Circ_0000595 knockdown alleviates CoCl2-mediated effects in VSMCs by regulating the miR-582-3p/ADAM10 axis

Abstract

Background

Thoracic aortic aneurysm (TAA) is a serious vascular disease causing the death of elder people. Accumulating studies have reported that circular RNAs (circRNAs) are implicated in the regulation of aortic aneurysms. However, the role of circ_0000595 in the progression of TAA is still unclear.

Methods

Quantitative real-time PCR (qRT-PCR) and western blotting were implemented to assess circ_0000595, microRNA (miR)-582-3p, guanine nucleotide-binding protein alpha subunit (ADAM10), PCNA, Bax, and Bcl-2 expression. The proliferation of vascular smooth muscle cells was determined using cell counting kit 8 (CCK-8) and 5-ethynyl-2-deoxyuridine (EdU). Cell apoptosis was measured using flow cytometry, and caspase-3 activity was analyzed using a commercial kit. After bioinformatics analysis, the interaction between miR-582-3p and circ_0000595 or ADAM10 was validated using a dual-luciferase reporter and RNA immunoprecipitation.

Results

As compared with controls, TAA tissues and CoCl₂-induced VSMCs displayed high expression of circ_0000595 and ADAM10, and low expression of miR-582-3p. CoCl₂ treatment evidently suppressed VSMC proliferation and promoted VSMCs apoptosis, and these impacts were reverted by circ_0000595 knockdown. Circ_0000595 acted as a molecular sponge for miR-582-3p, and circ_0000595 silencing-mediated influences in CoCl₂-induced VSMCs were overturned by miR-582-3p inhibitor. ADAM10 was confirmed as a target gene of miR-582-3p, and miR-582-3p overexpression-induced influence was almost restored by overexpressed ADAM10 in CoCl₂-induced VSMCs. Besides, circ_0000595 contributed to ADAM10 protein expression by sponging miR-582-3p.

Conclusion

Our data verified that circ_0000595 silencing might attenuate CoCl2-mediated impacts in VSMCs by regulating the miR-582-3p/ADAM10 axis, providing new potential roads for treating TAA.

Keywords

thoracic aortic aneurysm Circ_0000595 MiR-582-3p ADAM10

Introduction

Thoracic aortic aneurysm (TAA) is a vascular disease caused by dilated lesions of the thoracic aorta.¹ Due to untypical early symptoms of the tumor, rupture may occur at any time from the initial stage to the late stage, resulting in a high mortality rate for the patients.^1,2 In recent years, thoracic endovascular aortic repair has achieved better results than traditional surgery in the treatment of TAA.^3,4 However, the current treatment status of TAA is not ideal owing to the insidious disease, rapid development, high surgical risk, and postoperative complications.⁵ Therefore, there is an urgent need to develop new therapeutic strategies. In addition, some studies have confirmed that hypoxia might be one of the etiologies of aortic aneurysms, which might be associated with vascular smooth muscle cell dysfunction that contributes to the occurrence and development of TAA.^6,7 Thus, exploring the molecular mechanism of hypoxia-induced VSMC dysfunction is helpful to understand the pathogenesis of TAA and find safe and effective treatment strategies for TAA.

Circular RNAs (circRNAs) are a relatively new family of endogenous non-coding RNA with a closed circular structure lacking a 5′ cap and 3′ poly adenylation tail.⁸ Compared with linear RNA, circRNA formed by pre-mRNA back-splicing has higher stability.⁹ In addition, with the development of RNA sequencing and bioinformatics analysis, plenty of circRNA have been identified to be widely expressed in multiple species.¹⁰ Emerging evidence has indicated that many circRNAs are abnormally expressed in samples from patients with various diseases with respect to normal controls. Additionally, recent studies reported that circRNAs have unique advantages as a potential attractive marker for disease diagnosis and prognosis.^10,11 Further research has presented the important biological role of circRNA in the development of various malignant tumors.¹² Currently, it has been confirmed that the regulatory role of circRNA was closely associated with the dysfunction of vascular and related diseases, including aortic aneurysms.¹³ For example, Yue et al.¹⁴ demonstrated that circCBFB might block VSMC apoptosis by regulating LYPD3 and GRIA4 via miR-28-5p. Thence, it is of vital importance for us to study the role and potential mechanism of TAA-related circRNA, which might provide new support for TAA molecular targeted therapy. Interestingly, a recent study has suggested that circ_0000595 is significantly upregulated in aortic aneurysm tissues and CoCl₂-induced VSMCs, which might participate in the regulation of VSMCs apoptosis.¹⁵ Nevertheless, the pathogenesis of circ_0000595 involved in TAA progression and VSMC dysfunction is far from being addressed.

Nowadays, some scholars have confirmed that circRNA might derepress the expression of target genes via competitively binding to miRNAs, thereby affecting the progression of a variety of human diseases.^16,17 In this paper, bioinformatics analysis found that miR-582-3p possesses some binding sequence with circ_0000595 or disintegrin and metalloproteinase 10 (ADAM10) for the first time. Of note, some studies have indicated that the aberrant expression of both miR-582-3p and ADAM10 is related to aortic-related diseases.^18–20 Therefore, we aim to verify whether the involvement of circ_0000595 in the CoCl₂-induced VSMC process was mediated by regulating the miR-582-3p/ADAM10 axis.

Materials and methods

Tissue samples

The aortic media specimens from 43 TAA patients and 43 control samples (undergoing physical trauma without TAA) were collected between June 2018 and March 2020 at the First Affiliated Hospital of Guangxi Medical University. After the operation, all tissues were immediately frozen at −80°C. Meanwhile, serum specimens were obtained from TAA patients. Meanwhile, the written informed consent was signed by all patients and this project was authorized by the ethics committee of the First Affiliated Hospital of Guangxi Medical University. In addition, the sample size was computed with prior-power analysis using G-power software.

Cell lines

Human aortic vascular smooth muscle cell line (T/G HA-VSMC, American Type Culture Collection, Manassas, VA, USA) was grown in SmGM-2 Smooth Muscle Growth medium-2 (Lonza Group Ltd, Basel, Switzerland) containing 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA) at 37°C with 5% CO₂.

Quantitative real-time PCR (qRT-PCR)

Extraction of total RNA was implemented using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). After synthesizing template DNA, SYBR Green (ABI, Foster City, CA, USA) and specific primers were mixed with cDNA to conduct qRT-PCR. After being normalized using GAPDH and U6, data were calculated by the 2^−ΔΔCt method. Utilized primers were listed in Table 1.

Table 1.

Primers sequences used for PCR.

Name		Primers for PCR (5′-3′)
circ_0000595	Forward	CTTCCCCCTGGTTAAACTACAGA
circ_0000595	Reverse	CCTGACGAAGCTCAGCAAGT
CASC4	Forward	GCAGGCTACCAAGGACAGAG
CASC4	Reverse	CTGCGGATCAACAGGGGATT
miR-582-3p	Forward	GCCGAGTAACTGGTTGAACAAC
miR-582-3p	Reverse	CTCAACTGGTGTCGTGGAG
ADAM10	Forward	TTAATTCTGCTCCTCTCCTGGG
ADAM10	Reverse	TGTGAGACTGCTCTTTTGGCA
GAPDH	Forward	GACAGTCAGCCGCATCTTCT
GAPDH	Reverse	GCGCCCAATACGACCAAATC
U6	Forward	CTCGCTTCGGCAGCACA
U6	Reverse	AACGCTTCACGAATTTGCGT

Subcellular localization of circ_0000595

The nuclear and cytoplasmic RNAs of VSMCs were obtained using PARIS Kit (Invitrogen). Then, the expression of circ_0000595, U6, and GAPDH was detected via qRT-PCR assay.

RNase R assay

To identify the circular feature of circ_0000595, an RNase R assay was conducted in this study. After harvesting VSMCs, TRIzol Reagent (Invitrogen) was used to obtain the RNA, which was co-incubation with or without 3 U/μg RNase R (Geneseed, Guangzhou, China), followed by the qRT-PCR analysis of circ_0000595 expression and linear cancer susceptibility candidate 4 (CASC4).

Actinomycin D (ActD) assay

For the stability of circ_0000595, an ActD assay was performed in this study. For this part, the ActD solution (Seebio, Shanghai, China) was added to the VSMC culture medium. The harvested cells at different time points were analyzed using qRT-PCR for circ_0000595 and its linear isoform.

Cell transfection

Lipofectamine 3000 (Invitrogen) was applied for cell transfection in this research. Circ_0000595 small interfering RNAs (si-circ_0000595#1, si-circ_0000595#2 and si-circ_0000595#3), Circ_0000595 overexpression plasmid (circ_0000595), miR-582-3p mimic or inhibitor (miR-582-3p or in-miR-582-3p), the expression plasmid of ADAM10 (ADAM10), and their matched controls (si-NC, vector, miR-NC, in-miR-NC, and pcDNA) were synthesized by Ribobio (Guangzhou, China).

Cell counting kit 8 (CCK-8) assay

In short, CCK-8 reagent (Beyotime, Shanghai, China) was added to each well at predetermined time points (0, 24, 48, and 72 h). Four hours later, the optical density was determined at 450 nm to assess cell viability.

5-ethynyl-2-deoxyuridine (EdU) assay

To assess the cell proliferative ability, BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 488 (Beyotime) was employed to monitor the DNA synthesis. Briefly, VSMCs were mixed with Hoechst 33342 solution, followed by calculation according to fluorescence images.

Determination of cell apoptosis

After being harvested by centrifugation, transfected VSMCs were re-suspended with binding buffer. Then, the cell suspension was incubated with Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) solution (Beyotime) for 15 min in the dark. Then, the cell apoptotic rate was assessed under a flow cytometer (Thermo Fisher Scientific, Rockford, IL, USA).

The activity of caspase-3 was measured as per the manufacturer’s instructions for a commercial kit (ab219915; Abcam). In short, transfected VSMCs were incubated with caspase-3 substrate and assay buffer. Then, the caspase activity was evaluated by monitoring the fluorescence.

Western blotting

Protein samples were obtained from TAA tissues and VSMCs using RIPA buffer (Beyotime). After that, samples were processed using SDS-PAGE gel and transferred to PVDF membranes (Bio-Rad, Hercules, CA, USA), which were co-incubated with primary and secondary antibodies (Table 2). Protein blots were visualized with BeyoECL Plus (Beyotime) and analyzed with Image J software.

Table 2.

The antibodies in western blotting and IHC.

Antibody	Cat	Dilution ratio	Source
PCNA	ab92552	1:10000	Abcam
Bax	ab32503	1:10000	Abcam
Bcl-2	ab32124	1:1000	Abcam
ADAM10	ab124695	1:10000	Abcam
GAPDH	10494-1-AP	1:50000	Proteintech
Goat anti-rabbit IgG H&L (HRP)	ab6721	1:20000	Abcam

Bioinformatics analysis and dual-luciferase reporter system

CircInteractome and TargetScan online software were used to retrieve the binding sites of miR-582-3p and circ_0000595 or ADAM10, respectively. According to predicted binding sites, fragments of the wild type (WT) or mutant type (MUT) circ_0000595 and 3′UTR of ADAM10 mRNA were cloned into the upstream of pmirGLO luciferase reporter to synthesize WT or MUT luciferase reporter for circ_0000595 and ADAM10. After co-transfection with reporter vector and miRNA mimics or miRNA-NC for 48 h, the luciferase activities in cell lysates were analyzed using Dual-Lumi™ II Luciferase Assay Kit (Beyotime).

RNA immunoprecipitation (RIP) assay

According to the instruction of Magna RIP Kit (Millipore, Billerica, MA, USA), transfected VSMCs were treated with RIP lysis buffer first. Then, magnetic beads pre-coated with anti-Ago2 or anti-IgG were added into cell lysates. At last, immunoprecipitated RNAs were subjected to qRT-PCR analysis of circ_0000595 and miR-582-3p.

Statistical analysis

Data in this research were denoted as the mean ± standard deviation (SD) and analyzed by GraphPad Prism 8.0 software. Statistical significance was accepted when p < 0.05. Differences were compared using an unpaired t-test (two-tailed) or 1/2-way analysis of variance (ANOVA) with Tukey’s or Sidak’s. Pearson correlation coefficient was adopted to analyze the correlations between circ_0000595, miR-582-3p, and ADAM10.

Results

Circ_0000595 was upregulated in TAA tissue and hypoxic VSMCs

Circ_0000595 is located at chr15 and is generated by back-splicing of the 2–6 exons of the CASC4 gene (Figure 1(a)). Compared to the controls, the expression level of circ_0000595 was evidently upregulated in the aortic tissues of TAA patients (Figure 1(b)). Besides, there is a positive association between relative serum circ_0000595 levels and aortic diameter change in 43 TAA patients (Supplemental Figure S1). In addition, the results of subcellular localization analysis revealed that circ_0000595 was mainly located at the cytoplasm of VSMSs (Figure 1(c)). Meanwhile, our data exhibited that RNase R and Act D treatment had little affected on circ_0000595 expression, while its linear RNA CASC4 was sharply reduced by those (Figure 1(d) and (e)). Subsequently, considering that hypoxia is the cause of the thoracic aortic aneurysm formation, CoCl₂ was used to establish a cellular hypoxia model. Meanwhile, the expression of circ_000595 was detected under hypoxic conditions. As shown in Figure 1(f), the results showed that circ_000595 was significantly upregulated in VSMC under CoCl₂ (100, 300, and 1000 μM)-mediated hypoxic conditions when compared to the control group. Moreover, CoCl₂ (300 μM) treatment induced upregulation of circ_000595 expression in VSMC in a time-dependent manner (Figure 1(g)). Hence, CoCl₂ (300 μM, 24 h) was chosen to induce the VSMCs hypoxia model. These data illustrated that circ_0000595 might participate in regulating CoCl₂-induced influence on the VSMC process.

Figure 1.

Circ_0000595 was upregulated in TAA tissue and CoCl₂-incubated VSMCs. (a) The basic information of circ_0000595 was shown. (b) The expression of circ_0000595 in TAA tissues and control tissues (N = 43) was determined by qRT-PCR. (c–e) The circular characteristic of circ_0000595 was confirmed by subcellular localization analysis (c) RNase R assay (d) Act D assay (e). (f) The expression of circ_0000595 in VSMCs was measured by qRT-PCR after treatment with various doses of CoCl₂ (0, 100, 300, and 1000 μM) for 24 h. (g) The expression of circ_0000595 in VSMCs was measured by qRT-PCR after treating with 300 μM CoCl₂ at various times (0, 12, 24, and 48 h). *p < 0.05, **p < 0.01 and ***p < 0.001.

Depletion of circ_0000595 attenuated CoCl₂-mediated impacts in VSMCs

To further investigate the impacts between circ_0000595 silencing and CoCl₂ treatment on VSMC progression, siRNAs of circ_0000595 (si-circ_0000595#1/#2/#3) were transfected into VSMCs, results showed that siRNAs of circ_0000595, especially si-circ_0000595#2 significantly repressed the expression of circ_0000595 (Figure 2(a)). Therefore, si-circ_0000595#2 was selected for the following experiments. After transfecting si-circ_0000595#2 into CoCl₂-induced VSMCs, CCK-8 and EdU assays were performed. As shown in Figure 2(b) and (c), CoCl₂ treatment suppressed VSMC viability and DNA synthesis ability, whereas these impacts were partly restored after circ_0000595 knockdown. Besides, data presented that CoCl₂ exposure contributed to VSMC apoptosis rate and caspase-3 activity, while these effects were effectively reverted by transfecting si-circ_0000595#2 (Figure 2(d) and (e)). In support, PCNA (a proliferation marker) and Bcl-2 (anti-apoptosis factor) protein levels were notably decreased and Bax protein level (pro-apoptosis factor) was apparently increased in CoCl₂-induced VSMCs, which was partly abolished after circ_0000595 silencing (Figure 2(f)). The above evidence demonstrated circ_0000595 regulated CoCl₂-mediated impacts in VSMCs.

Figure 2.

Circ_0000595 knockdown repressed CoCl₂-mediated impacts on VSMC process. (a) The expression of circ_0000595 was detected by qRT-PCR to confirm the transfection efficiency. Then, VSMCs were treated differently and divided into four groups (control, CoCl_2, CoCl₂ + si-NC, and CoCl₂ + si-circ_0000595#2). (b–c) The cell viability and DNA synthesis were measured by CCK-8 assay and EdU assay. (d) Flow cytometry assay was employed to examine the cell apoptosis. (e) The relative activity of caspase-3 was measured by a commercial kit. (f) The protein levels of PCNA, Bax, and Bcl-2 were detected by western blotting in VSMCs. **p < 0.01 and ***p < 0.001.

MiR-582-3p was a target of circ_0000595

Next, circInteractome online starbase was used to predict the binding sites of circ_0000595 and miR-582-3p (Figure 3(a)). Considering the overexpression efficiency of miR-582-3p is available (Figure 3(b)), miR-582-3p mimic and circ_0000595 WT/MUT vectors were co-transfected into VSMCs. As shown in Figure 3(c), miR-582-3p only repressed the luciferase activity of the circ_0000595 WT vector, but did not affect the luciferase activity of the MUT vector. Furthermore, RIP assay displayed that circ_0000595 and miR-582-3p were enriched in Anti-Ago2-pre-incubated beads in comparison to IgG-pre-incubated beads (Figure 3(d)). Apart from that, circ_0000595 expression was dramatically upregulated in VSMCs transfected with circ_0000595 (Figure 3(e)). Moreover, we found that circ_0000595 silencing obviously improved miR-582-3p expression, whereas overexpressed circ_0000595 notably suppressed miR-582-3p expression (Figure 3(f)). Additionally, the expression level of miR-582-3p was decreased in the aortic tissues of TAA patients (Figure 3(g)). Beyond that, circ_0000595 content was negatively correlated with miR-582-3p in the aortic tissues of TAA patients (Figure 3(h)). Overall, circ_0000595 might be a molecular sponge for miR-582-3p.

Figure 3.

Circ_0000595 acted as a sponge of miR-582–3 in VSMCs. (a) The predicted miR-582-3p-binding sites in circ_0000595 WT and MUT sequences were shown. (b) MiR-582-3p expression was tested by qRT-PCR to verify the transfection efficiency. (c) The relative luciferase activity of circ_0000595 WT and MUT vectors was measured by dual-luciferase reporter assay. (d) The relative RNA enrichment of circ_0000595 and miR-582-3p was detected by RIP assay. (e) Circ_0000595 expression was examined by qRT-PCR to verify the transfection efficiency. (f) Circ_0000595 expression was measured by qRT-PCR after transfecting with si-NC, si-circ_0000595, vector, or circ_0000595. (g) MiR-582-3p expression was detected by qRT-PCR in TAA tissues and control tissues (N = 43). (h) Pearson correlation analysis was performed between relative circ_0000595 and miR-582-3p levels in TAA tissues. ***p < 0.001.

Circ_0000595 knockdown suppressed CoCl₂-mediated impacts via sponging miR-582-3p in VSMCs

After confirming the transfection efficiency of in-miR-582-5p (Figure 4(a)), si-circ_0000595#2 and in-miR-582-3p were co-transfected into CoCl₂-induced VSMCs, and results showed that circ_0000595 silencing attenuated the repression role of CoCl₂ exposure on miR-582-3p expression, whereas this impact was partially overturned by a miR-582-3p inhibitor (Figure 4(b)). After that, the function experiments data exhibited that miR-582-3p inhibitor partly overturned the promotion of circ_0000595 silencing on the CoCl₂-triggered VSMC proliferation suppression (Figure 4(c) to (e)). Additionally, circ_0000595 knockdown relieved the promotion of CoCl₂ treatment on cell apoptosis and the activity of caspase-3 in VSMCs, which was reverted after transfection of miR-582-3p inhibitor (Figure 4(f) to (h)). In support, miR-582-3p inhibition might distinctly reverse circ_0000595 silencing-mediated decrease in Bax protein level and increase in PCNA and Bcl-2 protein levels in CoCl₂-induced VSMCs (Figure 4(i)). Altogether, these results indicated that circ_0000595/miR-582-3p regulated CoCl₂-mediated impacts in VSMCs.

Figure 4.

Circ_0000595 silencing attenuated CoCl₂-mediated impacts by associating with miR-582-3p in VSMCs. (a) The expression of miR-582-3p was detected by qRT-PCR to confirm the transfection efficiency. Then, VSMCs were treated differently and divided into six groups (control, CoCl_2, CoCl₂ + si-NC, CoCl₂ + si-circ_0000595#2, CoCl₂ + si-circ_0000595#2 + in-miR-NC and CoCl₂ + si-circ_0000595#2 + in-miR-582-3p). (b) MiR-582-3p expression was determined by qRT-PCR. (c–e) The cell viability and DNA synthesis were measured by CCK-8 assay and EdU assay. (f–g) Flow cytometry assay was employed to examine the cell apoptosis. (h) The relative activity of caspase-3 was measured by a commercial kit. (i) The protein levels of PCNA, Bax, and Bcl-2 were detected by western blotting in VSMCs. *p < 0.05, **p < 0.01 and ***p < 0.001.

Circ_0000595 indirectly facilitated ADAM10 expression via sponging miR-582-3p

Then, a putative complementary binding site of miR-582-3p and ADAM10 was found based on TargetScan database (Figure 5(a)). Subsequently, the result of dual-luciferase reporter assay showed that the luciferase activity of WT ADAM10 3′UTR vector was remarkably reduced by miR-582-3p, while miR-582-3p had no effect on the MUT ADAM10 3′UTR vector in VSMCs (Figure 5(b)). Moreover, the protein level of ADAM10 was downregulated or upregulated by miR-582-3p overexpression or inhibition (Figure 5(c)). In TAA tissues, ADAM10 expression at the mRNA level and the protein level was apparently upregulated compared to their corresponding controls (Figure 5(d) and (e)). Additionally, circ_0000595 silencing obviously decreased ADAM10 protein level, which was clearly counteracted via miR-582-3p inhibitor (Figure 5(f)). ADAM10 level was inversely associated with a miR-582-3p level, and positively related to circ_0000595 level in the aortic tissues of TAA patients (Figure 5(g) and (h)). All in all, circ_0000595 might act as a sponge for miR-582-3p to increase ADAM10 expression.

Figure 5.

Circ_0000595 contributed to ADAM10 expression by sponging miR-582-3p in VSMCs. (a) The predicted miR-582-3p-binding sites in ADAM 3′UTR WT and MUT sequences were shown. (b) The relative luciferase activity of ADAM 3′UTR WT and MUT vectors was measured by dual-luciferase reporter assay. (c) ADAM10 protein expression was measured by western blotting after transfecting with miR-NC, miR-582-3p, in-miR-NC, or in-miR-582-3p. (d–e) ADAM10 protein expression was examined by qRT-PCR and western blotting in TAA tissues and control tissues. (f) ADAM10 protein expression was examined by western blotting after transfecting si-NC or si-circ_0000595#2 or in-miR-NC and in-miR-582-3p. (g–h) Pearson correlation analysis was performed between relative ADAM10 mRNA and miR-582-3p or circ_0000595 levels in TAA tissues. **p < 0.01 and ***p < 0.001.

MiR-582-3p attenuated CoCl₂-mediated impacts by targeting ADAM10 in VSMCs

To explore the regulatory role of the miR-582-3p/ADAM10 axis on CoCl₂-mediated in VSMC process, the transfection efficiency of ADAM10 overexpression plasmid was confirmed in VSMCs (Figure 6(a)). Western blot assay exhibited that miR-582-3p upregulation attenuated the promotion of CoCl₂ exposure on ADAM protein expression, whereas this impact was rescued by overexpressed ADAM10 (Figure 6(b)). The function experiments data exhibited that enhanced ADAM10 abolished the promotion of miR-582-3p on the CoCl₂-repressed VSMC proliferation (Figure 6(c) to (e)). Besides, miR-582-3p overexpression relieved the promotion of CoCl₂ treatment on the cell apoptosis in VSMCs, which was reverted after transfection of ADAM10 overexpression plasmid (Figure 6(f) to (h)). Meanwhile, miR-582-3p overexpression-mediated Bax protein level reduction and the protein levels of PCNA and Bcl-2 enhancement in CoCl₂-induced VSMCs were rescued by overexpressed ADAM10 (Figure 6(i)). Collectively, these outcomes confirmed that miR-582-3p repressed CoCl₂-mediated impacts in VSMCs via interacting with ADAM10. Above all, our results displayed that CoCl₂ upregulated the expression of circ_0000595, which sponged miR-582-3p to promote ADAM10 expression, thereby inhibiting proliferation and promoting apoptosis in VSMCs (Figure 7).

Figure 6.

MiR-582-3p hindered CoCl₂-mediated impacts via interacting with ADAM10. (a) The protein expression of ADAM10 was detected by western blotting to confirm the transfection efficiency. Then, VSMCs were treated differently and divided into six groups (control, CoCl_2, CoCl₂ + miR-NC, CoCl₂ + miR-582-3p, CoCl₂ + miR-582-3p + pcDNA, and CoCl₂ + miR-582-3p + ADAM10). (b) ADAM10 protein expression was detected by western blotting. (c–e) The cell viability and DNA synthesis were measured by CCK-8 assay and EdU assay. (f–g) Flow cytometry assay was employed to examine the cell apoptosis. (h) The relative activity of caspase-3 was measured by a commercial kit. (i) The protein levels of PCNA, Bax, and Bcl-2 were detected by western blotting in VSMCs. *p < 0.05, **p < 0.01 and ***p < 0.001.

Figure 7.

Human aortic smooth muscle cell.

Discussion

Although significant progress has been made in revealing the pathogenesis of TAA, there is no effective medicine for treating TAA, which still posed a threat to most human health.³ As widely believed, hypoxia has been broadly studied in the pathogenesis of many cardiovascular diseases.²¹ In the wall of large arteries, luminal blood diffusion is the main source of nutrients and oxygen for the luminal side cells, whereas perfusion through vasa vasorum provided nourishment to the abluminal side cells. Any change in these processes, or alteration in cellular oxygen consumption by the cell, will produce a hypoxic microenvironment.²² In aneurysms, hypoxia might stimulate inflammatory processes via the secretion of pro-inflammatory factors and upregulation of MMP secreted by smooth muscle cells, thereby influencing the structural integrity of the aortic wall and vascular wall remodeling.^23–25 Apart from that, the abnormal function of aortic VSMCs (decreased proliferation ability and increased apoptosis ratio) has been confirmed to be one of the characteristics of TAA.^6,26 Therefore, in the present study, CoCl₂ was used to establish a model of VSMC hypoxia to induce VSMC dysfunction.¹⁵ Experimental data confirmed that CoCl₂ suppressed VSMC proliferation and boosted VSMC apoptosis. In addition, highly expressed circ_0000595 was found in TAA tissue and CoCl₂-induced VSMCs. Mechanism research results suggested that circ_0000595 might function as the competing endogenous RNA (ceRNA) to sequester miR-582-3p away from ADAM10, thereby promoting VSMC dysfunction and leading to the occurrence of TAA.

Accumulating studies have shown that circRNA was closely related to many cell biological functions, such as cell growth, apoptosis, metabolism, hypoxia response, and so on.^27,28 Since circRNAs have the regulatory potency of gene expression, they have been identified to be an underlying disease biomarker and therapeutic target.¹² For example, circDNM3OS might accelerate cholangiocarcinoma cell motility and glutamine metabolism via binding to miR-145-5p.²⁹ Moreover, the circCBFB has been reported to be involved in the regulation of VSMC apoptosis by interacting with miR-28-5p in abdominal aortic aneurysms.¹⁴ In this study, circ_0000595, an obviously increased circRNA in aortic aneurysm tissues,¹⁵ was used as the target to study the pathogenesis of TAA. The results showed that circ_0000595 was significantly upregulated in TAA tissue and CoCl₂-induced VSMCs. In addition, CoCl₂ might significantly hinder cell proliferation and promote apoptosis in VSMCs, and silencing circ_0000595 almost reversed the dysfunction of VSMC induced by CoCl₂.

In the process of further molecular mechanism exploration, miR-582-3p was found to possess some binding sites with circ_0000595 in VSMCs, followed by validation using dual-luciferase reporter and RIP assay. It has been reported that dysregulated miR-582-3p played a cancer-promoting or anti-tumor effect in a variety of diseases, including leukemia,³⁰ hepatocellular carcinoma,³¹ osteoarthritis,³² and cervical adenocarcinoma.³³ However, miR-582-3p expression in TAA patient tissues and its role in the pathogenesis of TAA have not been reported yet. Here, miR-582-3p was significantly downregulated, and negatively correlated with the circ_0000595 level in TAA tissues. Functional experiments further confirmed that miR-582-3p improved VSMC dysfunction induced by CoCl₂. Additionally, miR-582-3p knockdown could relieve the influence of circ_0000595 silencing on CoCl₂-stimulated VSMC dysfunction, implicating that miR-582-3p served as a suppressor in TAA evolution.

ADAM10 belongs to a member of the A Disintegrin and metalloproteinase family, which might cleave myriad types of trans-membrane protein through ectodomain shedding or regulate intramembrane proteolysis.³⁴ Recent work suggested that the overexpression of ADAM10 might contribute to the development and progression of many human cancers.^35,36 In addition, Geng and colleagues¹⁸ found that ADAM10 expression was significantly upregulated in the CaCl₂-induced TAA rat model. Jiao et al.²⁰ proved that miR-103a was a therapeutic target for abdominal aortic aneurysm (AAA). Also, miR-103a inhibited AAA progression through negative regulation of ADAM10 expression. The above results suggested the vital role of ADAM10 dysregulation during the AAA and TAA process. The current work displayed that ADAM10 was the target gene of miR-582-3p in VSMCs. In addition, we proved that circ_0000595 facilitated ADAM10 content by modulating miR-582-3p in VSMCs. The rescue experiments verified that overexpressed ADAM10 reversed the impacts of miR-582-3p mimic on the function of VSMCs stimulated by CoCl₂.

In summary, our study confirmed that circ_0000595 might partly abolish CoCl₂-stimulated VSMC proliferation repression and apoptosis promotion by regulating the miR-582-3p/ADAM10 signaling pathway for the first time. These findings might provide new ideas and support for the development of TAA-targeted therapies.

Supplemental Material

Supplemental Material - Circ_0000595 knockdown alleviates CoCl2-mediated effects in VSMCs by regulating the miR-582-3p/ADAM10 axis

Supplemental Material for Circ_0000595 knockdown alleviates CoCl2-mediated effects in VSMCs by regulating the miR-582-3p/ADAM10 axis by Huixiong Wang, Hao Wang, Kai Liu, Xiao Qin in Vascular

Footnotes

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) received no financial support for the research, authorship, and/or publication of this article.

ORCID iD

Xiao Qin

Supplemental Material

Supplemental material for this article is available online.

References

Martin-Blazquez

Heredero

Aldamiz-Echevarria

, et al. Non-syndromic thoracic aortic aneurysm: cellular and molecular insights. J Pathol 2021; 254(3): 229–238.

Sidloff

Choke

Stather

, et al. Mortality from thoracic aortic diseases and associations with cardiovascular risk factors. Circulation 2014; 130(25): 2287–2294.

Oishi

Mizuno

Fujiwara

, et al. Surgical strategy for inflammatory thoracic aortic aneurysms in the endovascular surgery era. J Vasc Surg 2022; 75(1): 74.e2–80.e2.

Cooper

Salzler

Ryer

, et al. The combined use of thoracic and abdominal aortic stent grafts for endovascular repair of wide neck abdominal aortic aneurysms in high risk patients. Ann Vasc Surg 2021; 77: 350.e1–350350.e7.

Bradley

Bowdin

Morel

CFJ

, et al. The expanding clinical spectrum of extracardiovascular and cardiovascular manifestations of heritable thoracic aortic aneurysm and dissection. Can J Cardiol 2016; 32(1): 86–99.

Zhang

Guo

, et al. Long noncoding RNA hypoxia-inducible factor-1 alpha-antisense rna 1 regulates vascular smooth muscle cells to promote the development of thoracic aortic aneurysm by modulating apoptotic protease-activating factor 1 and targeting let-7g. J Surg Res 2020; 255: 602–611.

Wang

Xuan

, et al. Hypoxia-inducible factor 1 in clinical and experimental aortic aneurysm disease. J Vasc Surg 2018; 68(5): 1538–1550.

Verduci

Tarcitano

Strano

, et al. CircRNAs: role in human diseases and potential use as biomarkers. Cell Death Dis 2021; 12(5): 468.

Tao

Zheng

, et al. CircRNAs and their regulatory roles in cancers. Mol Med 2021; 27(1): 94.

10.

, et al. Circular RNAs: Their role in the pathogenesis and orchestration of breast cancer. Front Cell Dev Biol 2021; 9: 647736.

11.

Tang

Ren

Guo

, et al. Review on circular RNAs and new insights into their roles in cancer. Comput Struct Biotechnol J 2021; 19: 910–928.

12.

Harper

Mottram

Whitehouse

. Insights into the evolving roles of circular RNAs in cancer. Cancers (Basel) 2021; 13(16): 4180.

13.

Ding

Zhu

Liang

, et al. Circular RNAs in Vascular Functions and Diseases. Adv Exp Med Biol 2018; 1087: 287–297.

14.

Yue

Zhu

Yang

, et al. CircCBFB-mediated miR-28-5p facilitates abdominal aortic aneurysm via LYPD3 and GRIA4. Life Sci 2020; 253: 117533.

15.

Zheng

Niu

, et al. Cyclic RNA hsacirc000595 regulates apoptosis of aortic smooth muscle cells. Mol Med Rep 2015; 12(5): 6656–6662.

16.

Chen

Tong

, et al. Identification of a circRNA-miRNA-mRNA regulatory network for exploring novel therapeutic options for glioma. PeerJ 2021; 9: e11894.

17.

Lian

Zhang

, et al. CircGNG4 romotes the progression of prostate cancer by sponging miR-223 to enhance EYA3/c-myc expression. Front Cell Dev Biol 2021; 9: 684125.

18.

Geng

Wang

Chen

, et al. Elevation of ADAM10, ADAM17, MMP-2 and MMP-9 expression with media degeneration features CaCl2-induced thoracic aortic aneurysm in a rat model. Exp Mol Pathol 2010; 89(1): 72–81.

19.

Shen

Dong

, et al. hsa-miR-320d and hsa-miR-582, miRNA Biomarkers of Aortic Dissection, Regulate Apoptosis of Vascular Smooth Muscle Cells. J Cardiovasc Pharmacol 2018; 71(5): 275–282.

20.

Jiao

Yao

Zhang

, et al. Role of MicroRNA-103a Targeting ADAM10 in Abdominal Aortic Aneurysm. Biomed Res Int 2017; 2017: 9645874.

21.

Lim

Kiriakidis

Sandison

, et al. Hypoxia-inducible factor pathway and diseases of the vascular wall. J Vasc Surg 2013; 58(1): 219–230.

22.

Santilli

Fiegel

Knighton

. Changes in the aortic wall oxygen tensions of hypertensive rabbits. Hypertension and aortic wall oxygen. Hypertension 1992; 19(1): 33–39.

23.

Tamarina

McMillan

Shively

, et al. Expression of matrix metalloproteinases and their inhibitors in aneurysms and normal aorta. Surgery 1997; 122(2): 264–271.

24.

Yang

Fan

Wang

, et al. BMP-2 enhances the migration and proliferation of hypoxia-induced VSMCs via actin cytoskeleton, CD44 and matrix metalloproteinase linkage. Exp Cell Res 2018; 368(2): 248–257.

25.

Erdozain

Pegrum

Winrow

, et al. Hypoxia in abdominal aortic aneurysm supports a role for HIF-1α and Ets-1 as drivers of matrix metalloproteinase upregulation in human aortic smooth muscle cells. J Vasc Res 2011; 48(2): 163–170.

26.

Xiao

, et al. LncRNA Sox2ot modulates the progression of thoracic aortic aneurysm by regulating miR-330-5p/Myh11. Biosci Rep 2020; 40(7): BSR20194040.

27.

Rigoutsos

Lee

Nam

, et al. N-BLR, a primate-specific non-coding transcript leads to colorectal cancer invasion and migration. Genome Biol 2017; 18(1): 98.

28.

Zhou

Zhan

Huang

, et al. The functions and clinical significance of circRNAs in hematological malignancies. J Hematol Oncol 2020; 13(1): 138.

29.

Wang

, et al. Circular RNA circDNM3OS functions as a miR-145-5p sponge to accelerate cholangiocarcinoma growth and glutamine metabolism by upregulating MORC2. Onco Targets Ther 2021; 14: 1117–1129.

30.

Tian

Wang

, et al. MicroRNA-582-3p negatively regulates cell proliferation and cell cycle progression in acute myeloid leukemia by targeting cyclin B2. Cell Mol Biol Lett 2019; 24: 66.

31.

Zhang

Dong

Tang

, et al. MiR-146b protects against the inflammation injury in pediatric pneumonia through MyD88/NF-κB signaling pathway. Infect Dis 2020; 52(1): 23–32.

32.

Xie

. MiR-582-3p alleviates osteoarthritis progression by targeting YAP1. Mol Immunol 2020; 128: 258–267.

33.

Zhang

Huang

, et al. circEYA1 Functions as a Sponge of miR-582-3p to Suppress Cervical Adenocarcinoma Tumorigenesis via Upregulating CXCL14. Mol Ther Nucleic Acids 2020; 22: 1176–1190.

34.

Harrison

Koo

Tomlinson

. Regulation of ADAM10 by the TspanC8 Family of Tetraspanins and Their Therapeutic Potential. Int J Mol Sci 2021; 22(13): 6707.

35.

Liu

Zheng

Zhang

, et al. CircFOXM1 silencing represses cell proliferation, migration and invasion by regulating miR-515-5p/ADAM10 axis in prostate cancer. Anticancer Drugs 2022; 33(1): e573–e583.

36.

Cheng

Lin

, et al. ADAM10 is involved in the oncogenic process and chemo-resistance of triple-negative breast cancer via regulating Notch1 signaling pathway, CD44 and PrPc. Cancer Cell Int 2021; 21(1): 32.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.09 MB

Circ_0000595 knockdown alleviates CoCl2-mediated effects in VSMCs by regulating the miR-582-3p/ADAM10 axis

Abstract

Background

Methods

Results

Conclusion

Keywords

Introduction

Materials and methods

Tissue samples

Cell lines

Quantitative real-time PCR (qRT-PCR)

Subcellular localization of circ_0000595

RNase R assay

Actinomycin D (ActD) assay

Cell transfection

Cell counting kit 8 (CCK-8) assay

5-ethynyl-2-deoxyuridine (EdU) assay

Determination of cell apoptosis

Western blotting

Bioinformatics analysis and dual-luciferase reporter system

RNA immunoprecipitation (RIP) assay

Statistical analysis

Results

Circ_0000595 was upregulated in TAA tissue and hypoxic VSMCs

Depletion of circ_0000595 attenuated CoCl2-mediated impacts in VSMCs

MiR-582-3p was a target of circ_0000595

Circ_0000595 knockdown suppressed CoCl2-mediated impacts via sponging miR-582-3p in VSMCs

Circ_0000595 indirectly facilitated ADAM10 expression via sponging miR-582-3p

MiR-582-3p attenuated CoCl2-mediated impacts by targeting ADAM10 in VSMCs

Discussion

Supplemental Material

Supplemental Material - Circ_0000595 knockdown alleviates CoCl2-mediated effects in VSMCs by regulating the miR-582-3p/ADAM10 axis

Footnotes

Declaration of conflicting interests

Funding

ORCID iD

Supplemental Material

References

Supplementary Material

Depletion of circ_0000595 attenuated CoCl₂-mediated impacts in VSMCs

Circ_0000595 knockdown suppressed CoCl₂-mediated impacts via sponging miR-582-3p in VSMCs

MiR-582-3p attenuated CoCl₂-mediated impacts by targeting ADAM10 in VSMCs