Mechanistic studies on the role of TGF-β1 in angiogenesis through EndMT

Abstract

Objective

This study aims to investigate the mechanism of transforming growth factor-β1 (TGF-β1) in promoting angiogenesis through endothelial-to-mesenchymal transition (EndMT).

Methods

The mesenchymal transition of human umbilical vein endothelial cells (HUVECs) was induced by TGF-β1. The angiogenesis, migration, and proliferation of HUVECs undergoing EndMT were examined by tube formation assay, scratch assay, Transwell assay, and CCK-8 assay.

Results

The outcomes revealed that EndMT promoted angiogenesis, migration, and proliferation of HUVECs and the secretion of the vascular endothelial growth factor (VEGF) of HUVECs. Phosphorylated AKT (p-AKT) increased in EndMT by inhibiting the mitigation of angiogenesis.

Conclusion

EndMT induces angiogenesis by promoting the secretion of VEGF, and p-AKT participates in this regulation.

Keywords

Endothelial-to-mesenchymal transition vascular endothelial cell growth factor umbilical vein endothelial cells angiogenesis mechanism research

Introduction

Endothelial-to-mesenchymal transition (EndMT) refers to the loss of some characteristics of endothelial cells, such as anticoagulation,¹ and the acquisition of some phenotypes of mesenchymal cells, resulting in a series of morphological and functional changes under some pathological conditions.² Endothelial cells that undergo EndMT have irregular morphology, loosened intercellular connections, increased cellular activity, and increased secretion of collagen and extracellular matrix.³ EndMT is mainly found in the cardiovascular system and results in intimal hyperplasia and vascular sclerosis, although its role in angiogenesis remains unclear. Transforming growth factor-β1 (TGF-β1) and TGF-β/Smad signaling are the most important molecular and signaling pathways in inducing EndMT.

Angiogenesis is involved in a series of pathological changes, such as the repair of damaged tissue, invasion and metastasis of tumors, and formation of atherosclerotic plaques.⁴,⁵ During the process of tissue repair, neovascularization brings immune cells to the injured site and provides nutrients that are necessary for tissue repair. On the other hand, angiogenesis is correlated to the instability of atherosclerotic plaques. The rupture of the neovasculature may result in serious complications, such as intra-plaque hemorrhage and plaque rupture. The differentiation and proliferation of endothelial cells in local vascular injury remains as the basis of neovascularization. Vascular endothelial growth factor (VEGF) is the most powerful factor regulating angiogenesis.⁶ Local endothelial cells are prone to developing interstitial changes stimulated by pathological factors, such as inflammation, disturbed flow, ischemia, and hypoxia.

At present, the relationship between EndMT and angiogenesis and its specific mechanism remains unclear. Thus, the present study aims to further explore the specific mechanism of EndMT in promoting angiogenesis through in vitro experiments. We propose that TGF-β1 promotes angiogenesis through EndMT.

Materials and methods

Cells, main apparatus, and agents

Primary human umbilical vein endothelial cells (HVUECs; PCS-100–010, ATCC, USA) were purchased from the American Type Culture Collection (ATCC). The ingredients of the endothelial cell-specific medium (PCS-100–030, ATCC, USA) were as follows: glutamine, primary fetal bovine serum, epidermal growth factor, vascular endothelial growth factor, fibroblast growth factor, insulin-like growth factor, hydrocortisone, heparin, and vitamin C. Cells were cultured in an incubator at 37°C with 5% CO₂. Then, cells were digested by trypsin (0.25%) and sub-cultured once, up to a confluence of 80–90%. Transforming growth factor β1 (TGF-β1; 100–21, PeproTech, USA) was purchased from PeproTech. Before being stimulated by TGF-β1, cells were starvation cultured with a medium containing 1% serum for 12 h. This was then changed to the normal medium and stimulated with different concentrations of TGF-β1 for 48 h. Afterward, the cellular morphology was observed, the cell function tests were assayed, and the RNA and protein were extracted for further detection. The present study was approved by the Ethics Committee of our hospital.

Cellular RNA detection

Total RNA was extracted according to the instructions of the RNA extraction kit (Tiangen). RNA quantification was performed using a NanoDrop 2000 spectrometer (Thermo Scientific, USA). One µg of RNA was retrieved and reverse transcribed into cDNA using a reverse transcription kit (G490, abm, Canada). The cellular RNA was amplified on the real-time fluorescence quantitative polymerase chain reaction (PCR) (LightCycler 480 Roche, Switzerland) using an SYBR Green mixture kit (Roche Switzerland) and through quantitative real-time PCR (qPCR) with GAPDH as the internal reference. The results were analyzed using the 2^−△△CT method. The sequences of the primers are listed in Table 1.

Table 1.

qPCR primer sequence.

Gene	Forward (5′-3′)	Reverse (5′-3′)
VE-cadherin	TTGGAACCAGATGCACATTGAT	TCTTGCGACTCACGCTTGAC
CD31	AACAGTGTTGACATGAAGAGCC	TGTAAAACAGCACGTCATCCTT
VWF	CCGATGCAGCCTTTTCGGA	TCCCCAAGATACACGGAGAGG
α-sma	AAAAGACAGCTACGTGGGT GA	GCCATGTTCTATCGGGTACT TC
FSP-1	GATGAGCAACTTGGACAGCAA	CTGGGCTGCTTATCTGGGAAG
VEGF	GAGGAGCAGTTACGGTCTGTG	TCCTTTCCTTAGCTGACACTTGT
VEGFR-2	GGCCCAATAATCAGAGTGGCA	CCAGTGTCATTTCCGATCACTTT

Reaction system: 10 μL.

PCR water: 3 μL

2×Power SYBR® Green PCR Master Mix: 5 μL

10 μmol/L Primer1: 0.5 μL (0.1–0.5 μM)

10 μmol/L Primer2: 0.5 μL (0.1–0.5 μM)

Sample cDNA: 1 μL (50 ng–1μg)

Total volume: 10 μL

Amplification conditions: ① 95°C 2 min; ② 95°C 30 s; ③ 60°C 30 s; ④ 72°C 1min; ⑤ go to② 30 cycles.

Western blot analysis

Cellular protein was extracted using RIPA (1% Triton X-100, 1% deoxycholate, 0.1% SDS, 10 mM of Tris, and 150 mM of sodium chloride) and cleaved using a mixture of phosphatase and protease inhibitors (Santa Cruz Biotechnology Inc., Heidelberg, Germany). A bicinchoninic acid (BCA) kit (Beyotime, China) was used to perform the quantification of the supernatant. After the detection of the protein concentration, boiling denaturation was performed by adding a sample buffer containing beta-mercaptoethanol. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed using 30 μg of the protein from each sample. Then, 80 V of constant voltage was used to perform the transmembrane for 120 min, and the protein was translocated from the gel to the nitrocellulose (NC) membrane. Sealing was performed with TBST containing 5% skimmed milk powder. The α-smooth muscle actin (α-SMA; 1:500, BM0002, Boster, China), platelet and endothelial cell adhesion molecule-1 (PECAM-1, CD31; 1:200, 134168, Abcam, USA), Smad3 (1:200, BM3919, Boster, China), p-Smad3 (1:200, BM4033, Boster, China), and von Willebrand factor VWF (1 μg/mL 6994, Abcam, USA) were added and incubated at 4°C overnight. The secondary antibody was added and incubated at room temperature for 1 h. Fluorescence detection was performed using an Odyssey fluorescence detector (LI-COR Biosciences, USA). The images were quantified using ImageJ and adjusted using GAPDH as the internal reference. The phosphorylation level was expressed by the ratio of the expression of phosphorylated protein to that of the total protein.

Tube formation test

The pre-cooled and melted Matrigel glue (BD Biosciences, USA) and basic culture medium were diluted at a 1:4 ratio in advance. The evenly diluted Matrigel glue was then added into the 24-well plate according to a dilution of 200 µL/hole, and the culture plate was gelled at 37°C for 2 h.

Cells were digested by trypsin (0.25%). After centrifugation, trypsin and the culture medium were removed. Phosphate buffered saline (PBS) was used to re-suspend the cells. After the second centrifugation, these cells were re-suspended in a serum-free culture medium. The cell concentration was adjusted to 2 × 10⁶/mL after cell counting.

The Matrigel glue in each hole was added with 1 × 10⁶ cells, and the culture plate was incubated in an incubator at a constant temperature of 37°C for 24 h with 5% CO₂.

On the second day, the culture plate was placed under an inverted microscope to observe the growth of cells. Three visual fields were randomly selected, photos were taken under a low power microscope, and the number of newly formed tubes was analyzed.

Cell counting kit-8 cell proliferation assay

Cells were digested by trypsin. After centrifugation, trypsin and the culture medium were removed, and PBS was used to re-suspend the cells. After the second centrifugation, these cells were re-suspended in a serum-free basic culture medium. The cell concentration was adjusted to 5 × 10⁴/mL after cell counting.

The cell suspension was added into a 96-well plate with 100 µL/hole, respectively, and incubated in an incubator at a constant temperature of 37°C for 24 h with 5% CO₂.

In the 96-well plate, 10 µL of cell counting kit-8 (CCK-8) solution (Dojindo, Japan) was added into each hole, and care was taken to avoid the formation of bubbles. The replicate holes and blank control were set at the same time.

The 96-well plates were incubated in an incubator at a constant temperature of 37°C for 24 h with 5% CO_2., and the optical density values were measured after 24 h, 48 h, and 72 h, respectively.

Migration assay

In the 6-well plate, 3 × 10⁵ cells were inoculated into each hole, and three biological replicates were observed in each group. When the cells achieved a confluence of 95%, the sterilized tip of a 20-µL pipet was used to scratch the bottom of the plate and produce a “+” shaped score.

After discarding the culture medium, the plate was washed twice with PBS, and a serum-free culture medium was added. Then, the scratches were observed, photographed under an inverted microscope, and regarded as the 0 hours score.

Cell migration was observed and photographed under an inverted microscope after incubation for 0, 6, and 24 h in an incubator at a constant temperature of 37°C with 5% CO₂.

Transwell invasion assay

The Matrigel matrix glue (BD Biosciences, USA) was fully melted in a refrigerator at 4°C, the pipet tip and Transwell plate were pre-cooled, and all experimental operations were carried out on an icebox.

The Matrigel matrix gel and serum-free medium were diluted at a ratio of 1:8. The bottom of each Transwell chamber was evenly spread with 45 µL of the above-diluted solution to avoid the formation of bubbles. Gelation was achieved by incubating at a constant temperature of 37°C with 5% CO₂ for 30 min.

The Transwell plate was taken out of the incubator, and 100 µL of a serum-free medium was added for hydration.

The cell suspension was prepared, and the cell concentration was adjusted to 1 × 10⁵/mL. Then, 100 µL of the cell suspension was added to the Transwell chamber, and three biological replicates were performed for each group.

A complete medium containing 10% fetal bovine serum (FBS) was added to the bottom of the 24-well plate and incubated at a constant temperature of 37°C with 5% CO₂ for 24 h.

A cotton swab was used to carefully wipe the matrix glue, cells, and culture medium in the upper layer of a compartment of the Transwell. The compartment was then placed in 4% paraformaldehyde (PFA) for 10 min to achieve fixation and washed three times with PBS.

After staining with crystal violet dye for 5 min, the plate was washed 2–3 times with PBS, then observed and photographed under an inverted microscope. The ImageJ and GraphPad Prism software were used to count the number of cells that invaded the bottom of the chamber.

ELISA

The ELISA Kit was purchased from Abcam Company (ab222510 UK). Briefly, 40 μL of cell supernatant was added to 360 μL of dilution buffer and incubated with biotinylated detection antibody and HRP conjugate. After being incubated with substrate reagent for 15 min, the color intensity was measured at 450 nm according to the manufacturer’s instructions.

Statistic analysis

The SPSS 20.0 software was used for the statistical analysis of the data. Measurement data were expressed as mean ± standard deviation (x * SD), and counting data were expressed by percentages (%). The W-test was used for the normality test, and the F-test was used for the homogeneity test. One-way analysis of variance (ANOVA) was used for the comparison among groups, and the least significant difference was used for the post hoc analysis. A nonparametric test was performed to compare the mean of multiple samples that did not conform to the normal distribution or those that conformed to the normal distribution but had uneven variances. A Chi-square test was used for counting data. P < 0.05 was considered statistically significant.

Results

TGF-β1 promotes EndMT in HUVECs

Human umbilical vein endothelial cells (HUVECs) are the most common cell lines in EndMT studies,⁷ and TGF-β1 is the most important factor that causes endothelial cell interstitial changes,⁷ so we used TGF-β1-stimulated HUVECs to induce interstitial changes in vitro.

The cellular morphological changes were as follows: normal HUVECs were shaped like a paved stone, with a regular distribution and tight connection under the observation of the inverted microscope. After stimulation by TGF-β1, these cells were irregularly arranged, became slender, and had more antennae. Furthermore, smooth muscle-like cells could be seen with loose intercellular connections (Figure 1(a)).

Figure 1.

Interstitial changes of HUVECs induced by TGF-β1. (a) Cellular morphological changes after TGF-β1 stimulation (Bar = 50 μm). (b) Changes in phosphorylated Smad-3 after stimulation at different concentrations of TGF-β1. (C) Changes in the expression of CD31, VWF, and α-SMA at the RNA level after TGF-β1 stimulation by qPCR analysis. The results represent three independent tests. (d) Changes in the expression of CD31, VWF, and α-SMA at the protein level after TGF-β1 stimulation by western blot analysis. The statistical values from three independent tests are presented on the right side. *P < 0.05, **P < 0.01.

It has been reported that p-Smad3 is an indicator of TGF/Smad signaling activity.⁸ Western blot analysis was used to detect the changes in p-Smad3 induced by different concentrations of TGF-β1. The results revealed that p-Smad3 significantly increased when the concentration of TGF-β1 was 10 ng/mL (Figure 1(b)).

During EndMT, EC special markers such as CD31 and VWF downregulated; however, mesenchymal cell markers such as α-SMA upregulated.⁹ To verify the interstitial change of HUVECs, we detected cell markers in RNA and protein level by quantitative PCR (qPCR) and Western blot. The results revealed that the expression of CD31 and VWF decreased, while the expression of α-SMA increased. These results indicated the occurrence of interstitial changes in HUVECs (Figure 1(c) and (d)).

TGF-β1 promotes angiogenesis through EndMT

Angiogenesis

HUVECs can divide and proliferate in the matrix gel to form striped capillaries, which are ring-shaped in the cross-section under a microscope.¹⁰ Standard HUVECs and HUVECs stimulated by TGF-β1 with the same number of cells were implanted in the matrix gel. The results revealed that there were more rings in the matrix glue of HUVECs stimulated by TGF-β1, suggesting that HUVECs with TGF-β1 can produce more capillaries. Thus, this indicates that HUVECs with interstitial changes can produce more capillaries (Figure 2(a)).

Figure 2.

Effects of TGF-β1 on endothelial function. (a) The tube formation test to detect the angiogenesis function of endothelial cells. The ring was the cross-section of blood vessels that were formed by endothelial cells. The statistical values from three independent tests are presented on the right side. (Bar = 200 μm). (b) The scratch test was performed to detect the migration function of endothelial cells. Those between the green lines were the scratched site. The statistical values of the migration distance at different time points are presented on the right. (c) The Transwell test was performed to detect the invasion function of endothelial cells. Cells in purple were those that migrated into the lower chamber. The statistical values obtained from three independent tests are presented on the right side. (d) The CCK-8 assay was performed to detect the proliferation activity of endothelial cells. *P < 0.05, **P < 0.01, ***P < 0.001.

Changes in cellular migration

The cellular migration distance was observed at 0, 6, and 24 h through a scratch test. The results revealed that the ability of migration increased after TGF-β1 stimulation (Figure 2(b)). Meanwhile, the Transwell experiment also confirmed that more HUVECs migrated to the lower chamber after stimulation by TGF-β1 (Figure 2(c)).

Cellular proliferation test

In order to investigate the effect of interstitial changes on cell proliferation, CCK-8 was used to detect the change in cell proliferation. The results revealed that after adding the CCK-8 reagent, HUVECs stimulated by TGF-β1 had a stronger absorption value at 490 nm (Figure 2(d)).

Inhibition EndMT reduce angiogenesis induced by TGF-β1

To find the role of EndMT in angiogenesis induced by TGF-β1, we used oxymatrine (TGF/Smad signaling inhibitor) to inhibit EndMT. Through qPCR and Western blot, we found that after adding oxymatrine, the upregulation of α-SMA and downregulation of CD31 induced by TGF-β1 disappeared, suggesting oxymatrine can suppress EndMT induced by TGF-β1 (Figure 3(a)). Then we detected the angiogenesis function of HUVECs, and results showed that the rings in the matrix glue were significantly reduced after the addition of oxymatrine. Those results suggest that TGF-β1 promotes angiogenesis through EndMT (Figure 3(b)).

Figure 3.

Effects of EndMT on angiogenesis. (a) Changes in the expression of CD31 and α-SMA at the protein level were detected by western blot. The statistical values obtained from three independent tests are presented on the right side. (b) The tube formation test to detect the angiogenesis function of endothelial cells. The ring was the cross-section of blood vessels that were formed by endothelial cells. The statistical values from three independent tests are presented on the right side. (Bar = 200 μm). *P < 0.05, **P < 0.01.

Promotion of angiogenesis by TGF-β1 via promoting the secretion of VEGF

VEGF is a highly specific factor that promotes the growth of endothelial cells. VEGF promotes angiogenesis by increasing the permeability of the vascular wall, promoting the dissolution of the extracellular matrix, and inducing the migration and proliferation of vascular endothelial cells.⁶ We detected the RNA expression of VEGF and VEGF-R2 through qPCR and the concentration of VEGF in cell supernatant through ELISA. The results revealed that after stimulation by TGF-β1, the expression of VEGF and VEGF-R2 in HUVECs increased (Figure 4(a) and (b)). Since VEGF is regarded as the most important factor for angiogenesis, it was proposed that TGF-β1 can induce angiogenesis by promoting the secretion of VEGF. Moreover, inhibiting EndMT by oxymatrine can reduce the expression of VEGF and VEGF-R2.

Figure 4.

The mechanism of EndMT in promoting angiogenesis. (a) Changes in the expression of VEGF and VEGF-R at the RNA level were detected by qPCR. (b) The expression of VEGF in cell supernatant concentration was detected by ELISA. (c) Changes in AKT phosphorylation by western blot analysis. The HY15186-p-AKT inhibitor. The statistical values from three independent tests are presented on the right side. (D) The tube formation test. The figure on the right side presents the statistical values of the ring-forming statistics in three independent tests. *P < 0.05, **P < 0.01.

AKT is a serine/threonine protein kinase. Activated AKT regulates cell function by phosphorylating downstream factors, such as enzymes, kinases, and transcription factors, such as glucose metabolism, apoptosis, cell proliferation, transcription, and cell migration. The Western blot results revealed that the expression of phosphorylated AKT (p-AKT) in HUVECs significantly increased after TGF-β1 stimulation (Figure 4(c)). Furthermore, after adding the AKT phosphorylation inhibitor HY15186, the function of angiogenesis induced by TGF-β1 significantly decreased (Figure 4(d)). Thus, these indicate that AKT phosphorylation might be involved in the process of angiogenesis promotion by TGF-β1.

Discussion

The present study explored the mechanism of TGF-β1 in promoting angiogenesis through EndMT. These results revealed that TGF-β1 could improve the function of endothelial cells in angiogenesis, migration, and proliferation and promote the secretion of VEGF through EndMT. The phosphorylation of AKT takes part in this process.

EndMT-related diseases

The phenomena of EndMT were first reported by Camenisch et al.¹¹ in 2002. Some changes in endothelial cells in the endocardium were observed during embryonic development. These cells gradually acquired the characteristics of stromal cells and invaded the sub-endometrium, which participated in the formation of the interventricular septum and valves. EndMT was confirmed in the cardiac fibrosis induced by hypertension and the renal fibrosis induced by urinary tract obstruction in mice by endothelial cell tracing. Furthermore, EndMT was the main pathological change that caused fibrosis. In addition, most of the fibroblasts in the lesion were transformed from endothelial cells via EndMT.¹²,¹³ EndMT plays an important role in many diseases, such as organ fibrosis, the invasion and metastasis of tumors, and vascular malformations.^14–17 EndMT can be induced in a variety of pathological conditions, such as chronic inflammation, disturbed flow, and hypoxia.^14,18–20 However, the role of EndMT in angiogenesis has not been reported. Our results suggest the angiogenesis function of ECs upregulated after EndMT induced by TGF-β1.

Process of angiogenesis

Angiogenesis comprises the processes of germination, migration, and subsequent vascular remodeling of endothelial cells under the effects of various cytokines. Two main sources of endothelial cells participate in neovascularization. One is the division and proliferation of mature endothelial cells that surround the injury to form angiogenesis, while the other is the differentiation of endothelial progenitor cells into mature endothelial cells at the injured site to form the angiogenesis. Either the endothelial cells or the endothelial progenitor cells can undergo interstitial changes stimulated by inflammatory factors.²¹ The results of these present experiments confirm that the endothelial cell proliferation, migration, and angiogenesis function with interstitial changes were all enhanced. These functional changes play a role in promoting tissue repair during the recovery of injured tissue. However, in tumors, atherosclerosis and other diseases, excessive neovascularization might promote the growth, infiltration, and metastasis of tumors, and promote the rupture of atherosclerotic plaques. In this study, we have not compared the neovascularization between normal ECs and ECs with EndMT. The tight junction between ECs after EndMT was destroyed, the function of the cell barrier was damaged, and the permeability of the blood vessel increased. Therefore, it was speculated that the structure and function of neovascularization formed by endothelial cells after EndMT might be different from that of the normal neovasculature. These differences need to be studied further.

Promotion of angiogenesis by EndMT by increasing the secretion of VEGF

VEGF is the most important factor in promoting angiogenesis. It plays a critical role in the migration and chemotaxis of endothelial cells. The results of the present study revealed that the expression of VEGF and VEGF-R2 increased after the occurrence of interstitial changes in endothelial cells, suggesting that EndMT can regulate angiogenesis by promoting the secretion of VEGF. Protein phosphorylation is a fundamental approach to regulating cell function. AKT phosphorylation participates in many signaling pathways, such as PI3K/AKT, promotes cell growth and inhibits cell apoptosis. Furthermore, it is closely correlated to proliferative diseases, such as cancer and chronic inflammation. It was found that the expression of p-AKT increased after the occurrence of interstitial changes of endothelial cells, and the effect of promoting angiogenesis disappeared after inhibiting the phosphorylation of AKT. Thus, this suggests that AKT phosphorylation might be involved in the process of angiogenesis, which is promoted by EndMT.

It was confirmed in the present study that EndMT might promote angiogenesis by increasing the secretion of VEGF and that angiogenesis participates in a variety of pathophysiological processes, which provides a new approach to treat related diseases. However, there were some limitations in the present study. First, the present study is an in vitro experiment. The role of EndMT in promoting angiogenesis still needs further studies in vivo. Second, further studies regarding the detailed mechanism of EndMT in increasing VEGF are still needed.

In summary, these present results suggest that TGF-β1 induce angiogenesis through EndMT by promoting the secretion of VEGF, and the phosphorylation of AKT participates in this process.

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

Xiao-Qiang Li

References

Hong

You

, et al. Reciprocal enhancement of thrombosis by endothelial-to-mesenchymal transition induced by iliac vein compression. Life Sci 2019; 233: 116659.

Medici

Kalluri

Endothelial–mesenchymal transition and its contribution to the emergence of stem cell phenotype. Semin Cancer Biol 2012; 22: 379–384.

Songia

Branchetti

Parolari

, et al. Mitral valve endothelial cells secrete osteoprotegerin during endothelial mesenchymal transition. J Mol Cell Cardiol 2016; 98: 48–57.

Parma

Baganha

Quax

PHA

, et al. Plaque angiogenesis and intraplaque hemorrhage in atherosclerosis. Eur J Pharmacol 2017; 816: 107–115.

Viallard

Larrivée

Tumor angiogenesis and vascular normalization: alternative therapeutic targets. Angiogenesis 2017; 20: 409–426.

Ferrara

VEGF-A: a critical regulator of blood vessel growth. Eur Cytokine Netw 2009; 20: 158–163.

Evrard

Lecce

Michelis

, et al. Endothelial to mesenchymal transition is common in atherosclerotic lesions and is associated with plaque instability. Nat Commun 2016; 7: 11853.

Xie

Ostriker

Jin

, et al. LMO7 is a negative feedback regulator of transforming growth factor β signaling and fibrosis. Circulation 2019; 139: 679–693.

Stenmark

Frid

Perros

Endothelial-to-mesenchymal transition: an evolving paradigm and a promising therapeutic target in PAH. Circulation 2016; 133: 1734–1737.

10.

Liu

You

, et al. Semaphorin 7A promotes VEGFA/VEGFR2-mediated angiogenesis and intraplaque neovascularization in ApoE–/– Mice. Front Physiol 2018; 9: 1718.

11.

Camenisch

Schroeder

Bradley

, et al. Heart-valve mesenchyme formation is dependent on hyaluronan-augmented activation of ErbB2–ErbB3 receptors. Nat Med 2002; 8: 850–855.

12.

Zeisberg

Tarnavski

Zeisberg

, et al. Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat Med 2007; 13: 952–961.

13.

Zeisberg

Potenta

Sugimoto

, et al. Fibroblasts in kidney fibrosis emerge via endothelial-to-mesenchymal transition. J Am Soc Nephrol 2008; 19: 2282–2287.

14.

Zhang

Fang

, et al. Endothelial cells promote triple-negative breast cancer cell metastasisvia PAI-1 and CCL5 signaling. FASEB J 2018; 32: 276–288.

15.

Nakaya

Watari

Tajima

, et al. Cardiac myofibroblast engulfment of dead cells facilitates recovery after myocardial infarction. J Clin Invest 2017; 127: 383–401.

16.

Manetti

Romano

Rosa

, et al. Endothelial-to-mesenchymal transition contributes to endothelial dysfunction and dermal fibrosis in systemic sclerosis. Ann Rheum Dis 2017; 76: 924–934.

17.

Zhou

Tang

Wong

, et al. Cerebral cavernous malformations arise from endothelial gain of MEKK3–KLF2/4 signalling. Nature 2016; 532: 122–126.

18.

Piera-Velazquez

Jimenez

SA.

Endothelial to mesenchymal transition: role in physiology and in the pathogenesis of human diseases. Physiol Rev 2019; 99: 1281–1324.

19.

Mina

Huang

Murray

, et al. The role of shear stress and altered tissue properties on endothelial to mesenchymal transformation and tumor-endothelial cell interaction. Biomicrofluidics 2017; 11: 044104.

20.

Choi

Hong

Nam

, et al. A hypoxia-induced vascular endothelial-to-mesenchymal transition in development of radiation-induced pulmonary fibrosis. Clin Cancer Res 2015; 21: 3716–3726.

21.

Zhang

Zhou

, et al. Activated phosphatidylinositol 3-kinase/Akt inhibits the transition of endothelial progenitor cells to mesenchymal cells by regulating the forkhead box subgroup O-3a signaling. Cell Physiol Biochem 2015; 35: 1643–1653.