanced the reprogramming efficiency of ASCL1, we used both ASCL1 and miRNA124 [Am] in all subsequent experiments.

To confirm that the converted cells were indeed postmitotic neurons, we treated the cells at Day 6 with 10 µM EdU (5-ethynyl-2ʹ-deoxyuridine) for 24 h to label dividing cells, which incorporate EdU into genomic DNA. When cells were fixed at Day 12 and stained for EdU, very few EdU⁺ cells were found and none of them was Tuj1⁺ (Figure 1(k) and (k″)). This is consistent with previous studies showing that overexpression of ASCL1 drives cells out of cell cycle. ¹⁶ To substantiate the results, we used a different antibody against MAP2 and found the co-localization of MAP2 and Tuj1 (Figure 1(l) and (l‴)) and the co-localization of MAP2 and another mature neuronal marker, NeuN (Figure 1(m) and (m‴)) in converted cells at Day 12. Together, these results unequivocally demonstrated that Am converted RPE cells to postmitotic neurons.

ASCL1 and miRNA converts hRPE cells to neurons expressing photoreceptor markers

We examined whether the converted neurons express photoreceptor markers. Rods and cones, the two types of photoreceptors in human, perform phototransduction through rhodopsin and opsin, respectively. After eight days of reprogramming with ASCL1 and miRNA124, we stained the converted cells for the rod cell marker rhodopsin, the cone cell marker red/green opsin (L/M-opsin), and the pan-photoreceptor marker recoverin, which is expressed in all photoreceptors. ¹⁹ While the parental hRPE 252 cells did not express opsin (Figure 2(aʹ)), rhodopsin (Figure 2(cʹ)), and recoverin (Figure 2(eʹ)), many converted cells coexpressed Tuj1 with opsin (Figure 2(bʹ)), rhodopsin (Figure 2(dʹ)), and recoverin (Figure 2(fʹ)). In contrast to native photoreceptors in vivo, the converted neurons coexpressed both rhodopsin (Figure 2(gʹ)) and opsin (Figure 2(g″)). We found that in all DAPI⁺ cells, 76.4 ± 3.6% expressed opsin, 86.0 ± 6.2% expressed rhodopsin, and 92.1 ± 1.6% expressed recoverin (Figure 2(h)). These results suggest that hPRE 252 cells were reprogrammed by Am to acquire some characteristics of photoreceptors, with coexpression of rhodopsin and opsin.

OPEN IN VIEWER

Figure 2.

Detection of photoreceptor markers in hRPE 252 cells reprogrammed by ASCL1 and miRNA124. Immunostaining of hRPE 252 cells for (a–aʹ) cone cell marker L/M-opsin, (c–cʹ) rod cell marker rhodopsin, and (e–eʹ) photoreceptor marker recoverin. After eight days of reprogramming with ASCL1 and miRNA124, hRPE 252 cells were immunostained for (b–bʹ) L/M-opsin, (d–dʹ) rhodopsin, and (f–fʹ) recoverin. All cells were co-stained for (a″–f″) Tuj1 and (a‴–f‴) DAPI. (g–g‴) Merged image (g) of costaining for rhodopsin (gʹ), L/M-opsin (g″), and DAPI (g‴) in hRPE 252 cells reprogrammed with Am for eight days. Scale bar, 100 μm. (h) Quantification of the percentage of DAPI⁺ cells that are positive for the indicated markers at Day 8. (A color version of this figure is available in the online journal.)

Time-dependent induction of photoreceptor genes as hRPE cells are reprogrammed by Am

To confirm the results from immunostaining, we performed quantitative RT-PCR to measure the expression of photoreceptor-specific genes at different time points as three independent lines of adult hRPE cells (252, 256, and 247) were being reprogrammed by ASCL1 and miRNA124 (Am). We found that the expression of the cone photoreceptor markers L/M-opsin (Figure 3(a)) and S-opsin (Figure 3(b)) in the three lines of hRPE cells was significantly and consistently increased from Days −2 to 6 of reprogramming. Expression levels of the rod photoreceptor markers phosphodiesterases 6 b (PDE6b) (Figure 3(c)) and arrestin S-antigen (SAG) (Figure 3(d)) were also significantly and consistently increased from Days −2 to 6. This was also the case for the expression of the generic photoreceptor markers phosducin (PDC) (Figure 3(e)) and recoverin (Rcv) (Figure 3(f)). While each line of hRPE cells had somewhat different patterns in the induction of these marker genes, the overall trend was a substantial and continuing increase in the expression of these genes, as hRPE cells were converted to acquire photoreceptor properties.

OPEN IN VIEWER

Figure 3.

Induction of photoreceptor marker genes in multiple lines of hRPE cells reprogrammed with ASCL1 and miRNA124. Real-time quantitative RT-PCR measurements of the expression of L/M-opsin (a), S-opsin (b), PDE6b (c), SAG (d), PDC (e), and recoverin (f) in total RNA isolated from three independent lines of hRPE cells (252, 256, and 247) at Days −2, 0, 1, 2, 4, and 6 of reprogramming. Expression levels of the indicated genes were compared to that of GAPDH in the same sample. * P < 0.05, vs. Day −2, unpaired Student's t-test, n = 6 wells from three independent experiments. (A color version of this figure is available in the online journal.)

Morphological and functional analyses of converted neurons

The unique ultrastructural features of photoreceptors are densely packed membrane discs or invaginations that are embedded with components of the phototransduction pathway, such as rhodopsin and opsin. ²⁰ We performed transmission electron microscopy on hRPE 252 cells converted by ASCL1 and miRNA124 at Day 10. In these converted cells, there were many stacked, single-layered, semi-parallel membranous structures that were similar to photoreceptor discs (Figure 4(a) and (b), arrows). Cone photoreceptors have far fewer discs than rod photoreceptors have; their discs are formed by invaginations of the outer segment membrane, unlike the freely floating, stacked discs in rod photoreceptors. We did not see disc-like structures attached to the plasma membrane.

OPEN IN VIEWER

Figure 4.

Transmission electron micrographs and electrophysiology recordings of hRPE 252 cells converted by ASCL1 and miRNA124. (a, b) Transmission electron micrographs of hRPE 252 cells reprogrammed with ASCL1 and miRNA124 for 10 days. Arrowheads, photoreceptor disc-like structures. Scale bars: 500 nm in (a), 100 nm in (b). (c) In response to voltage steps, small voltage-gated Na⁺ currents (I_Na⁺, inward) and voltage-gated delayed rectifier K⁺ currents (I_K⁺, outward) were recorded in hRPE 252 cells reprogrammed with ASCL1 and miRNA124 for seven days. (d) In response to voltage steps, large voltage-gated Na⁺ currents (I_Na⁺, inward), voltage-gated A-type K⁺ currents (I_K⁺, outward), and voltage-gated Ca²⁺ currents (I_Ca²⁺, inward) were recorded in hRPE 252 cells reprogrammed with ASCL1 and miRNA124 for 14 days.

We performed electrophysiological recording on converted cells at Day 7 and Day 14. In response to voltage steps applied on the cell membrane, small amount of fast-inactivating voltage-gated Na⁺ currents (I_Na⁺, inward) were observed, along with large voltage-gated delayed rectifier K⁺ currents (I_K⁺, outward) in neurons at Day 7 (Figure 4(c)). In neurons at Day 14, much larger voltage-gated Na⁺ currents (I_Na⁺, inward) were seen. In addition, there were A-type voltage-gated K⁺ currents (I_K⁺, transient outward), as well as voltage-gated Ca²⁺ currents (I_Ca²⁺, inward). These currents were similar in durations and amplitudes to what we observe in induced neurons converted from fibroblasts. ¹⁶ The data showed a maturation of electrophysiological properties in the converted neurons. We tried to elicit light responses using 1 s green LED stimulus (530 nm peak) of varying intensities. There was no current or voltage response in response to light stimulation, suggesting that the complete visual phototransduction machinery is either not present or not fully functional.