Zinc oxide influences intestinal integrity,the expressions of genes associated with inflammation and TLR4-myeloid differentiation factor 88 signaling pathways in weanling pigs

Abstract

This study explored whether zinc oxide (ZnO) supplementation could alleviate weanling-induced intestinal injury through TLR and NOD-like receptor signaling pathways. Twelve early-weanling piglets were allotted to two dietary treatments (control vs 2200 mg Zn/kg from ZnO) for 1 wk. The results showed that supplemental ZnO improved daily gain and feed intake, decreased post weaning scour scores, increased villus height and villus height:crypt depth ratio at the jejunal mucosa, and decreased diamine oxidase activity and endotoxin concentration in plasma. The intestinal mRNA levels of TLR4 and its downstream signals, including MyD88, IL-1 receptor-associated kinase 1 and TNF-α receptor-associated factor 6, were decreased, and the expressions of intestinal pro-inflammatory cytokines and chemokines were decreased simultaneously in the ZnO-supplemented piglets. Although NF-κB p65 mRNA abundance was not affected by ZnO supplementation, NF-κB p65 protein expression was down-regulated by ZnO. However, ZnO supplementation had no effect on intestinal expressions of NOD1 and NOD2, and their adaptor molecule receptor-interacting serine/threonine-protein kinase 2, as well as protein expressions of caspase-3 and heat shock protein 70. The results indicated that the protective effects of ZnO on intestinal integrity were closely related to decreasing the expressions of genes associated with inflammation through inhibiting the TLR4-MyD88 signaling pathways.

Keywords

Intestinal integrity myeloid differentiation factor 88 nucleotide-binding oligomerization domain protein Toll-like receptor 4 weanling pig zinc oxide

Introduction

Weaning is the most significant event in the life of pigs as they are abruptly forced to adapt to nutritional, immunological and psychological disruptions.¹ The weaning transition of piglets is commonly associated with growth retardation and impaired intestinal barrier.^1–4 One of the major problems in nursery pig management is post-weaning syndrome, which includes post-weaning diarrhea and endotoxin shock.⁵ It is widely accepted that endotoxin plays an important role in the development of post-weaning diarrhea.⁵ Endotoxin shock is a shock-like syndrome that is caused by the systemic effects of endotoxin, and usually occurs 1 wk after weaning.⁵

Early-weaned piglets are susceptible to immunologic challenge as a result of their immature immune and digestive systems.⁶ It has been well documented that weaning triggers intestinal inflammation, marked by an up-regulated expression of pro-inflammatory cytokines in the intestine, such as TNF-α, IL-6, IL-1β and INF-γ.^4,7,8 The inflammatory response and subsequent overproduction of pro-inflammatory cytokines induce a disrupted intestinal barrier function.^1,4,6 From the nutritional perspective, controlling early intestinal inflammation is certainly a challenge in managing post-weaning intestinal disorders in piglet.^4,8

It is well known that zinc (Zn) is involved in resistance to inflammation, diarrhea and infection.^9–11 The role of Zn in restoration of mucosal barrier integrity has been demonstrated both in vitro and in vivo.^9,10,12 The duration and severity of diarrhea can be controlled by Zn supplementation.^9–11 In particular, zinc oxide (ZnO) appears to have a strong effect in resistance to intestinal diseases.¹² Supplementing pharmacologic concentrations of ZnO (between 2000 and 4000 mg/kg of Zn) in weanling piglets alleviates post-weaning diarrhea and improves growth performance.^9,10,13 Although there is evidence suggesting that the beneficial role of ZnO in the intestine is closely related to the down-regulation of pro-inflammatory cytokines,^9,10,14 the underlying mechanisms remain largely unknown.

In the gut, two classes of PRRs, the TLRs and the NLRs, play a crucial role in the recognition of PAMPs by the mucosal immune system.¹⁵ TLRs are membrane-anchored proteins that are expressed either at the cell surface or associated with intracellular organelles, whereas NLRs are localized in cell cytosol.¹⁵ A key hallmark of inflammation is the induction of the NF-κB pathway, which is responsible for turning on pro-inflammatory cytokines and chemokines.¹⁵ The activation of NF-κB is triggered both by TLRs and some NLRs.

We hypothesized that dietary ZnO supplementation would improve the intestinal barrier by regulating the production of pro-inflammatory cytokines through modulation of TLR and NLR signaling pathways. In the present study, we employed an early-weanling porcine model, to explore whether ZnO supplementation could alleviate weanling-induced intestinal injury through the TLR4 and NLR signaling pathways.

Materials and methods

Experimental design and pig care

All procedures were approved by the Animal Care and Use Committee, Zhejiang University. A total of 12 barrows (Duroc × Landrace × Yorkshire) were weaned at 21 d of age [6.1 ± 0.4 kg body mass (BM)] and randomly assigned to two groups based on BM and litter of origin. The two treatments were: (1) control, basal diet; (2) basal diet +2200 mg/kg of Zn from ZnO. The basal diet was formulated according to the National Research Council requirements.¹⁶ The ingredients and composition of the basal diet are shown in Table 1. All piglets were individually housed in 1.3 × 1.2 m² pens in an environmentally controlled nursery barn. Each treatment had six replicate pens. The piglets were given ad libitum access to feed and water. The feeding experiment lasted 7 d. Average daily gain, average daily feed intake and feed conversion efficiency were calculated. Fecal scores were visually assessed every day on a five-point scale ranging from 1 to 5 according to the method of Hu et al.^9,10,13: 1 = no diarrhea, hard feces; 2 = no diarrhea, normal consistency of feces; 3 = mild diarrhea, soft and partially formed feces; 4 = moderate diarrhea, semi-liquid feces; and 5 = severe diarrhea, watery feces.

Table 1.

Ingredient and composition of the basal diet (as-fed basis).

Ingredients (g/kg)
Corn	560
Soybean meal	294
Fish meal	55
Dried whey	45
Soybean oil	15
Limestone meal	5
Dicalcium phosphate	11.5
Sodium chloride	3
L-Lysine hydrochloric acid	1
DL-Methionine	0.5
Vitamin-mineral premix^a	10
Analyzed composition (g/kg)
Digestible energy^b (MJ/kg)	14.4
Crude protein	215.3
Lysine	14.6
Methionine	3.8
Calcium	9.1
Total phosphorus	7.3
Zn (mg/kg)	127.9

Provided per kg of diet: vitamin A, 6000 IU; vitamin D₃, 500 IU; vitamin E, 40 IU; pantothenic acid, 20 mg; niacin, 30 mg; riboflavin, 5.0 mg; vitamin K₃, 1.5 mg; thiamine, 2.0 mg; pyridoxine, 3.0 mg; biotin, 0.10 mg; folic acid, 0.6 mg; vitamin B₁₂, 0.04 mg; choline, 800 mg; Cu (CuSO₄·5H₂O), 16 mg; Zn (ZnSO₄), 100 mg; Fe (FeSO₄), 125 mg; Mn (MnSO₄·H₂O), 15 mg; I (KI), 0.2 mg; Se (Na₂SeO₃), 0.3 mg.

Digestible energy was calculated from data provided by Feed Database in China.

Sample collections

After the feeding trial, blood samples for diamine oxidase (DAO; EC 1.4.3.6) analysis were taken from the anterior vena cava into tubes containing sodium heparin and mixed immediately to avoid coagulation. Plasma was obtained after centrifugation at 3000 g for 15 min at 4℃ and then stored at −80℃ for DAO analysis. Endotoxin-free needles and tubes containing sodium heparin were used to collect the blood samples for endotoxin analysis according to the procedure of Hagman et al.¹⁷ After sampling, the tubes were immediately placed on ice and centrifuged. The plasma was then transferred by autoclaved pipettes to endotoxin-free glass tubes, frozen and stored at −20℃. Only sterile, pyrogen-free equipment was used. All samples were transported in a Styrofoam box with ice clamps, and arrived within 4 h at the laboratory, where the endotoxin analyses were performed.¹⁷ After blood collection was complete, all the piglets were slaughtered under anesthesia. The gastrointestinal tract was removed immediately. The specimens from the mid-jejunum were excised, flushed with physiological saline and fixed in 10% formalin. The mucosa samples from the middle part of jejunum were harvested by scraping with a sterile glass microscope slide, rapidly frozen in liquid nitrogen and stored at −80℃ for further analysis.

Intestinal morphological analyses

The jejunal segments were dehydrated, embedded and stained with hematoxylin and eosin according to the procedures of Hu et al.^4,13 Villus height and crypt depth were determined using an image processing and analysis system (Version 1; Leica Imaging Systems, Cambridge, UK).

DAO activity in plasma and intestinal mucosa

DAO activity in plasma and intestinal mucosa was measured using an enzymatic spectrophotometric assay, as described by Hu et al.¹³ Cadaverine dihydrochloride, o-dianisidine dihydrochloride, HRP and DAO standard were purchased from Sigma Chemical (St. Louis, MO, USA). DAO activity in plasma and intestinal mucosa was expressed as U/ml and U/mg protein, respectively.

Concentrations of endotoxin in plasma

The plasma endotoxin was analyzed using a standard limulus amebocyte lysate assay.¹⁷ The endotoxin testing kit was purchased from Zhanjiang Bokang Marine Biological (Zhanjiang, China). The procedures were carried out following the manufacturer’s protocol.

mRNA expression analysis by real-time PCR

The mRNA levels of cytokines and chemokine, as well as TLR4, NOD and their downstream signals, were determined by real-time PCR as described by Liu et al.¹⁸ and Chen et al. ¹⁹ Briefly, total RNA was extracted from jejunal mucosa using the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s guidelines. RNA was spectrophotometrically quantified and its integrity was verified by agarose gel electrophoresis. Reverse transcription using the PrimeScripte RT reagent kit (TaKaRa Biotechnology, Dalian, China) was carried out following the manufacturer’s instructions. Quantitative analysis of PCR was carried out on a StepOne Plus real-time PCR system (Applied Biosystems, Foster City, CA, USA) using a SYBR Green Master mix (Promega, Madison, WI, USA), according to the manufacturer’s instructions. The primers used are presented in Table 2. The 2^−ΔΔCt method was used to analyze the relative changes in each target gene expression.²⁰ The change (Δ) in Ct values in the each group was compared with the Ct value of GAPDH (ΔCt). Subsequently, ΔΔCT was computed for each target gene from the ZnO groups by subtracting the average ΔCT for the control group. The final fold differences were computed as 2^−ΔΔCt for each target gene. All samples were run in triplicate. Our results showed that GAPDH exhibited no difference between two groups.

Table 2.

Primer sequences used for real-time PCR.^a

Primer name	Primer sequence	Size (bp)	Accession numbers
TNF-α	F:5′CATCGCCGTCTCCTACCA3′	199	NM_214022.1
TNF-α	R:5′CCCAGATTCAGCAAAGTCCA3′	199	NM_214022.1
IFN-γ	F:5′GAGCCAAATTGTCTCCTTCTAC3′	140	NM_213948.1
IFN-γ	R:5′CGAAGTCATTCAGTTTCCCAG3′	140	NM_213948.1
IL-6	F:5′ ATCAGGAGACCTGCTTGATG 3′	177	NM_001252429.1
IL-6	R:5′ TGGTGGCTTTGTCTGGATTC 3′	177	NM_001252429.1
CXCL2/GRO β	F:5′ TGCTGCTCCTGCTTCTAGTG 3′	171	AY578786.1
CXCL2/GRO β	R:5′ TGGCTATGACTTCCGTTTGG 3′	171	AY578786.1
CXCL10/IP-10	F:5′ CCCACATGTTGAGATCATTGC 3′	168	NM_001008691.1
CXCL10/IP-10	R:5′ CATCCTTATCAGTAGTGCCG 3′	168	NM_001008691.1
TLR4	F:5′ TCAGTTCTCACCTTCCTCCTG 3′	166	GQ503242.1
TLR4	R:5′ GTTCATTCCTCACCCAGTCTTC 3′	166	GQ503242.1
MyD88	F:5′ GATGGTAGCGGTTGTCTCTGAT 3′	148	AB292176.1
MyD88	R:5′ GATGCTGGGGAACTCTTTCTTC 3′	148	AB292176.1
IRAK1	F:5′ CAAGGCAGGTCAGGTTTCGT 3′	115	XM_003135490.1
IRAK1	R:5′ TTCGTGGGGCGTGTAGTGT 3′	115	XM_003135490.1
TRAF6	F:5′ CAAGAGAATACCCAGTCGCACA 3′	122	NM_001105286.1
TRAF6	R:5′ ATCCGAGACAAAGGGGAAGAA 3′	122	NM_001105286.1
NOD1	F:5′ CTGTCGTCAACACCGATCCA 3′	57	AB187219.1
NOD1	R:5′ CCAGTTGGTGACGCAGCTT 3′	57	AB187219.1
NOD2	F:5′ GAGCGCATCCTCTTAACTTTCG 3′	66	AB195466.1
NOD2	R:5′ ACGCTCGTGATCCGTGAAC 3′	66	AB195466.1
RIPK2	F:5′ CAGTGTCCAGTAAATCGCAGTTG 3′	206	XM_003355027.1
RIPK2	R:5′ CAGGCTTCCGTCATCTGGTT 3′	206	XM_003355027.1
NF-κB p65	F:5′ GTGTGTAAAGAAGCGGGACCT 3′	139	EU399817.1
NF-κB p65	R:5′ CACTGTCACCTGGAAGCAGAG 3′	139	EU399817.1
GAPDH	F:5′ CGTCCCTGAGACACGATGGT 3′	194	AF017079.1
GAPDH	R:5′ GCCTTGACTGTGCCGTGGAAT 3′	194	AF017079.1

Protein expression analysis by Western blot

Western blot analysis was performed as described by Liu et al.¹⁸ Briefly, the intestinal mucosa samples were homogenized in lysis buffer and centrifuged to collect the supernatants. Intestinal mucosa proteins were separated on a polyacrylamide gel and transferred onto polyvinylidene difluoride membranes. The membranes were incubated overnight (12–15 h) at 4℃ with primary Abs and then with the secondary Ab for 120 min at room temperature (22℃). The primary Abs [Caspase-3 rabbit mAb, heat shock protein (HSP)70 rabbit mAb, NF-κB p65 rabbit mAb, β-actin rabbit mAb] were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA). The secondary Ab was HRP-conjugated anti-rabbit Ab. Western blot was detected with an Enhanced Chemiluminescence detection kit (Amersham, Arlington Heights, IL, USA), photographed by the ChemiScope 3400 machine (Clinx Science Instruments, Shanghai, China), and analyzed using Quantity One software. The β-actin was used as an internal control, which exhibited no difference between the groups. The relative abundance of each target protein was expressed as target protein/β-actin protein ratio.

Statistical analysis

Data were analyzed using the SAS statistical package (SAS Institute, Cary, NC, USA),²¹ with each animal as an experimental unit. Results are expressed as mean ± SD. Differences between means were tested using Student’s t-test. Differences were considered significant at P < 0.05.

Results

Scouring index and growth performance

The effects of ZnO on scouring index and performance of weanling pigs are shown in Table 3. As compared with the control, dietary addition of 2200 mg Zn/kg from ZnO decreased (P < 0.05) the post-weaning scour scores, and improved (P < 0.05) average daily gain and daily feed intake.

Table 3.

Effects of ZnO on scouring index and performance of weanling pigs.^a

Control	ZnO
Scouring index	4.18 ± 0.38	2.01 ± 0.26^*
Average daily gain, g	141.15 ± 12.15	160.37 ± 10.79^*
Daily feed intake, g	178.25 ± 13.24	203.56 ± 14.95^*
Feed:gain	1.26 ± 0.09	1.27 ± 0.08

Values are means ± SD (n = 6).

Differences were considered significant at P < 0.05.

Intestinal morphology and barrier function

The effects of ZnO on intestinal morphology and barrier function are shown in Table 4. Compared with the control, dietary addition of 2200 mg Zn/kg from ZnO increased (P < 0.05) villus height and the villus height:crypt depth ratio at the jejunal mucosa, and decreased (P < 0.05) DAO activity and endotoxin concentration in plasma. However, there was no difference (P > 0.05) for DAO in intestinal mucosa between the two groups.

Table 4.

Effect of ZnO on jejunal morphology and barrier function of weanling pigs.^a

Control	ZnO
Villus height, µm	504.28 ± 42.62	637.65 ± 38.79*
Crypt depth, µm	268.61 ± 20.47	246.08 ± 18.36
Villus height: crypt depth	1.88 ± 0.16	2.59 ± 0.21*
Jejunal mucosa DAO, U/mg protein	0.16 ± 0.04	0.20 ± 0.05
Plasma DAO, U/ml	2.96 ± 0.52	1.74 ± 0.36^*
Plasma endotoxin, U/ml	0.16 ± 0.06	0.07 ± 0.04^*

Values are means ± SD (n = 6).

Differences were considered significant at P < 0.05.

Intestinal mRNA expressions of cytokines and chemokines

The effects of ZnO on mRNA relative expressions of cytokines and chemokines in intestinal mucosa of piglets are shown in Table 5. Compared with the control, dietary addition of 2200 mg Zn/kg from ZnO decreased (P < 0.05) mRNA levels of TNF-α, IFN-γ, chemokine C-X-C motif ligand (CXCL2) in jejunal mucosa. There was no difference (P > 0.05) for mRNA levels of IL-6 and CXCL10 between the two groups.

Table 5.

Effect of ZnO on cytokine and chemokine mRNA relative expressions in jejunal mucosa of piglets.^a

Control	ZnO
TNF-α	1.00 ± 0.24	0.32 ± 0.08*
IFN-γ	1.00 ± 0.26	0.41 ± 0.09*
IL-6	1.00 ± 0.32	0.72 ± 0.24
CXCL2	1.00 ± 0.28	0.45 ± 0.12*
CXCL10	1.00 ± 0.35	0.76 ± 0.28

The 2^−ΔΔCt method was used to analyze the relative expression (fold changes), calculated relative to the control group. Values are means ± SD (n = 6).

Differences were considered significant at P < 0.05.

Intestinal mRNA expressions of TLR4 and NOD and their downstream signals

The effects of ZnO on mRNA relative expressions of TLR4 and NOD and their downstream signals in intestinal mucosa of piglets are shown in Table 6. Compared with the control, dietary addition of 2200 mg Zn/kg from ZnO decreased (P < 0.05) mRNA expressions of TLR4, MyD88, IL-1 receptor-associated kinase 1 (IRAK1), TNF-α receptor-associated factor 6 (TRAF6) in jejunal mucosa. However, there was no difference (P > 0.05) for jejunal NOD1, NOD2, NF-κB p65, and receptor-interacting serine/threonine-protein kinase 2 (RIPK2) between the two groups.

Table 6.

Effects of ZnO on mRNA expressions of TLR4 and NOD and their downstream signals in weanling pigs.^a

Control	ZnO
TLR4	1.00 ± 0.26	0.33 ± 0.10*
MyD88	1.00 ± 0.24	0.43 ± 0.13*
IRAK1	1.00 ± 0.25	0.38 ± 0.14*
TRAF6	1.00 ± 0.21	0.31 ± 0.09*
NOD1	1.00 ± 0.32	1.26 ± 0.40
NOD2	1.00 ± 0.27	0.84 ± 0.29
RIPK2	1.00 ± 0.28	1.12 ± 0.32
NF-κB p65	1.00 ± 0.34	0.92 ± 0.36

The 2^−ΔΔCt method was used to analyze the relative expression (fold changes), calculated relative to the control group. Values are means ± SD (n = 6).

Differences were considered significant at P < 0.05.

Intestinal protein expressions of HSP 70, caspase-3 and NF-κB p65

The effects of ZnO on HSP 70, caspase-3 and NF-κB p65 protein expressions in intestinal mucosa of piglets are shown in Figure 1. Compared with the control, dietary addition of 2200 mg Zn/kg from ZnO decreased (P < 0.05) NF-κB p65 protein expression in jejunal mucosa. However, there was no difference (P > 0.05) for jejunal caspase-3 and HSP 70 protein expressions between the two groups.

Figure 1.

Effects of ZnO on caspase-3, HSP 70 and NF-κB p65 protein expressions in jejunal mucosa of weanling piglets. The bands are representative blots from one of six pigs. The relative protein expression was expressed as the ratio of the target protein and β-actin. Data are means ± SD (n = 6). *Differences were considered significant at P < 0.05.

Discussion

Weaning piglets are abruptly forced to combine stressors, such as removal from sow and littermates, transportation to a new environment and abrupt changes in diet.⁴ Growth retardation, intestinal disorders and post-weaning diarrhea are common problems in weaned piglets.^1–4 Barnett et al.²² reported that most pigs began scouring 4–5 d post-weaning; scouring peaked at d 8 post-weaning and returned to normal after d 15 post-weaning. A large body of evidence has demonstrated that supplementing nursery pigs with 2000–4000 mg Zn/kg from ZnO alleviates post-weaning diarrhea and improves growth performance.^1,9,10,13 As previously reported, the present study showed that dietary addition of 2200 mg Zn/kg from ZnO decreased post-weaning scour scores, and increased daily gain and feed intake in newly weaned pigs.

Compromising alterations in villus crypt structure, such as villus atrophy and crypt hyperplasia, are generally seen in newly weaned piglets.^4,5 The minimal value of villous height:crypt depth ratio occurs at about 6 d after weaning.⁵ In the present study, the shorter villus and deeper crypt observed in the control treatment verified the weanling-induced intestinal structural injury. Our data indicating that ZnO supplementation increased the villus height:crypt depth ratio at the jejunal mucosa is consistent with the previous reports.^9,13

Apart from the function of the digestion and absorption of nutrients, the small-intestinal epithelium serves as a barrier against noxious antigens and pathogens.³ Impaired intestinal barrier function may promote the translocation of bacteria, and the entering of allergenic compounds from the gut into the body.³ This results in immunologic responses and an increased susceptibility to infections.³ A large body of evidence has demonstrated that the small-intestinal barrier and absorptive functions deteriorate within a short time of weaning.^1–4 Using either the Ussing chamber technique or orally administered marker probes, the paracellular barrier function is reported to be decreased when pigs are weaned at 3 wks of age or earlier.^1–4 Plasma DAO has been suggested as a quantitative and sensitive circulating marker for monitoring the extent of intestinal mucosal injury.^13,23 DAO is found exclusively in the villi of the small intestine. When intestinal mucosal integrity is damaged, an increased amount of DAO is released into blood.^13,23 Considerable research has shown that Zn played a role in maintaining epithelial barrier integrity and function.^9–13 In the present study, ZnO supplementation improved the intestinal barrier, manifested by decreased plasma DAO activity in weaned pigs, which was consistent with previous reports.¹³ Endotoxin (LPS), which is part of the cell wall of Gram-negative bacteria, is released into the circulation when the bacteria overgrow or the intestinal barrier is destroyed.¹⁷ It is widely accepted that endotoxin is closely related to the development of post-weaning diarrhea.⁵ Our observations that ZnO supplementation decreased plasma endotoxin concentration supported the improved intestinal barrier.

Weaning-associated intestinal inflammation occurs in various animal species.⁸ In mice, weaning induced an increase in the number of specific cytokine-secreting intestinal lymphocytes, and changed the distribution of lymphocyte subsets in the small intestine.^24,25 In rats, weaning was associated with increased IL-1 expression in the intestine.²⁶ In piglets, weaning anorexia contributed to local inflammation in the small intestine.⁷ The intestinal expression of pro-inflammatory cytokines was up-regulated by weaning in the piglets.^4,8 Cytokines play an important role in the immune and inflammatory responses.^4,8 They also participate in the regulation of the intestinal barrier integrity.^4,27 Researches in vitro and in vivo show that over-production of pro-inflammatory cytokines has negative effects on intestinal integrity and epithelial function.^4,18,27 Most pro-inflammatory cytokines, such as TNF-α, IFN-γ and IL-6, induce a pathologic opening of the intestinal tight junction and increase intestinal epithelial permeability.^4,9,27 The barrier disruptive actions of TNF-α and IFN-γ have been well-established.^28,29 TNF-α can act synergistically with INF-γ to induce disruption in tight junctions.^9,27 Controlling the release of intestinal pro-inflammatory cytokines may alleviate intestinal disorders induced by weaning.^4,8 In vitro, ZnO reduced inflammatory response of porcine epithelial IPEC J2 cells to enterotoxigenic Escherichia coli infection,³⁰ and counteracted the up-regulated the expression of the inflammatory IL-8 and TNF-α mRNA levels caused by E. coli K₈₈ in Caco-2 enterocytes.¹² In the present study, ZnO supplementation decreased intestinal mRNA expressions of pro-inflammatory cytokines and chemokines in piglets, indicating that the weaning-induced inflammation was minimized by ZnO supplementation. Our observations were supported by Sargeant et al.,¹⁴ who reported that the chemokine CXCL2 was down-regulated in ZnO-treated piglets by transcriptome analysis. Moeser et al.³¹ reported that mucosal mast cell activation was a critical event mediating the intestinal barrier dysfunction in early-weaned pigs. Mast cell activation leads to degranulation and release of several mediators, such as histamine, cytokines and chemokines, which injure the intestinal structure and increase intestinal permeability.³² The stem cell factor is a chemotactic molecule for mast cells and induces their degranulation.³³ Ou et al.³³ reported that ZnO supplementation inhibits the expression of stem cell factor in small intestine, leading to reductions in the number of mast cells and histamine release. It could be suggested that ZnO improves intestinal integrity partially by inhibiting the expression of genes associated with inflammation in weaned pigs.

To elucidate the mechanisms by which ZnO alleviates the intestinal inflammatory response, we examined the role of TLR and NLR signaling pathways. TLRs and NODs are two major forms of innate immune sensors, which play a crucial role in the activation of the innate system as a result of the recognition of PAMPs in the gut.³⁴ Of them, TLRs are membrane-anchored proteins, whereas NODs are cytoplasmic proteins.¹⁵ TLRs activate immune responses by sensing microbial structures, such as bacterial LPS, viral RNA and endogenous ‘danger’ molecules released by damaged host cells.³⁵ Among the TLRs family, TLR4 is responsible for recognizing endotoxin (LPS) from Gram-negative bacteria. Among the NLRs family, NOD1 and NOD2 possess the ability to connect with LPS and peptidoglycan, and to transduce a TLRs-independent signal.^18,34 MyD88 is an adapter protein that mediates signal transduction for most TLRs, and leads to activation of NF-κB and production of pro-inflammatory cytokines and chemokines.³⁵ Interaction of PAMPs with TLRs or some NLRs triggers multiple downstream intracellular signals that lead to the activation of NF-κB, which then induces activation of inflammatory genes.³⁴ The TLR4–Myd88 signaling pathway has been shown to be involved in intestinal inflammation.^18,19,34 Juul-Madse et al.³⁶ reported that TLR4 + cells were markedly enhanced by weaning in piglets. To our knowledge, the research on ZnO regulating the TLR and NLR signaling pathways is very limited. In the present study, we demonstrated, for the first time, that the intestinal mRNA levels of TLR4 and its downstream signals, including MyD88, IRAK1 and TRAF6, were decreased, and the expressions of intestinal pro-inflammatory cytokines and chemokines were decreased simultaneously in the ZnO-supplemented piglets. Although NF-κB p65 mRNA abundance was not affected by ZnO supplementation, NF-κB p65 protein expression was down-regulated by ZnO. NLRs transmit a TLR-independent signal, which also leads to NF-κB activation via the adaptor molecule RIPK2, and stimulates the synthesis of pro-inflammatory mediators.^18,34 However, we found that ZnO supplementation had no effect on intestinal expressions of NOD1 and NOD2, or their adaptor molecule RIPK2. The results indicated that the protective effects of ZnO on intestinal integrity were closely related to decreasing the expressions of genes associated with inflammation through inhibiting the TLR4–MyD88 signaling pathways.

It has been suggested that the successful prophylactic use of ZnO in preventing diarrhea may be owing to its antibacterial activity.¹ In vitro studies show that ZnO inhibits the growth of Staphylococcus aureus and E. coli.¹ In piglets, high doses of ZnO reduced bacterial translocation from the small intestine to the mesenteric lymph node, and decreased the viable count of E. coli and Clostridium spp. in the intestine.^10,13 ZnO protected cells from enterotoxigenic E. coli (ETEC)-induced damage by inhibiting bacterial adhesion and internalization.¹² It has been reported that weaning alters intestinal microbiota and increases the E. coli:Lactobacilli ratio.^37,38 Weaning removes young pigs from passive immune protection from the milk of the sow and increases their susceptibility to ETEC infection.³² The Gram-negative bacterium E. coli is considered to be one of the main causes of post-weaning diarrhea in pigs.³⁶ TLR4 recognizes endotoxin from Gram-negative bacteria.³⁴ In the present study, ZnO supplementation decreased plasma endotoxin concentration. The influences of ZnO on TLR4–MyD88 signaling pathway in weanling pigs might be related to the altered intestinal microbiota and decreased endotoxin concentration. Moreover, it was reported that ZnO supplementation altered ETEC gene expression of factors involved in the initiation of an immune response, such as LPS or toxin.³⁰ The production of several bacterial toxins, including Shiga and Diptheria toxins, is regulated by Zn concentration.³⁰

HSPs play a central role in the protection of cells, tissues or organs subjected to various types of stressors.³⁹ HSP 70 protects against apoptosis, endotoxins, reactive oxygen species, radiation and ischemia.³⁹ It was reported that HSP acted as inhibitors of NF-κB-mediated cytokine expression.³⁰ There is some evidence to suggest that the reduced inflammatory response with Zn treatment is via the increased expression of stress response proteins.³⁰ Klosterhalfen et al.⁴⁰ found that treatment with Zn²⁺ induced expression of HSP70, and reduced the plasma TNF-α, IL-1β and IL-6 response to LPS in pigs. Van Molle et al.⁴¹ reported that ZnSO₄-treated mice were protected from TNF-induced inflammation, and ZnSO₄ treatment induced HSP70 expression in murine small intestine. However, unlike previous findings, the present study showed that ZnO supplementation had no effect on intestinal caspase-3 and HSP 70 protein expressions. David et al.³⁹ found that weaning modulated the expression of HSP in the intestinal tract of pigs according to spatial-temporal patterns. The expression of HSP 70 was transiently increased between 24 and 48 h post-weaning in the mid-jejunum.³⁹ The discrepancy regarding the effects of ZnO on stress response proteins might be related to their spatial-temporal patterns.

In summary, dietary addition of 2200 mg Zn/kg from ZnO ameliorated weaning-associated growth retardation and intestinal injury. The improved intestinal barrier in pigs fed ZnO was accompanied by reduced intestinal mRNA expression of TLR4, MyD88, IRAKs and TRAF6, as well as reduced intestinal protein expression of NF-kB p65, leading to reduced intestinal pro-inflammatory cytokines and chemokines. The results indicated that the protective effects of ZnO on intestinal integrity were closely related to decreasing the expressions of genes associated with inflammation through inhibiting the TLR4–MyD88 signaling pathways.

Footnotes

Funding

This research was jointly supported by Zhejiang Provincial Qianjiang Talent project of China (No. 2013R10036), National Natural Science Foundation of China (No. 31072039), the “948” Project from the Ministry of Agriculture (No. 2011-G7), and program for Changjiang Scholars and Innovative Research Team in University (No. IRT1040).

Conflict of interest

The authors do not have any potential conflicts of interest to declare.

References

Kim

Hansen

Mullana

. Nutrition and pathology of weaner pigs: nutritional strategies to support barrier function in the gastrointestinal tract. Anim Feed Sci Technol 2012; 173: 3–16.

Smith

Clark

Overman

. Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am J Physiol Gastrointest Liver Physiol 2010; 298: G352–G363.

Wijtten

PJA

Meulen

Verstegen

MWA

. Intestinal barrier function and absorption in pigs after weaning: a review. Br J Nutr 2011; 105: 967–981.

Xiao

Luan

. Early weaning increases intestinal permeability, alters expression of cytokine and tight junction protein, and activates mitogen-activated protein kinases in pigs. J Anim Sci 2013; 91: 1094–1101.

van Beers-Schreurs

HMG

Vellenga

Wensing

. The pathogenesis of the post-weaning syndrome in weaned piglets, a review. Veterinary Quarterly 1992; 14: 29–34.

Liu

Che

. Dietary L-arginine supplementation alleviates liver injury caused by Escherichia coli LPS in weaned pigs. Innate Immun 2012; 18: 804–814.

McCracken

Spurlock

Roos

. Weaning anorexia may contribute to local inflammation in the piglet small intestine. J Nutr 1999; 129: 613–619.

Pié

Lallès

Blazy

. Weaning is associated with an upregulation of expression of inflammatory cytokines in the intestine of piglets. J Nutr 2004; 134: 641–647.

Song

. Diosmectite-ZnO composite improves intestinal barrier function, modulates expression of proinflammatory cytokines and tight junction protein in early weaned pigs. Br J Nutr. Epub ahead of print 11 Jan 2013.

10.

Xiao

Song

. Effects of ZnO supported on zeolite on growth performance, intestinal microflora and permeability, and cytokines expression of weaned pigs. Anim Feed Sci Tech 2013; 181: 65–71.

11.

Song

You

. Zinc oxide-montmorillonite hybrid influences diarrhea, intestinal mucosal integrity and digestive enzyme activity in weaned pigs. Biol Trace Elem Res 2012; 149: 190–196.

12.

Roselli

Finamore

Garaguso

. Zinc oxide protects cultured enterocytes from the damage induced by Escherichia coli. J Nutr 2003; 133: 4077–4082.

13.

Luan

. Effects of montmorillonite–zinc oxide hybrid on performance, diarrhea, intestinal permeability and morphology of weanling pigs. Anim Feed Sci Tech 2012; 177: 108–115.

14.

Sargeant

McDowall

Miller

. Dietary zinc oxide affects the expression of genes associated with inflammation: transcriptome analysis. Vet Immunol Immunop 2010; 137: 120–129.

15.

Magalhaes

Tattoli

Girardin

. The intestinal epithelial barrier: How to distinguish between the microbial flora and pathogens. Semin Immunol 2007; 19: 106–115.

16.

National Research Council. Nutrient requirements of swine, 10th ed. Washington, DC: National Academic Press, 1998.

17.

Hagman

Kindahl

Lagerstedt

. Pyometra in bitches induces elevated plasma endotoxin and prostaglandin f2α metabolite levels. Acta Vet Scand 2006; 47: 55–68.

18.

Liu

Chen

Odle

. Fish oil enhances intestinal integrity and inhibits TLR4 and NOD2 signaling pathways in weaned pigs after LPS challenge. J Nutr 2012; 142: 2017–2024.

19.

Chen

Tian

. Dietary arginine supplementation alleviates immune challenge induced by Salmonella enterica serovar Choleraesuis bacterin potentially through the Toll-like receptor 4-myeloid differentiation factor 88 signalling pathway in weaned piglets. Br J Nutr 2012; 108: 1069–1076.

20.

Livak

Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and 2⁻^ΔΔCt method. Methods 2001; 25: 402–408.

21.

SAS. Institute Inc. SAS/STAT user’s guide, Version 8.1, Cary, NC: SAS Institute, 2000.

22.

Barnett

Kornegay

Risley

. Characterization of creep feed consumption and its subsequent effects on immune response, scouring index and performance of weanling pigs. J Anim Sci 1989; 67: 2698–2708.

23.

Wolvekamp

MCJ

de Bruin

RWF

. Diamine oxidase: an overview of historical, biochemical and functional aspects. Digest Dis 1994; 12: 2–14.

24.

Vazquez

Gil

Garcia-Olivares

. Weaning induces an increase in the number of specific cytokine-secreting intestinal lymphocytes in mice. Cytokine 2000; 12: 1267–1270.

25.

Manzano

Abadia-Molina

Garcia-Olivares

. Absolute counts and distribution of lymphocyte subsets in small intestine of BALB/c mice change during weaning. J Nutr 2002; 132: 2757–2762.

26.

Mengheri

Ciapponi

Vignolini

. Cytokine gene expression in intestine of rat during the postnatal developmental period: increased IL-1 expression at weaning. Life Sci 1996; 59: 1227–1236.

27.

Al-Sadi

Boivin

. Mechanism of cytokine modulation of epithelial tight junction barrier. Front Biosci 2009; 14: 2765–2778.

28.

Youakim

Ahdieh

. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. Am J Physiol 1999; 276: G1279–G1288.

29.

Boivin

. Mechanism of TNF-α modulation of Caco-2 intestinal epithelial tight junction barrier: role of myosin light-chain kinase protein expression. Am J Physiol 2005; 288: G422–G430.

30.

Sargeant

Miller

Shaw

. Inflammatory response of porcine epithelial IPEC J2 cells to enterotoxigenic E. coli infection is modulated by zinc supplementation. Mol Immunol 2011; 48: 2113–2121.

31.

Moeser

Ryan

Knighot

. Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs. Am J Physiol Gastrointest Liver Physiol 2007; 293: G413–G421.

32.

Zhu

Liu

Xie

. Effect of L-arginine on intestinal mucosal immune barrier function in weaned pigs after Escherichia coli LPS challenge. Innate Immun 2013; 19: 242–252.

33.

Cao

. Dietary supplementation with zinc oxide decreases expression of the stem cell factor in the small intestine of weanling pigs. J Nutr Biochem 2007; 18: 820–826.

34.

Chen

Liu

Zhu

. Fish oil attenuates liver injury caused by LPS in weaned pigs associated with inhibition of TLR4 and nucleotide-binding oligomerization domain protein signaling pathways. Innate Immun. Epub ahead of print 22 Jan 2013. DOI: 10.1177/1753425912472003.

35.

Laird

MHW

Rhee

Perkins

. TLR4/MyD88/PI3K interactions regulate TLR4 signaling. J Leukocyte Biol 2009; 85: 966–977.

36.

Juul-Madse

Jensen

Nielsen

. Ontogeny and characterization of blood leukocyte subsets and serum proteins in piglets before and after weaning. Vet Immunol Immunop 2010; 133: 95–108.

37.

Castillo

Martín-Orúe

Nofrarías

. Changes in caecal microbiota and mucosal morphology of weaned pigs. Vet Microbiol 2007; 124: 239–247.

38.

Yao

Perez-Gutierrez

. 16S ribosomal RNA-based methods to monitor changes in the hindgut bacterial community of piglets after oral administration of Lactobacillus sobrius S1. Anaerobe 2008; 14: 78–86.

39.

David

Grongnet

Lalles

. Weaning affects the expression of heat shock proteins in different regions of the gastrointestinal tract of piglets. J Nutr 2002; 132: 2551–2561.

40.

Klosterhalfen

Töns

Hauptmann

. Influence of heat shock protein 70 and metallothionein induction by zinc-bis-(dl-hydrogenaspartate) on the release of inflammatory mediators in a porcine model of recurrent endotoxemia. Biochem Pharmacol 1996; 52: 1201–1210.

41.

Van Molle

Van Roy

Van Bogaert

. Protection of zinc against tumor necrosis factor induced lethal inflammation depends on heat shock protein 70 and allows safe antitumor therapy. Cancer Res 2007; 67: 7301–7307.