Agrin as a Stable Biomarker for Muscle Strength Decline in Elderly Sarcopenic Patients Associated with Neuromuscular Junction Dysfunction

Abstract

Agrin-mediated neuromuscular junction (NMJ) morphological alterations is one of the main pathogeneses of sarcopenia. The aim of this study was to observe the changes in serum agrin in patients with different degrees of sarcopenia and the alterations in Agrin receptors in human skeletal muscle with age. A total of 236 elderly subjects were enrolled and categorized into nonsarcopenia, possible sarcopenia, sarcopenia, and severe sarcopenia groups. Serum levels of the C-terminal Agrin fragment were quantified using an Enzyme-Linked Immunosorbent Assay (ELISA) kit. In addition, in a distinct and smaller exploratory subgroup (n = 12), quantitative real-time polymerase chain reaction and immunofluorescence staining were performed to investigate the expression of Agrin receptors, specifically low-density lipoprotein receptor-related protein 4 (Lrp4) and alpha-dystroglycan (α-DG), in human skeletal muscle samples. Compared with that in the nonsarcopenia group, the level of agrin in the other groups was significantly different. Partial correlation analysis and binary logistic regression analysis suggested that the level of Agrin was associated with handgrip strength. There was a significant increase in the serum level of agrin and a reduction in the mRNA expression of the agrin receptors Lrp4, α-DG, and RAPSN, while immunofluorescence analysis confirmed the expression patterns of the Lrp4 and α-DG receptors. In the elderly population, the level of agrin decreased in patients with sarcopenia, while the expression of its receptors also decreased. These factors result in NMJ morphological alterations, weakened muscle contraction, and increased risk of sarcopenia.

Keywords

sarcopenia agrin low-density lipoprotein receptor-related protein 4 (Lrp4)alpha dystroglycan (α-DG)handgrip strength

Introduction

Sarcopenia, a syndrome characterized by the progressive loss of muscle mass and function associated with aging, profoundly impacts the quality of life of elderly individuals.¹ It is not only linked to reduced physical ability but also increases the risk of falls, fractures, and other health complications, ultimately contributing to increased mortality rates.^2–5 The pathogenesis of sarcopenia is complex and incompletely understood; however, recent evidence suggests that morphological alterations of the neuromuscular junction (NMJ) may play a critical role in its development.⁶

The NMJ is a specialized connection between motor neurons and muscle fibers, where nerve signals are converted into muscle contractions via neurotransmitters.⁷ Among these neurotransmitters, acetylcholine (ACh) stands out as one of the most crucial neurotransmitters for this process. Stored primarily at the axon terminals of motor neurons, ACh is released into the synaptic cleft through exocytosis in response to neural electrical signals.⁸ This release facilitates binding to acetylcholine receptors (AChRs) on the muscle cell surface, thereby stimulating muscle contraction.

In recent years, studies have shown that agrin also plays an important role in the formation and maintenance of NMJs.⁹ Agrin, a heparan sulfate proteoglycan synthesized mainly by motor neurons, has a molecular weight ranging from approximately 400 kDa to 600 kDa.¹⁰ It contains multiple functional domains, including an N-terminal signal peptide, serine/threonine-rich regions, a heparin-binding domain, and a C-terminal neuromuscular-specific domain.¹¹ The cleaved C-terminal fragment (CAF) of agrin can be detected in human blood and urine, serving as a sensitive indicator of tissue agrin levels.⁹

At the NMJ, agrin is synthesized and released by motor neurons into the synaptic cleft, where it binds to low-density lipoprotein receptor-related protein 4 (Lrp4) on the muscle cell membrane.¹² This interaction activates muscle-specific kinase (MuSK), initiating signaling pathways that lead to the aggregation of AChRs and other NMJ components on the muscle cell membrane.⁹ This process is vital for the effective transmission of neural signals to muscles, supporting muscle function and integrity.¹³ Moreover, agrin participates in the regeneration and repair processes of skeletal muscle cells. Studies have demonstrated that agrin can activate the Yap and ERK signaling pathways after binding with another receptor, alpha dystroglycan (α-DG), in cardiomyocytes, increasing the proliferation of neonatal cardiomyocytes.¹⁴ Agrin combined with α-DG can also promote the aggregation of AChRs on the skeletal muscle cell membrane through the Rapsyn protein.¹⁵ In mouse models of congenital muscular dystrophy, the overexpression of agrin significantly improved muscular dystrophy.¹⁶ In addition, supplementation with agrin has been shown to improve muscle mass and strength in elderly mice, delaying the progression of sarcopenia.¹⁷ However, the changes in the expression of agrin in elderly patients with sarcopenia and its clinical diagnostic significance need further clarification.

This study was designed to further elucidate the relationship between agrin and sarcopenia/skeletal muscle aging. To this end, we validated agrin’s prognostic value in a very large, well-characterized cohort uniquely enriched with older patients experiencing severe sarcopenia, using advanced statistical methods. Furthermore, by examining the expression levels of agrin receptors and related molecules in human skeletal muscle tissues across different age groups, we provide direct pathophysiological evidence that moves beyond predominant animal models, thereby offering new and robust evidence for investigating the pathogenesis of sarcopenia.

Subjects and Methods

Study population

A total of 236 elderly subjects (age range 65–101 years, mean age 89.99 ± 9.06 years) were included in this study, and all of them were stable outpatients followed up at the Geriatric Hospital of Nanjing Medical University. Most of the participants were over 80 years old (n = 199, 84.32%), with 64.41% (n = 152) of them being over 90 years old. The proportion of females was 37.29% (female: n = 88, male: n = 148). All recruited subjects were asked to complete a self-assessment questionnaire that included demographic data, height, body weight (BW), midupper arm circumference (MUAC), calf circumference, disease history, and medication history. Body mass index (BMI) was calculated as follows: BMI (kg/m²) = weight (kg)/height² (m²).

Individuals taking antidepressants and antiepileptics were excluded. In addition, subjects with myasthenia gravis, amyotrophic lateral sclerosis, diabetic peripheral neuropathy, acute infection, or severe liver and kidney dysfunction were also excluded.

This study complied with the guidelines of the Helsinki Declaration. The Ethics Committee of the Geriatric Hospital of Nanjing Medical University approved this study protocol (No: 2022022). All participants provided written informed consent, and patient anonymity was preserved.

Blood sampling

Blood samples were obtained after an overnight fast. Alanine aminotransferase (ALT, 0–45 u/L), albumin (ALB, 35–55 g/L), serum creatinine (sCr, 45–98 μmol/L), Low-density lipoprotein cholesterol (LDL-C, 1.0–3.7 mmol/L), C-reactive protein (CRP, 0–5 mg/L) and glucose (GLU, 3.9–6.1 mmol/L) levels were determined immediately by the laboratory of the Geriatric Hospital of Nanjing Medical University using chemiluminescence method (HITACHI 7600 automatic analyzer).

Agrin detection

Serum CAFs were detected via an ELISA kit (ab216945, Abcam, Cambridge, MA) in the fasting serum of all selected individuals to determine the level of agrin. Following collection and clotting, serum was separated by centrifugation (2000×g, 10 minutes), aliquoted, and stored at −80°C. All standards, controls, and samples were assayed in duplicate. For the assay, samples were diluted ≥4-fold. A mixture of 50 µL diluted sample/standard and 50 µL antibody cocktail was added to the precoated plate and incubated for 1 hour at RT with shaking (2800 × g). After three washes with Wash Buffer PT (350 µL/well), 100 µL TMB was added, and the plate was incubated in the dark for 8 minutes with shaking. The reaction was stopped with 100 µL stop solution, and absorbance was read at 450 nm.

Assessment of sarcopenia

In accordance with the consensus of AWGS 2019, skeletal muscle mass index (SMI), hand grip (HG) and gait speed (GS) were used to represent skeletal muscle mass, muscle strength, and muscle function, respectively.

Bioelectrical impedance analysis (InBody S10, Korea) was used to measure appendicular skeletal muscle mass (ASM). The appendicular SMI was calculated as follows: SMI (kg/m²) = ASM (kg)/height² (m²). A low SMI is defined as <7.0 kg/m² in men and <5.7 kg/m² in women.

A hand dynamometer (Jamar®, Los Angeles, CA, USA) was used to measure the HG of the dominant hand. All hands were naturally drooped and tested three times in 1 minute using a dynamometer to record the maximum. Low muscle strength is defined as <28.0 kg for men and <18.0 kg for women. The HG/BW index was calculated as follows: HG/BW = handgrip strength (kg)/body weight (kg), whereas the HG/SMI index was calculated as follows: HG/SMI = handgrip strength (kg)/SMI (kg/m²).

GS was measured via the 6-meter (6 m) walk test. The examiner measured the time taken to walk 6 m at a normal pace from a moving start without deceleration and took the average result of at least 2 trials as the recorded speed. According to the AWGS 2019 consensus, the cutoff for slow GS is <1 m/s.

All the assessments were performed by a single examiner in a dedicated Comprehensive Geriatric Assessment room to avoid distractions during the procedure.

Diagnosis of sarcopenia

According to the AWGS 2019 consensus, the definition of sarcopenia includes low SMI combined with low HG or slow GS. Severe sarcopenia is defined as a low SMI combined with low HG and slow GS. Sarcopenia may be defined as a normal SMI but low HG, with or without slow GS.

Human muscle tissue samples

A total of 12 elderly subjects (aged 23–82 years) were included and divided into a young group (aged <60 years, n = 6) and an elderly group (aged ≥60 years, n = 6). The average ages of the young and elderly groups were 36.54 ± 8.16 years and 78.23 ± 5.12 years, respectively, with female proportions of 50% and 33.33%, respectively. These individuals were patients with tibial plateau fractures who were undergoing knee replacement surgery and without a history of myasthenia gravis, amyotrophic lateral sclerosis, severe diabetic peripheral neuropathy, or severe hepatic and renal dysfunction. The muscle tissue was derived from the gastrocnemius muscle. Informed consent forms were signed, and ethical approval was granted (No: 2022022) by the Ethics Committee of the Geriatric Hospital of Nanjing Medical University.

RNA purification and quantitative real-time polymerase chain reaction (Q-PCR)

Muscle tissues were harvested for RNA purification. Total RNA was isolated via TRIzol reagent (Invitrogen) for mRNA evaluation. One microgram of total RNA was used for cDNA synthesis. Reverse transcription was performed via the Superscript III first-strand synthesis system (Invitrogen) on a Veriti 96-Well Fast Thermal Cycler (Applied Biosystems, Grand Island, NY). Q-PCR was performed via the SYBR GreenER Q-PCR Kit (Invitrogen) via a Q3 Real-Time PCR System (Applied Biosystems). The primer pairs used for the mRNAs were as follows:

Gene	Forward	Reverse
Lrp4	ACCTACCTGTTCCCCTCTTGA	GTCCTGCTCATCCGAGTCATC
MuSK	CTGGTTGCCTTCAGCGGAA	CTGCACACATGAAAGTAGCCA
α-DG	CTCTCTGTGGTTATGGCTCAGT	CTGTTGGAATGGTCACTCGAAAT
RAPSN	GCAGGTGTGGACAAAGGTG	CCAGGTTCAGGTAGCTCTCC
ACTB	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT

Immunofluorescence staining

Immunofluorescence analysis of muscle tissues was performed as described previously.¹⁸ For immunofluorescence staining: sections were removed from −20°C, air-dried at room temperature (avoiding over-drying), soaked in PBS for 10 minutes to remove O.C.T., and incubated with 0.3% Triton X-100 for 10 minutes, followed by PBS wash for 10 minutes. After blocking with 3% BSA at 37°C for 30 minutes, sections were incubated with primary antibodies overnight at 4°C, then washed 3× with PBST (10 minutes each). Secondary antibodies were applied and incubated at 37°C for 1 hour in the dark, followed by 3× PBST washes (10 minutes each). Finally, sections were mounted with 4′,6-diamidino-2-phenylindole (DAPI)-containing antifade medium and imaged via two-photon laser confocal microscopy. The following primary antibodies were used: rabbit anti-Lrp4 (Proteintech, China, Cat# 24434-1-AP, RRID: AB_3669437) and rabbit anti-αDG (Bioss, China, Cat# bs-5152R, RRID: AB_11068079), both at a dilution of 1:200. Alexa Fluor 488-conjugated goat antirabbit antibody (Invitrogen, USA, Cat# A32731, RRID: AB_2633280) was used as a secondary antibody at a 1:500 dilution. The nuclei were stained with DAPI (Sigma, MO). Images were captured via a confocal fluorescence microscope (ZEISS, Germany).

Statistical analysis

Descriptive data are presented as the means (M) ± standard deviations. Before statistical analysis, the data were tested for a normal distribution. One-way Analysis of Variance (ANOVA) and t-tests were performed when the data were normally distributed; otherwise, rank-sum tests were used. The chi-square test was chosen to compare the proportions of females. For the correlation analysis, Pearson’s partial correlation analysis was used. To investigate the associations of agrin with sarcopenia and its defining components (low muscle mass, low muscle strength, and low muscle function), we fitted two logistic regression models. For Model 1, we adjusted for sex, which differed between groups at baseline. For Model 2, age, sex, BMI, ALT, sCr, and CRP were adjusted to be potentially causal for sarcopenia or contribute to its development.

Results

Baseline data, SMI, HG, and GS levels for participants

All patients were divided into a nonsarcopenia group, a possible sarcopenia group, a sarcopenia group, and a severe sarcopenia group according to the 2019 AWGS consensus. Among all 236 subjects, 99 were diagnosed with sarcopenia (sarcopenia or severe sarcopenia), while 78 and 69 individuals were diagnosed with possible sarcopenia and without sarcopenia, respectively.

The proportion of females (χ² = 10.10, p = 0.02), the SMI (F = 40.17, p < 0.01), the HG (F = 39.08, p < 0.01), the GS (F = 15.98, p < 0.01), the HG/BW index (F = 39.69, p < 0.01), the HG/SMI (F = 83.61, p < 0.01) index, and the level of serum agrin (F = 14.83, p < 0.01) were significantly different among the four groups. Compared with those in the nonsarcopenia group, the proportions of females in the sarcopenia and sarcopenia groups were lower, while the HG/SMI index and the level of agrin in the other groups were significantly different. In addition, the HG/BW indices in the possible and severe sarcopenia groups were lower than those in the nonsarcopenia group. The baseline data for the four groups are shown in Table 1.

Table 1.

Baseline Characteristics of the Participants

	Nonsarcopenia	Possible sarcopenia	Sarcopenia		p value
	Nonsarcopenia	Possible sarcopenia	Sarcopenia	Severe sarcopenia	p value
N	69	78	44	45
Female (%)	37 (53.62)	23 (29.49)^#	14 (31.82)^#	18 (40.00)	0.02^*
Age (y)	89.99 ± 8.76	90.35 ± 8.56	88.21 ± 9.75	90.59 ± 9.73	0.56
BMI (kg/m²)	24.85 ± 2.89	24.77 ± 3.87	24.17 ± 3.33	24.76 ± 3.63	0.31
ALT (U/L)	18.29 ± 15.86	17.94 ± 12.74	19.41 ± 13.96	19.69 ± 15.60	0.88
ALB (g/L)	36.88 ± 6.40	37.67 ± 4.12	38.51 ± 3.83	36.57 ± 3.61	0.27
sCr (μmol/L)	85.29 ± 42.48	82.07 ± 25.64	90.94 ± 63.76	75.36 ± 24.56	0.33
GLU (mmol/L)	6.09 ± 2.25	5.90 ± 1.78	5.91 ± 1.98	5.38 ± 1.15	0.26
LDL (mmol/L)	2.31 ± 0.79	2.32 ± 0.81	2.17 ± 0.75	2.37 ± 0.85	0.59
CRP (mg/L)	1.52 ± 1.66	1.93 ± 1.84	2.39 ± 2.55	1.57 ± 1.77	0.88
SMI (kg/m²)	7.34 ± 1.04	7.54 ± 0.87	5.96 ± 0.65^#	5.90 ± 0.78^#	<0.01^*
HG (kg)	27.95 ± 7.49	18.99 ± 5.15^#	28.76 ± 4.69	19.95 ± 4.88^#	<0.01^*
GS (m/s)	0.80 ± 0.21	0.60 ± 0.21^#	0.71 ± 0.18	0.58 ± 0.22^#	<0.01^*
HG/BW	0.42 ± 0.09	0.30 ± 0.08^#	0.45 ± 0.11	0.33 ± 0.09^#	<0.01^*
HG/SMI	3.98 ± 0.90	2.32 ± 0.64^#	5.29 ± 1.72^#	3.29 ± 0.86^#	<0.01^*
MUAC (cm)	27.65 ± 2.37	26.75 ± 6.82	26.84 ± 2.58	26.02 ± 2.82	0.29
CC (cm)	34.00 ± 3.12	33.55 ± 5.80	33.40 ± 3.47	31.80 ± 3.12^#	0.06
Agrin (ng/mL)	5.87 ± 0.60	5.00 ± 0.95^#	5.34 ± 0.78^#	5.01 ± 0.95^#	<0.01^*

p value <0.05, comparison among the four groups.

p value <0.05, compared with the nonsarcopenia group.

BMI, body mass index; ALT, alanine aminotransferase; ALB, albumin; sCr, serum creatinine; GLU, glucose; LDL, low-density lipoprotein; CRP, C-reactive protein; SMI, skeletal muscle mass index; HG, hand grip; GS, gait speed; MUAC, midupper arm circumference; CC, calf circumference.

Correlation between agrin and skeletal muscle evaluation indices

Utilizing baseline data, we employed partial correlation analysis to examine the relationships between agrin and various evaluation indices while controlling for sex to mitigate its potential confounding effects. After adjusting for sex, the agrin level was positively correlated with HG (r =0.175, p = 0.007), HG/BW (r = 0.207, p = 0.001), and HG/SMI (r = 0.228, p < 0.001). Moreover, we noted a modest positive correlation between serum agrin levels and age, although this trend did not reach statistical significance (Fig. 1). We speculate that this may be attributed to the fact that all the patients included in our study were elderly, with a relatively narrow age range.

FIG. 1.

Correlations between agrin and skeletal muscle parameters. SMI, skeletal muscle mass index; HG, hand grip; GS, gait speed; BMI, body mass index; BW, body weight. MUAC, midupper arm circumference; CC, calf circumference. *p value <0.05 indicates a statistically significant correlation.

The correlation between agrin and sarcopenia

Furthermore, binary logistic regression analysis was conducted to elucidate the association between sarcopenia and agrin levels. In Model 1, agrin levels were found to mitigate the risk of HG decline, although males were more susceptible to decreased HG. In Model 2, after adjusting for age, sex, ALT, sCr, GLU, and CRP, the findings remained consistent with those of Model 1 (Table 2).

Table 2.

Correlations Between Agrin, Sarcopenia, Low SMI, Low HG, and Low GS

	Sarcopenia		Low SMI		Low HG		Slow GS
	OR (95% CI)	P	OR	P	OR	P	OR	P
Model 1
Agrin	0.79 (0.59–1.01)	0.13	0.80 (0.60–1.01)	0.12	0.43 (0.30–0.61)	<0.01^*	0.82 (0.48–1.39)	0.46
Male	1.20 (0.69–2.07)	0.51	1.21 (0.70–2.07)	0.50	1.76 (1.01–3.09)	0.04^*	1.98 (0.82–4.80)	0.13
Model 2
Agrin	0.72 (0.48–1.10)	0.13	0.73 (0.47–1.01)	0.12	0.43 (0.29–0.62)	<0.01^*	0.91 (0.53–1.58)	0.74
Male	1.16 (0.50–2.65)	0.73	1.16 (0.51–2.66)	0.74	2.26 (1.20–4.27)	0.01^*	2.13 (0.79–5.78)	0.14

Model 1: adjusted for sex, which varied between groups at baseline.

Model 2: adjusted for age, sex, ALT, sCr, GLU, and CRP, which are potentially causal factors for sarcopenia or contribute to its development.

p value <0.05 indicates a statistically significant difference.

SMI, skeletal muscle mass index; HG, hand grip; GS, gait speed; OR, Odds Ratio; CI, Confidence Interval.

The expression of agrin-related receptors in skeletal muscle tissues from elderly and young people

As sarcopenia is an age-related disease, we expanded our analysis to include serum samples from both younger and older populations to further investigate the relationship between serum agrin levels and age. In addition, to elucidate the mechanism of action of agrin in skeletal muscle tissue, we conducted quantitative PCR (Q-PCR) analyses to evaluate the expression levels of agrin receptors and their associated downstream signaling molecules in the skeletal muscle tissue of elderly and young people. Our findings revealed a significant age-dependent increase in serum agrin levels, marked reductions in the mRNA expression of skeletal muscle agrin receptor components (Lrp4, DAG1, and RAPSN) with increasing age, and stable expression levels of the MuSK receptor (Fig. 2A). The observed decrease in Lrp4 expression is sufficient to impair the physiological function of agrin, as the formation of a complex between Lrp4 and MuSK is essential for effective agrin signal transduction. This conclusion is further corroborated by the down-regulation of the expression of DAG1, a downstream effector of agrin signaling in skeletal muscle tissue. Moreover, the results of the immunofluorescence analysis supported the Q-PCR findings, confirming the expression patterns of the Lrp4 and α-DG receptors (Fig. 2B).

FIG. 2.

(A) mRNA expression levels of LRP4, MUSK, DAG1, and RAPSN in elderly and young population skeletal muscle tissues were measured via Q-PCR. (B) The protein expression of Lrp4 and α-DG in skeletal muscle tissues was examined via immunofluorescence microscopy (×200). *p value <0.05, **p value <0.01, and ***p value <0.001 indicates a statistically significant correlation.

Discussion

Sarcopenia is a prevalent condition among elderly individuals and constitutes a primary cause of disability within this population.¹⁹ The pathophysiology of sarcopenia is multifaceted, with NMJ morphological alterations being a significant contributing factor.⁶ Agrin plays a critical role in maintaining NMJ integrity.²⁰ In this study, we observed that serum agrin levels were markedly lower in elderly patients with sarcopenia than in their nonsarcopenic counterparts, particularly among those with severe or suspected sarcopenia. Notably, reduced grip strength is a common diagnostic criterion for these latter groups, leading us to hypothesize that agrin is more closely associated with grip strength. This hypothesis was corroborated through correlation and regression analyses, which revealed a stronger association between Agrin levels and indicators of muscle strength than between agrin levels and muscle mass or function. Furthermore, we detected significant down-regulation of Lrp4 and α-DG, two principal agrin receptors, in the skeletal muscle tissue of both elderly and young patients. The protein expression of rapsyn, a critical factor in promoting the aggregation of AChRs after receptor activation, was also found to be significantly down-regulated. This analysis of muscle tissue revealed that the expression of the agrin receptor in skeletal muscle tissue markedly decreases with age, consequently impairing the role of agrin in AChR clustering and muscle contraction, thereby facilitating the onset and progression of sarcopenia.

Agrin, a pivotal component of the NMJ, has been extensively documented in previous studies to be associated with sarcopenia.²¹ Several studies have reported that serum agrin levels in the elderly population are elevated compared with those in younger individuals, which is similar to our findings (Fig. 2A). In conjunction with our findings, we hypothesize that this elevation is linked to the downregulation of agrin receptor expression in muscle tissue. The agrin secreted by neuronal cells into the synaptic cleft is unable to fully bind to its receptors on the skeletal muscle cell membrane, resulting in increased accumulation of agrin within the synaptic cleft. The metalloproteinases (MMPs) or neutral endopeptidases (neprilysin) secreted by neuronal cells are capable of cleaving agrin into CAFs, which can subsequently be released into the serum, leading to an elevated concentration of agrin CAF fragments in the elderly population.²² However, the majority of current research has focused primarily on assessing the levels of serum agrin or its CAF fragments across different age groups. There is a paucity of studies examining the expression levels of agrin specifically in elderly individuals, both within the general population and among those with sarcopenia, at the same age. A study by Sarto et al. reported no significant difference in serum agrin levels between nonsarcopenic and sarcopenic older adults.⁶ This finding contrasts with our initial interpretation but underscores the complex dynamics of circulating agrin in aging and sarcopenia. In this context, our observation of significantly lower CAF levels specifically in the severe sarcopenia subgroup may represent a distinct phenomenon, potentially indicative of a late-stage depletion of agrin-related substrates in the advanced disease state.

Furthermore, the capacity of skeletal muscle cells to synthesize agrin receptors and essential postreceptor substances is diminished, resulting in impaired NMJ function. This impairment consequently reduces the frequency and efficacy of muscle contractions, thereby increasing the risk of sarcopenia.^6,23 Concurrently, the decline in contraction frequency and capability is more directly manifested in decreased muscle contraction strength. This relationship underscores the significant association between agrin and muscle strength observed in this study, particularly with respect to muscle strength indicators such as handgrip strength adjusted for body weight (HG/BW) and handgrip strength adjusted for skeletal muscle mass index (HG/SMI).

In addition, in our distinct exploratory subgroup, preliminary histological analysis revealed decreased expression of the agrin receptors Lrp4 and α-DG in skeletal muscle tissue, alongside an age-related reduction in rapsyn expression. Rapsyn, a critical protein involved in the clustering of AChRs, is recognized as a “biological anchor protein” because of its essential role in facilitating AChR aggregation.²⁴ The reduction in rapsyn expression further disrupts AChR clustering, thereby impairing the precise transmission of neurotransmitters.²⁵ Moreover, agrin is implicated in the differentiation and proliferation of muscle cells upon binding to the receptor a-DG, in addition to facilitating the aggregation of AChRs.^26,27 A reduction in α-DG expression impairs the ability of agrin to effectively promote muscle cell proliferation and differentiation, thereby increasing the risk of sarcopenia.^28,29

Our study, however, has certain limitations. First, the serum sample size is insufficient to adequately represent the broader elderly population. Second, the lack of comprehensive data on medication use may lead to residual confounding by polypharmacy, despite controlling for key medications. Third, when selecting muscle tissue samples, we did not differentiate between tissues from elderly patients with and without sarcopenia; instead, samples were obtained from patients with tibial plateau fractures who underwent knee replacement surgery. Although we endeavored to exclude necrotic and potentially compromised muscle tissues, we cannot entirely rule out the influence of specimen source on our findings. We acknowledge that the definitive establishment of a functional impairment in excitation-contraction coupling, which would require complementary techniques such as electromyography, remains an important goal for future investigation.

In summary, by leveraging a very large, well-characterized cohort uniquely enriched with older patients experiencing severe sarcopenia, our study robustly demonstrated that serum agrin levels were lower in elderly patients with sarcopenia than in their nonsarcopenic counterparts, and this reduction was closely associated with diminished muscle strength. Furthermore, our direct analysis of human skeletal muscle tissue, which provides crucial evidence beyond prior animal models, revealed that the expression levels of the key agrin receptors Lrp4 and α-DG significantly decreased with age. This decline impairs agrin’s receptor-binding capacity and its downstream signaling, thereby exacerbating the risk of sarcopenia.

Authors’ Contributions

J.C. and N.C. were responsible for the study design, data collection, data analysis, and article writing. Y.L., T.X., and L.X. collected data and contributed to review of the article. X.O. and C.W. supervised the study and participated in study design, data collection, data analysis, and article writing. All authors revised the article and approved the final article.

Footnotes

Author Disclosure Statement

The authors declare no competing interests.

Funding Information

This work was supported by the Jiangsu Health Commission Foundation of China (No. LKM2022011, LKZ2024004).

Data Availability

The data analyzed in this study are not publicly available but available from the corresponding author upon reasonable request.

Ethics Approval and Consent to Participate

This study was approved by the Ethics Committee of the Geriatric Hospital of Nanjing Medical University (Ethic number: 2022022). All participants provided study protocol and granted informed consent. This study was performed in accordance with the guidelines outlined in the Declaration of Helsinki.

References

Zhang

, Chen

, Hou

, et al. Prevalence and risk factors governing the loss of muscle function in elderly sarcopenia patients: A longitudinal study in China with 4 years of follow-Up. J Nutr Health Aging, 2020; 24(5):518–524; doi: 10.1007/s12603-020-1361-0

Abe

, Inao

, Shingu

, et al. Associations of sarcopenia and malnutrition with 30-day in-hospital morbidity and mortality after cardiac surgery. Eur J Cardiothorac Surg, 2024; 67(1):ezae456; doi: 10.1093/ejcts/ezae456

Delbari

, Azimi

, Pakmehr

, et al. Association of Obesity, Sarcopenia, and Functional Mobility with Risk of Fall: A Cross-Sectional Study from Ardakan Cohort Study on Aging (ACSA). Med J Islam Repub Iran, 2024; 38:114; doi: 10.47176/mjiri.38.114

Ishimoto

, Mutsuzaki

, Shimizu

, et al. Association between Sarcopenia and Balance in Patients Undergoing Inpatient Rehabilitation after Hip Fractures: A Retrospective Cohort Study. Medicina (Kaunas), 2024; 60(5):742; doi: 10.3390/medicina60050742

Wen

, Chen

, Luo

, et al. Association between sarcopenia grade and fall history among older adults in West China: A retrospective study. BMJ Open, 2024; 14(2):e080426; doi: 10.1136/bmjopen-2023-080426

Sarto

, Franchi

, McPhee

, et al. Neuromuscular impairment at different stages of human sarcopenia. J Cachexia Sarcopenia Muscle, 2024; 15(5):1797–1810; doi: 10.1002/jcsm.13531

Hashemolhosseini

, Gessler

. Crosstalk among canonical Wnt and Hippo pathway members in skeletal muscle and at the neuromuscular junction. Neural Regen Res, 2025; 20(9):2464–2479; doi: 10.4103/NRR.NRR-D-24-00417

Petrov

, Lenina

, Leroy

, et al. An alpha7 nicotinic and GABA(B) receptor-mediated pathway controls acetylcholine release in the tripartite neuromuscular junction. J Physiol, 2025; 603(2):507–527; doi: 10.1113/JP287243

Yasuda

, Uzawa

, Onishi

, et al. Elevated serum levels of C-terminal agrin fragment in acetylcholine receptor antibody-positive myasthenia gravis. J Neuroimmunol, 2024; 396:578455; doi: 10.1016/j.jneuroim.2024.578455

10.

Stiegler

, Burden

, Hubbard

. Crystal structure of the agrin-responsive immunoglobulin-like domains 1 and 2 of the receptor tyrosine kinase MuSK. J Mol Biol, 2006; 364(3):424–433; doi: 10.1016/j.jmb.2006.09.019

11.

, Xu

, Si

, et al. Role of Agrin in tissue repair and regeneration: From mechanisms to therapeutic opportunities (Review). Int J Mol Med, 2024; 54(5):98; doi: 10.3892/ijmm.2024.5422

12.

Naniwa

, Nishida

, Yoshida

, et al. LRP4 and Agrin Are Modulated by Cartilage Degeneration and Involved in beta-Catenin Signaling in Human Articular Chondrocytes. Int J Mol Sci, 2025; 26(3):1007; doi: 10.3390/ijms26031007

13.

Oury

, Gamallo-Lana

, Santana

, et al. Agonist antibody to MuSK protects mice from MuSK myasthenia gravis. Proc Natl Acad Sci U S A, 2024; 121(39):e2408324121; doi: 10.1073/pnas.2408324121

14.

, Zhang

, Chiu

, et al. Conditional inactivation of Nf1 and Pten in Schwann cells results in abnormal neuromuscular junction maturation. G3 (Bethesda), 2019; 9(1):297–303; doi: 10.1534/g3.118.200795

15.

Brockhausen

, Cole

, Gervasio

, et al. Neural agrin increases postsynaptic ACh receptor packing by elevating rapsyn protein at the mouse neuromuscular synapse. Dev Neurobiol, 2008; 68(9):1153–1169; doi: 10.1002/dneu.20654

16.

Meinen

, Lin

, Thurnherr

, et al. Apoptosis inhibitors and mini-agrin have additive benefits in congenital muscular dystrophy mice. EMBO Mol Med, 2011; 3(8):465–479; doi: 10.1002/emmm.201100151

17.

Pratt

, Motanova

, Pessanha

, et al. Plasma C-terminal agrin fragment concentrations across adulthood: Reference values and associations with skeletal muscle health. J Cachexia Sarcopenia Muscle, 2024; 15(4):1501–1510; doi: 10.1002/jcsm.13507

18.

Sun

, Wang

, Gong

, et al. Secretion of rat tracheal epithelial cells induces mesenchymal stem cells to differentiate into epithelial cells. Cell Biol Int, 2012; 36(2):169–175; doi: 10.1042/cbi20110121

19.

Qaisar

, Khan

, Karim

, et al. Lipid-Lowering medications are associated with reduced sarcopenia-related quality of life in older adults with hyperlipidemia. Drugs Aging, 2024; 41(5):443–453; doi: 10.1007/s40266-024-01111-2

20.

Ham

, Lin

, Tse

, et al. Single-nuclei sequencing of skeletal muscle reveals subsynaptic-specific transcripts involved in neuromuscular junction maintenance. Nat Commun, 2025; 16(1):2220; doi: 10.1038/s41467-025-57487-1

21.

Kumar

, Nayak

, Umakanth

, et al. Effect of targeted intervention on C-terminal agrin fragment and its association with the components of sarcopenia: A scoping review. Aging Clin Exp Res, 2023; 35(6):1161–1186; doi: 10.1007/s40520-023-02396-w

22.

Monti

, Sarto

, Sartori

, et al. C-terminal agrin fragment as a biomarker of muscle wasting and weakness: A narrative review. J Cachexia Sarcopenia Muscle, 2023; 14(2):730–744; doi: 10.1002/jcsm.13189

23.

Cacciatore

, Calvani

, Esposito

, et al. Emerging targets and treatments for sarcopenia: A narrative review. Nutrients, 2024; 16(19):3271; doi: 10.3390/nu16193271

24.

Das

, Hilman

, Yang

, et al. Motor neurons and endothelial cells additively promote development and fusion of human iPSC-derived skeletal myocytes. Skelet Muscle, 2024; 14(1):5; doi: 10.1186/s13395-024-00336-4

25.

Xing

, Xiong

, Mei

. Rapsyn as a signaling and scaffolding molecule in neuromuscular junction formation and maintenance. Neurosci Lett, 2020; 731:135013; doi: 10.1016/j.neulet.2020.135013

26.

Bassat

, Mutlak

, Genzelinakh

, et al. The extracellular matrix protein agrin promotes heart regeneration in mice. Nature, 2017; 547(7662):179–184; doi: 10.1038/nature22978

27.

Pribiag

, Peng

, Shah

, et al. Dystroglycan mediates homeostatic synaptic plasticity at GABAergic synapses. Proc Natl Acad Sci U S A, 2014; 111(18):6810–6815; doi: 10.1073/pnas.1321774111

28.

Okuma

, Hord

, Chandel

, et al. N-terminal domain on dystroglycan enables LARGE1 to extend matriglycan on alpha-dystroglycan and prevents muscular dystrophy. Elife, 2023; 12:e82811; doi: 10.7554/eLife.82811

29.

Vannoy

, Zhou

, Qiao

, et al. Adeno-Associated virus-mediated mini-agrin delivery is unable to rescue disease phenotype in a mouse model of limb girdle muscular dystrophy type 2I. Am J Pathol, 2017; 187(2):431–440; doi: 10.1016/j.ajpath.2016.09.024