Curcumin improves atherosclerosis by inhibiting the epigenetic repression of lncRNA MIAT to miR-124

Abstract

Objectives: Atherosclerosis is a dominant cardiovascular disease. Curcumin has protective effect on atherosclerosis. However, the mechanisms remain to be explored.

Methods: Atherosclerosis was induced by feeding mice with high-fat diet (HFD) and ox-low-density lipoprotein (LDL)-induced human umbilical vein endothelial cells (HUVECs) were structured. Oil Red O staining was used to evaluate the plaques in the artery. Quantitative real-time PCR (qRT-PCR) was conducted to detect the level of myocardial infarction associated transcript (MIAT), miR-124, and enhancer of zeste homolog 2 (EZH2). We performed western blotting and enzyme linked immunosorbent assay to examine the expression of EZH2 and cytokines including IL-1β, TNFα, IL-6, and IL-8, respectively. RNA immunoprecipitation and chromatin immunoprecipitation (ChIP) were used to validate the interaction between myocardial infarction associated transcript and EZH2. Flow cytometry and CCK-8 assay were used to examine cell apoptosis and proliferation, respectively.

Results: Curcumin suppressed inflammation in atherosclerosis mouse model and ox-LDL-induced cell model. MIAT overexpression and miR-124 inhibition relieved the anti-inflammation effect of curcumin in ox-LDL-induced cell. MIAT regulated miR-124 by interacting with EZH2. Curcumin relieved ox-LDL-induced cell inflammation via regulating MIAT/miR-124 pathway. Conclusion: MIAT/miR-124 axis mediated the effect of curcumin on atherosclerosis and altered cell apoptosis and proliferation, both in vivo and in vitro. These data further support the application of curcumin in control of atherosclerosis advancement.

Keywords

Atherosclerosis curcumin EZH2 MIAT miR-124

Introduction

Atherosclerosis is a type of inflammatory disease which is symbolized by disorder of lipid metabolism, chronic inflammation, and atherosclerotic plaque development.¹ Atherosclerosis is becoming a major burden for global health and may lead to many cardiovascular, cerebrovascular, and peripheral vascular diseases. More than 10% of the world population are affected by atherosclerosis.² The level of LDL is elevated in atherosclerosis and can be well managed by statins and proprotein convertase subtilisin/kexin type 9 (PCSK9) inhibitors.³ However, the control of LDL cholesterol could not rule out the risk of major adverse cardiovascular events (MACE) completely and other treatment method like canakinumab leads to an increase of lethal infections.⁴ Novel therapies for atherosclerosis with desirable efficacy and safety profile are still needed.

As the active ingredient of turmeric,⁵ curcumin has been widely utilized in the treatment of human diseases like cancer, inflammatory disease, or cardiovascular disease.⁶ In the treatment of atherosclerosis, curcumin is demonstrated to suppress the progression.⁷ As reported, curcumin regulated the inflammation response in macrophage.⁸ However, the detailed molecular mechanisms involved in the benefits of curcumin in atherosclerosis are far from well established.

Long non-coding RNA (LncRNA) is a kind of non-coding RNA with pivotal roles in multiple human diseases, including atherosclerosis.⁹ Dozens of lncRNAs have been demonstrated involved in the atherothrombotic disease, like GAS5,¹⁰ KCNQ1OT1,¹¹ and MALAT1.¹² MIAT has been revealed to have aberrant expression in multiple diseases, including myocardial infarction,¹³ schizophrenia,¹⁴ ischemic stroke,¹⁵ and cancers.¹⁶ In the milieu of atherosclerosis, overexpression of MIAT has been shown to be associated with the aggravation of atherosclerosis.^16,17 Multiple pathways are reported to participate atherosclerosis including miRNAs,¹⁶ PI3K/Akt signaling,¹⁷ and miR-181b/STAT3.¹⁸ However, more detailed mechanisms of MIAT regulation in atherosclerosis are still not well elaborated.

In the current study, we found that curcumin alleviated the inflammation response in both mouse model and cell lines through suppressing MIAT. Furthermore, MIAT could bind to EZH2 and therefore regulated the expression of miR-124. Our results revealed a novel mechanism mediating the protective effects of curcumin in the progression of atherosclerosis, which may shed light on potential therapeutic options.

Methods

Atherosclerosis animal model

15 8-week-old ApoE^−/− C57BL/6 male mice were obtained from SJA Laboratory Animal Co., LTD (Changsha, China). The mice were randomly assigned to three groups (n = 5), treated with normal diet, high-fat diet, and HFD +curcumin, respectively. Mice were fed with ND or HFD containing 21.2% fat (1.5% cholesterol) and 16.7% protein for 16 weeks. Phosphate buffer saline (PBS) or 30 mg/kg curcumin were administered intraperitoneally at fourth week. All procedures related to animal experiments were reviewed and approved by the People’s Hospital of Hunan Province (approval no. 2019042) (see Supplementary Figure).

Cell culture and treatment

Human umbilical vein endothelial cells (HUVECs) were purchased from ATCC. Cells were cultured with vascular cell basal medium (Gibco, Carlsbad, CA, USA), in addition with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA, USA) and antibiotics (100 mg/mL streptomycin and 100 IU/mL penicillin, Gibco, Carlsbad, CA, USA). All cell lines were cultured under 5% CO₂, with a temperature of 37°C. The atherosclerosis cell models were developed with the treatment of 100 μg/mL oxidized low-density lipoprotein (ox-LDL, Solarbio, Beijing, China) for 24 hours. The treatment concentration of curcumin was 20 μM. MiR-124 mimics, miR-124 inhibitor, small interfering RNA (siRNA) targeting EZH2, and expression vectors containing MIAT and EZH2 (GenePharm, Suzhou, China) were transfected into ox-LDL-induced HUVECs. Lipofectamine 3000 reagent (Life Technologies Corporation, Carlsbad, CA, USA) was used for cell transfection.

ChIP assays

SimpleChIP® Enzymatic Chromatin IP Kit (Cell Signaling Technology, MA, USA) was used for ChIP assay. Briefly, HUVECs were fixed by formaldehyde for 10 minutes and the chromatin was broken to fragments ranged from 200 to 1000 bp. Chromatin was then immunoprecipitated with 2 μg of EZH2 or IgG antibody (Abcam, Cambridge, UK) at 4°C for 2 hours. The product was examined by qRT-PCR. ChIP assay was conducted for three times.

Oil Red O Staining

Oil Red O staining was conducted in 5 μm sections of paraffin-embedded samples of aortic roots. Briefly, the sections of each group were stained with 0.5% Oil Red O staining (Sigma-Aldrich, MO, USA) for 30 minutes. Then hematoxylin solution (Sigma-Aldrich, MO, USA) was used to counterstain for 20 s. Then the slides were observed under microscope.

Cell viability assay

Cell proliferation was assessed through CCK-8 assay (Beyotime, Shanghai, China). Cells were put in a 96-well plate and cultured at 37°C for 48 hours, added 10 μL CCK-8 into each well, and incubated at 37°C for 2 hours; the absorbance at 450 nm was measured for cell viability assessment at 48 hours.

Enzyme linked immunosorbent assay

Human TNF-α, IL-β, IL-6, and IL-8 ELISA kits (Genzyme Techne, USA) were used according to the protocols. HUVECs were treated with ox-LDL or curcumin and transfected with MIAT or miR-124 inhibitor. The cultured medium was then collected and TNF-α, IL-β, IL-6, and IL-8 levels were measured by ELISA analysis using ELISA kit according to the instructions of the supplier. The concentration was calculated from the standard curve.

Subcellular fractionation

The isolation of nuclear and cytoplasmic RNA was performed with PARISTM kit (Life Technologies, Inc., Gaithersburg, MD, USA) according to the description in Zhao et al.’s¹⁹ study. Then RNA was extracted using TRIzol reagent as described above.

RNA extraction and qRT-PCR

TRIzol® reagent (Thermo Fisher Scientific, MA, USA) was used to obtain total RNA from tissues and cell lines. NanoDrop™ 2000 spectrophotometers (Thermo Fisher Scientific, MA, USA) were utilized to test RNA quality. For qualified RNA, OD260/280 should range from 1.8 to 2.0. Then the RNA samples were used to synthesize cDNA by PrimeScript^TM RT reagent Kit (Takara, Dalian, China). qRT-PCR was used to determine the genes expression of MIAT and miR-124 using SYBR^® Green Real-Time PCR master mix (Thermo Fisher Scientific, MA, USA) on ABI StepOnePlusTM Real-Time PCR System (Applied Biosystems, CA, USA). Each sample was assessed 3 times. GAPDH and U6 were used as reference genes and primer sequence of tested genes were listed below:

MIAT: forward 5^′- ATCCTCGAGACAAAGAGCCCTCTGCACTAG -3^′;

MIAT: reverse 5^′- ATCGGATCCGAGCAAATGGAGACAAAGGAC -3^′;

miR-124: forward 5^′- GCTAAGGCACGCGGTG -3^′;

miR-124: reverse 5^′- GTGCAGGGTCCGAGGT -3^′;

GAPDH: forward 5^′- CTGACTTCAACAGCGACACC -3^′;

GAPDH: reverse 5^′- GTGGTCCAGGGGTCTTACTC -3^′;

U6: forward 5^′- CTCGCTTCGGCAGCACA -3^′;

U6: reverse 5^′- AACGCTTCACGAATTTGCGT -3^′.

Apoptosis assay

After collection, 1 × 10⁵ cells were cultured in 6-well plates and were stained with annexin V-PI (Elabscience, Wuhan, China) based on manufacturer’s instructions and then sorted by flow cytometry (FACScan, BD Bioscience, NJ, USA). Briefly, cells were washed with PBS twice. Then they were digested and resuspended and the final cell density was adjusted to 0.5 × 10⁶/100 μL cells. Cells were treated with 5 μL annexin V/FITC for 10 minutes in the dark. After mixed with 100 μL binding buffer, cells were treated with 5 μL PI for 5 minutes in the dark and then analyzed by flow cytometry. (Annexin V-FITC)-/PI+ cells were dead cells. Doublet Discrimination Module was utilized in the experiment. Results were evaluated by CELL Quest 3.0 software (BD Bioscience, NJ, USA).

RNA immunoprecipitation assay

RIP assays were conducted with Magna RIP Kit (Millipore, Bedford, MA, USA) according to protocol. In brief, cells were transfected with EZH2 and incubated for 48 hours. HUVECs were harvested and lysed in lysis buffer. Then the lysates were incubated with magnetic beads conjugated by an anti-EZH2 antibody (Millipore, Bedford, MA, USA) or negative control normal mouse IgG (Millipore, Bedford, MA, USA). The immunoprecipitated products were purified and the presence of MIAT was evaluated by qRT-PCR.

Western blotting analysis

Tissues and cells were harvested and lysed in radio immunoprecipitation (RIPA) buffer with protease inhibitors (Beyotime Institute of Biotechnology, Shanghai, China) to extract total protein. Aortic tissues were harvested and homogenized with a mortar in RIPA buffer with protease inhibitors to extract total protein. Equal protein was separated and transferred to a PVDF membrane (Invitrogen, Grand Island, NY, USA) and then followed by blocking in Tris Buffered Saline Tween (TBST) with 5% skim milk powder. Incubate the membrane with primary antibody including IL-1β (1:1000; Abcam, Cambridge, UK), TNFα (1:1000; Cell Signaling Technology, USA), IL-6 (1:1000; Cell Signaling Technology, MA, USA), IL-8 (1:1000; Cell Signaling Technology, MA, USA), EZH2 (1:1000; Cell Signaling Technology, MA, USA), and GAPDH (internal control for total proteins, Cell Signaling Technology, MA, USA) at 4°C overnight. Next, the membrane was washed using TBST every 5 minutes for 3 times and then cultured with HRP-conjugated secondary antibody (1:2000, Abcam, Cambridge, UK) for room temperature at 2 hours. After washing, the bands were imaged using Gel Imaging System (Life Science, CA, USA), and band intensity was examined by ImageJ software V1.52a (National Institutes of Health).

Statistical analysis

All experiments were repeated more than 3 times. Data were presented as the mean ± standard deviation (SD). SPSS 18.0 was used to analyze data. Unpaired two-tailed Student’s t-test was used for comparison in two groups, One-way analysis of variance (ANOVA) followed by Tukey’s post hoc test was utilized for multiple groups. A statistical significance was defined at p<0.05.

Results

Curcumin alleviated atherosclerosis in mouse model and inflammation in ox-LDL-induced HUVECs

Previous studies showed that curcumin ameliorated atherosclerosis in animal model and cell lines.^20,21 In our research, we also examined the effect of curcumin treatment on atherosclerosis. Oil Red O staining indicated an increase of aortic plaques in the HFD group compared to that of the ND group, while administration of curcumin significantly reduced the plaque area (Figure 1(a)). Consistently, the expression of serum inflammatory factors, including IL-6, IL-1β, TNFα, and IL-8 was boosted in the HFD group and was suppressed by curcumin, which was manifested by ELISA (Figure 1(b)) and western blotting (Figure 1(c)). LncRNA MIAT was also revealed to aggravate atherosclerosis damage.¹⁷ Herein, we tried to identify whether MIAT and miR-124 were involved after curcumin administration. Results of qRT-PCR showed that in mouse tissues, MIAT was up-regulated while miR-124 was down-regulated in the HFD group and curcumin treatment restored the expression profile to normal status (Figure 1(d) and (e)). The results in animal model were further validated in ox-LDL-treated HUVECs. The expression of inflammatory factors (Figure 1(f) and (g)), MIAT (Figure 1(h)), and miR-124 (Figure 1(i)) presented similar pattern to that in animal models. Overall, curcumin mitigated atherosclerosis damage in animal model and inhibited inflammation in cells. Furthermore, MIAT was decreased and miR-124 was increased after curcumin treatment.

Figure 1.

Curcumin alleviated atherosclerosis in mouse model and inflammation in ox-LDL-induced HUVECs. Mice were fed with normal diet (ND) or high-fat diet (HFD) and treated with curcumin. (a) Oil Red O staining was used to indicate the plaques in aortic sinus. (b and c) The expression levels of inflammatory factors IL-1β, TNFα, IL-6, and IL-8 were detected by ELISA and western blotting in mice. (d and e) The expression levels of MIAT and miR-124 were determined by qRT-PCR. (f and g) The expression levels of inflammatory factors IL-1β, TNFα, IL-6, and IL-8 were detected by ELISA and western blotting in ox-LDL-induced HUVECs. (h and i) The expressions of MIAT and miR-124 were detected by qRT-PCR. *p < .05, **p < .01, and ***p < .001.

MIAT overexpression reversed the anti-inflammation effect of curcumin on ox-LDL-induced cells

To determine the role of MIAT in curcumin treatment, we overexpressed MIAT in ox-LDL-induced HUVECs and examined cell behaviors. The expression of MIAT was induced by ox-LDL treatment and inhibited by curcumin treatment. However, transfection of plasmids containing MIAT significantly increased its expression (Figure 2(a)). ELISA and western blotting showed the expression of inflammatory factors IL-6, IL-1β, TNFα, and IL-8 was greatly boosted by ox-LDL treatment and suppressed by curcumin. Furthermore, co-administration of MIAT reversed curcumin’s inhibitory effect on inflammation (Figure 2(b) and (c)). Proliferation and apoptosis were also detected by CCK-8 assay and flow cytometry, respectively. Proliferation was retarded and apoptosis was promoted in the ox-LDL group. Addition of curcumin restored proliferation and suppressed apoptosis and MIAT overexpression reversed curcumin’s effect (Figure 2(d) and (e)). Taken together, MIAT reversed curcumin’s anti-inflammation function efficiently.

Figure 2.

MIAT overexpression reversed the anti-inflammation effect of curcumin on ox-LDL-induced cells. (a) MIAT expression in different groups was examined by qRT-PCR. (b and c) The expression levels of inflammatory factors IL-1β, TNFα, IL-6, and IL-8 were measured by ELISA and western blotting. (d) Effect of curcumin and MIAT treatment on cell proliferation was examined by CCK-8 assay. (e) Cell apoptosis of HUVECs was assessed by flow cytometry. *p < .05, **p < .01, and ***p < .001.

MiR-124 inhibition impaired curcumin’s anti-inflammation function

The function of miR-124 in ox-LDL-induced inflammation was further characterized. Compared to HUVECs treated with ox-LDL, curcumin, and inhibitor NC, additional miR-124 inhibitor treatment reduced its expression (Figure 3(a)). The expression of inflammatory factors was also increased after addition of miR-124 inhibitor, indicating an enhancement of inflammatory response (Figure 3(b) and (c)). Moreover, the cell viability was suppressed and apoptosis was activated by miR-124 inhibitor treatment (Figure 3(d) and (e)). Above results indicated that miR-124 inhibitor abolished the efficacy of curcumin in ox-LDL-treated cells.

Figure 3.

MiR-124 inhibition impaired curcumin’s anti-inflammation function. (a) MiR-124 expression in different groups was examined by qRT-PCR. (b and c) ELISA and western blotting were used to detect the expression of inflammatory factors IL-1β, TNFα, IL-6, and IL-8. (d) Effect of curcumin and miR-124 inhibitor treatment on cell proliferation was analyzed by CCK-8 assay. (e) Cell apoptosis was measured by flow cytometry. *p < .05 and **p < .01.

MIAT modulated miR-124 through epigenetic regulation

We then identified the subcellular localization of MIAT via qRT-PCR. MIAT was shown to be mostly enriched in nucleus instead of cytoplasm (Figure 4(a)). The binding between EZH2 and MIAT was confirmed by RIP. MIAT was enriched in EZH2-treated group (Figure 4(b)). ChIP results demonstrated that the enrichment of H3K27me3 and EZH2 in the promoter region of miR-124 was greatly reduced by shMIAT treatment (Figure 4(c)). Then we performed EZH2 gain and loss of function in HUVECs, and the efficiency was validated by qRT-PCR (Figure 4(d)) and western blotting (Figure 4(e)). MiR-124 was found to be inhibited after EZH2 transfection and promoted after siEZH2 administration (Figure 4(f)). Collectively, above results suggested MIAT regulated the level of miR-124 via EZH2.

Figure 4.

MIAT modulated miR-124 through epigenetic regulation. (a) The expression of MIAT in nucleus and cytoplasm was detected by qRT-PCR. (b) The enrichment of MIAT in EZH2 and IgG RIP, respectively. (c) Cells were treated with shNC or shMIAT and enrichment of H3K27me3 and EZH2 on the promoter of miR-124 were examined. (d and e) The expression of EZH2 was detected by qRT-PCR and western blotting after treated with plasmids containing EZH2 or siEZH2. (f) MiR-124 expression after treated with plasmids containing EZH2 or siEZH2 was measured by qRT-PCR. *p < .05 and **p < .01.

Curcumin relieved inflammation via regulating MIAT/miR-124 pathway

We then explored the roles of MIAT/miR-124 in the regulation of curcumin treatment. Plasmids containing MIAT and miR-124 mimics could effectively boost the expression of MIAT and miR-124, respectively (Figure 5(a) and (b)). The expression of inflammatory factors was then evaluated by ELISA and western blotting and results showed that curcumin inhibited the expression of inflammatory factors and MIAT overexpression activated cytokines’ expression, while simultaneous treatment of miR-124 mimics reversed this trend (Figure 5(c) and (d)). MiR-124 mimics also reversed the high apoptotic rate and low proliferative capability caused by MIAT overexpression (Figure 5(e) and (f)). To summarize, curcumin mitigated cell inflammation by removing MIAT’s inhibition on miR-124.

Figure 5.

Curcumin relieved inflammation via regulating MIAT/miR-124 pathway. (a and b) The expression levels of MIAT and miR-124 were detected by qRT-PCR. (c and d) The expression levels of inflammatory factors (IL-1β, TNFα, IL-6, and IL-8) were examined by ELISA and western blotting. (e) CCK-8 assay was used to assess cell proliferation. (f) Flow cytometry was used to analyze cell apoptosis. *p < .05 and **p < .01.

Discussion

Atherosclerosis is one of the dominant cardiovascular disease types.²² Lipid deposition, inflammation, and fibrosis usually occur in atherosclerosis, which facilitate atherosclerotic plaques development and the block of blood flow, thereby leading to stroke or death.^23,24 The therapeutic effect of curcumin against atherosclerosis has been validated in vitro and in vivo by large amounts of studies. Evidence confirms curcumin may alleviate atherosclerosis by multiple processes. Ameruoso et al.²⁵ showed that curcumin inhibited the expression of several inflammatory factors, like IL-1β, IL-6, and TNFα. Our previous work demonstrated curcumin regulated the level of reactive oxygen species (ROS) by suppressing hypoxia inducible factor-1α (HIF-1α)-induced inflammation and apoptosis.²⁶ Curcumin also mitigates the accumulation of ox-LDL in vitro and in vivo, which has been verified by several studies.^27,28 The molecular pathway involved in the function of curcumin in atherosclerosis remains to be further elaborated. In this study, we found curcumin suppressed MIAT to inhibit the inflammation in atherosclerosis. Moreover, miR-124 was proved to be regulated by MIAT through epigenetic regulation. Our results provided new evidence for the protective effect of curcumin.

LncRNAs are validated to be involved in the progression of atherosclerosis, including cholesterol metabolism, macrophage proliferation, and inflammation.^29–31 For example, lncRNA MALAT1 inhibition relieves ox-LDL-induced inflammation and oxidative stress and exerts protective effects on endothelium.¹² Previous studies revealed the important roles of MIAT in multiple cancers and vascular disease,^32,33 but research about its function in atherosclerosis is limited. Zi-Ming Ye et al. reported that lncRNA MIAT worked as the molecular sponge of miR-149-5p and up-regulated CD47. This pathway could inhibit efferocytosis in advanced atherosclerosis.³⁴ In ox-LDL-induced cell models, MIAT facilitated proliferation and suppressed apoptosis via miR-181b/STAT3 axis.¹⁸ Our present study demonstrated that MIAT was inhibited by curcumin treatment and this down-regulation hindered inflammation and apoptosis and promoted proliferation in atherosclerosis, which may partly account for the therapeutic effect of curcumin.

A growing knowledge demonstrates that lncRNAs are the targets of RNA-binding proteins (RBPs), especially proteins involved in carcinogenesis.^35–37 HOTAIR was reported to interact with a histone demethylase LSD1 and a histone methyltransferase PRC2.^38,39 Previous reports suggested MALAT1 could interact with a series of splicing regulators.⁴⁰ The functions of miRNA in the development of atherosclerosis have been introduced thoroughly.⁴¹ Among them, miR-124 is associated with atherosclerosis. MiR-124 also mediates the pro-angiogenic function of lncRNA HULC in endothelial cells.⁴² Our study showed that MIAT binds to EZH2, a histone methyltransferase which has important function in human cancer, and then regulates the expression of miR-124. Moreover, miR-124 was a critical component in the regulation pathway of curcumin on atherosclerosis. A higher level of miR-124 was associated with lower cell inflammation.

In summary, we identified MIAT/miR-124 mediated the protective effect of curcumin on atherosclerosis at cellular level and in animal model. We also found that MIAT suppressed miR-124 by interacting with EZH2. This finding contributed a novel mechanism which may account for the benefits of curcumin on atherosclerosis and potentiated the feasibility of curcumin treatment against atherosclerosis.

Supplemental Material

sj-pdf-1-vas-10.1177_17085381211040974 – Supplemental Material for Curcumin improves atherosclerosis by inhibiting the epigenetic repression of lncRNA MIAT to miR-124

Supplemental Material, sj-pdf-1-vas-10.1177_17085381211040974 for Curcumin improves atherosclerosis by inhibiting the epigenetic repression of lncRNA MIAT to miR-124 by Shang Ouyang, Ou Zhang, Hua Xiang, Yuan-Hui Yao and Zhi-Yong Fang in Vascular

Footnotes

Acknowledgments

Thanks to the members of our laboratory for their contributions.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Ethics approval

All procedures related to animal experiments were reviewed and approved by the People’s Hospital of Hunan Province.

ORCID iD

Zhi-Yong Fang

Supplemental material

Supplemental material for this article is available online.

Appendix

References

Bennett

Sinha

Owens

. Vascular smooth muscle cells in atherosclerosis. Circ Res 2016; 118: 692–702.

GBD 2017 Disease and Injury Incidence and Prevalence Collaborators . Global, regional, and national incidence, prevalence, and years lived with disability for 354 diseases and injuries for 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet 2018; 392: 1789–1858.

Ridker

Danielson

Fonseca

, et al. Rosuvastatin to prevent vascular events in men and women with elevated C-reactive protein. N Engl J Med 2008; 359: 2195–2207.

Ridker

Everett

Thuren

, et al. Antiinflammatory therapy with Canakinumab for atherosclerotic disease. N Engl J Med 2017; 377: 1119–1131.

Akbik

Ghadiri

Chrzanowski

, et al. Curcumin as a wound healing agent. Life Sci 2014; 116: 1–7.

Gupta

Patchva

Aggarwal

. Therapeutic roles of curcumin: lessons learned from clinical trials. AAPS J 2013; 15: 195–218.

Hasan

Zingg

Kwan

, et al. Curcumin modulation of high fat diet-induced atherosclerosis and steatohepatosis in LDL receptor deficient mice. Atherosclerosis 2014; 232: 40–51.

Chen

Zhou

Guo

, et al. Curcumin retunes cholesterol transport homeostasis and inflammation response in M1 macrophage to prevent atherosclerosis. Biochem Biophys Res Commun 2015; 467: 872–878.

Zhang

Salisbury

Sallam

. Long noncoding RNAs in atherosclerosis: JACC review topic of the week. J Am Coll Cardiol 2018; 72: 2380–2390.

10.

Carter

Miladinovic

Patel

, et al. Circulating long noncoding RNA GAS5 levels are correlated to prevalence of type 2 diabetes mellitus. BBA Clin 2015; 4: 102–107.

11.

Vausort

Wagner

Devaux

. Long noncoding RNAs in patients with acute myocardial infarction. Circ Res 2014; 115: 668–677.

12.

Michalik

You

Manavski

, et al. Long noncoding RNA MALAT1 regulates endothelial cell function and vessel growth. Circ Res 2014; 114: 1389–1397.

13.

Ishii

Ozaki

Sato

, et al. Identification of a novel non-coding RNA, MIAT, that confers risk of myocardial infarction. J Hum Genet 2006; 51: 1087–1099.

14.

Rao

, et al. Genetic variants in long non-coding RNA MIAT contribute to risk of paranoid schizophrenia in a Chinese Han population. Schizophr Res 2015; 166: 125–130.

15.

Zhu

Luo

, et al. Peripheral blood leukocyte expression of lncRNA MIAT and its diagnostic and prognostic value in ischemic stroke. J Stroke Cerebrovasc Dis 2018; 27: 326–337.

16.

Crea

Venalainen

, et al. The role of epigenetics and long noncoding RNA MIAT in neuroendocrine prostate cancer. Epigenomics 2016; 8: 721–731.

17.

Sun

. Up-regulation of MIAT aggravates the atherosclerotic damage in atherosclerosis mice through the activation of PI3K/Akt signaling pathway. Drug Deliv 2019; 26: 641–649.

18.

Zhong

Zhang

, et al. MIAT promotes proliferation and hinders apoptosis by modulating miR-181b/STAT3 axis in ox-LDL-induced atherosclerosis cell models. Biomed Pharmacother 2018; 97: 1078–1085.

19.

Zhao

Yang

, et al. Long non-coding RNA FENDRR modulates autophagy through epigenetic suppression of ATG7 via binding PRC2 in acute pancreatitis. Inflammation 2021; 44:999–1013.

20.

Tian

Sun

, et al. Curcumin ameliorates atherosclerosis through upregulation of miR-126. J Cell Physiol 2019; 234: 21049–21059.

21.

Lin

Chen

, et al. Efficacy of curcumin on aortic atherosclerosis: a systematic review and meta-analysis in mouse studies and insights into possible mechanisms. Oxid Med Cell Longev 2020; 2020: 1520747.

22.

Koelwyn

Corr

Erbay

, et al. Regulation of macrophage immunometabolism in atherosclerosis. Nat Immunol 2018; 19: 526–537.

23.

Hansson

Robertson

Soderberg-Naucler

. Inflammation and atherosclerosis. Annu Rev Pathol 2006; 1: 297–329.

24.

Tabas

. Russell Ross memorial lecture in vascular biology: molecular-cellular mechanisms in the progression of atherosclerosis. Arterioscler Thromb Vasc Biol 2017; 37: 183–189.

25.

Ameruoso

Palomba

Palange

, et al. Ameliorating amyloid-beta fibrils triggered inflammation via curcumin-loaded polymeric nanoconstructs. Front Immunol 2017; 8: 1411.

26.

Ouyang

Yao

Zhang

, et al. Curcumin inhibits hypoxia inducible factor-1alpha-induced inflammation and apoptosis in macrophages through an ERK dependent pathway. Eur Rev Med Pharmacol Sci 2019; 23: 1816–1825.

27.

Zhong

Liu

Guo

. Curcumin inhibits ox-LDL-induced MCP-1 expression by suppressing the p38MAPK and NF-kappaB pathways in rat vascular smooth muscle cells. Inflamm Res 2012; 61: 61–67.

28.

Zhou

Chen

Wang

, et al. Effect of curcumin on down-expression of thrombospondin-4 induced by oxidized low-density lipoprotein in mouse macrophages. Biomed Mater Eng 2014; 24: 181–189.

29.

Ballantyne

Pinel

Dakin

, et al. Smooth muscle enriched long noncoding RNA (SMILR) regulates cell proliferation. Circulation 2016; 133: 2050–2065.

30.

Sallam

Jones

Thomas

, et al. Transcriptional regulation of macrophage cholesterol efflux and atherogenesis by a long noncoding RNA. Nat Med 2018; 24: 304–312.

31.

Sallam

Jones

Gilliland

, et al. Feedback modulation of cholesterol metabolism by the lipid-responsive non-coding RNA LeXis. Nature 2016; 534: 124–128.

32.

Mitra

Chen

Greenawalt

, et al. Decoding critical long non-coding RNA in ovarian cancer epithelial-to-mesenchymal transition. Nat Commun 2017; 8: 1604.

33.

Yan

Yao

Liu

, et al. lncRNA-MIAT regulates microvascular dysfunction by functioning as a competing endogenous RNA. Circ Res 2015; 116: 1143–1156.

34.

Yang

Xia

, et al. LncRNA MIAT sponges miR-149-5p to inhibit efferocytosis in advanced atherosclerosis through CD47 upregulation. Cell Death Dis 2019; 10: 138.

35.

Barrandon

Spiluttini

Bensaude

. Non-coding RNAs regulating the transcriptional machinery. Biol Cell 2008; 100: 83–95.

36.

Bernstein

Allis

. RNA meets chromatin. Genes Dev 2005; 19: 1635–1655.

37.

Jeffery

Nakielny

. Components of the DNA methylation system of chromatin control are RNA-binding proteins. J Biol Chem 2004; 279: 49479–49487.

38.

Cai

Song

Cai

, et al. HOTAIR: a cancer-related long non-coding RNA. Neoplasma 2014; 61: 379–391.

39.

Zhang

Wang

, et al. Long noncoding RNA HOTAIR involvement in cancer. Tumour Biol 2014; 35: 9531–9538.

40.

Anko

Neugebauer

. RNA-protein interactions in vivo: global gets specific. Trends Biochem Sci 2012; 37: 255–262.

41.

Volny

Kasickova

Coufalova

, et al. microRNAs in cerebrovascular disease. Adv Exp Med Biol 2015; 888: 155–195.

42.

Yin

, et al. Pro-angiogenic role of LncRNA HULC in microvascular endothelial cells via sequestrating miR-124. Cell Physiol Biochem 2018; 50: 2188–2202.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.12 MB