Asparagine improves intestinal integrity,inhibits TLR4 and NOD signaling,and differently regulates p38 and ERK1/2 signaling in weanling piglets after LPS challenge

Abstract

Asparagine (Asn), an activator of ornithine decarboxylase (ODC), stimulates cell proliferation in intestinal epithelial cells. We hypothesized that Asn can mitigate LPS-induced injury of intestinal structure and barrier function by regulating inflammatory signaling pathways. We executed the following experiment using weanling pigs for each of the groups: (1) non-challenged control; (2) LPS-challenged control; (3) LPS + 0.5% Asn; (4) LPS + 1.0% Asn. After 21-d feeding, pigs received an i.p. injection of either saline or LPS. Four h after injection, the mid-jejunum and mid-ileum samples were collected. We found that Asn restored ODC expression that was decreased by LPS treatment. Asn also restored intestinal morphology and barrier function that were impaired by LPS treatment. In addition, Asn down-regulated intestinal caspase-3 protein expression and TNF-α concentration, and decreased the mRNA expression of intestinal TLR4, TLR4 downstream signals (myeloid differentiation factor 88, IL-1 receptor-associated kinase 1 and TNF-α receptor-associated factor 6 and NOD1, NOD2 and their adaptor molecule (receptor-interacting serine/threonine-protein kinase 2). Moreover, Asn decreased p38 phosphorylation but increased ERK1/2 phosphorylation. Our results suggest that Asn improves intestinal integrity during an inflammatory insult, which appears to be related to the decrease of intestinal pro-inflammatory cytokine (via TLR4, NODs and p38) and of enterocyte apoptosis (via p38 and ERK1/2).

Keywords

Asparagine weanling piglets intestine lipopolysaccharide inflammatory response

Introduction

The intestine is not only an important organ for nutrient digestion, absorption and metabolism, but is also the largest immune organ in the body, comprising more than 70% of the body’s immune cells.¹ However, multiple factors such as pathogenic and nonpathogenic challenges can damage intestinal mucosa structure and function.^2–4

Activation of inflammatory signaling pathways plays a critical role in intestinal damage.^5–7 TLRs and NODs are important protein families of inflammatory signaling pathways.^8–10 TLRs and NODs are expressed in many tissues including the intestine,^11–15 and play key roles in induction of innate antibacterial and inflammatory responses by recognition of PAMPs.^8,9,16 Interactions of TLRs or NODs with their specific PAMPs trigger downstream signaling events that lead to activation of NF-κB and pathways involving MAPKs, which further provoke the expression of genes encoding pro-inflammatory cytokines, including IL-1β, IL-6 and TNF-α.¹⁷ Consequently, pro-inflammatory cytokines mediate the host’s defense against invading pathogens. However, overproduction of these cytokines, especially TNF-α, can also elicit collateral injury in the intestine.

Many studies have shown that some specific amino acids, for example, glutamine (Gln), exert protective effects in the intestine under inflammatory conditions and can be used for treating diseases associated with intestinal injury.¹⁸ However, Gln undergoes spontaneous degradation into ammonia and other metabolites at room temperature and is not a stable compound for animal feeds.¹⁹ Asparagine (Asn), however, with a similar chemical structure to Gln, is more stable at room temperature and is a potential alternative to Gln. In fact, previous in vitro studies have shown that Asn protected against the induction of apoptosis in Gln-deprived rat intestinal epithelial cells.^20,21 The protective effect of Asn was completely blocked by a Gln synthetase inhibitor, suggesting that the conversion of Asn to Gln is required for protection against apoptosis.²¹ In addition, Asn increases ornithine decarboxylase (ODC) activity and cellular polyamine levels, and thus improves rat intestinal mucosal growth.^20,22 However, to our best knowledge, in vivo studies that address whether Asn can modulate intestinal health under inflammatory stress are lacking. In this study, we used a piglet model in which the LPS of Escherichia coli was administrated to piglets to induce intestinal damage.^23,24 We showed that Asn could attenuate intestinal injury induced by LPS, and regulate TLR4, NOD, p38 and ERK signaling.

Materials and methods

Animal care and diets

The experiment and animal care were conducted in compliance with the guidelines established by Animal Care and Use Committee of Wuhan Polytechnic University. A total of 24 weaned crossbred castrated barrows [Duroc × Large White × Landrace, 35 ± 1 d of age, 8.87 ± 0.15 kg initial body mass (BM)] were utilized for this study. Pigs were individually housed in stainless steel metabolic cages (1.80 × 1.10 m²) with access to feed and water in an environmentally controlled house. The ambient temperature was maintained at 22–25℃. The corn- and soybean meal-type basal diet (Table 1) was formulated in accordance with the National Research Council requirements for all nutrients.²⁵

Table 1.

Ingredient composition of diets (as fed basis).

Items	Concentration
Ingredients	g/kg
Corn	570.5
Soybean meal (44% CP)	224
Wheat middling	50
Fish meal	36
Soy protein concentrate	14
Fat powder^a	20
Defatted milk-replacer powder	30
Limestone	9.4
Dicalcium phosphate	12.2
Salt	3.4
Alanine^b	13.5
Acidifier^c	2.0
l-Lysine HCl (78.8% Lysine)	2.7
dl-Methionine (99% methionine)	1.0
l-Threonine (98% threonine)	0.8
Butylated hydroquinone	0.5
Vitamin and mineral premix^d	10
Nutrient composition	g/kg
Digestible energy^e,f (MJ/kg)	13.6
Crude protein^g	203
Crude fat^g	44
Calcium^g	8.0
Total phosphorus^g	7.0
Amino acid concentrations^g	g/kg
Total aspartate + asparagine	16.9
Total glutamate + glutamine	30
Arginine	9.8
Lysine	11.1
Serine	9.1
Threonine	7.3
Proline	11.2
Glycine	7.5
Alanine	26
Histidine	4.9
Leucine	15
Isoleucine	5.6
Tyrosine	4.5
Phenylalanine	7.1
Valine	6.4

A rumen-stable fat powder, purchased from Berg + Schmidt (Hamburg, German).

In the 0.5% Asn diet, 1.35% alanine were replaced by 0.5% Asn, 0.68% alanine and 0.17% cornstarch. In the 1.0% Asn diet, 1.35% alanine was replaced by 1.0% Asn and 0.35% cornstarch. All diets were isonitrogenous.

A compound acidifier including lactic acid and phosphoric acid, provided by Wuhan Fanhua Biotechnology Co. (Wuhan, China).

The vitamin and mineral premix (defatted rice bran as carrier) provided the following amounts per kg of complete diet: retinol acetate, 2700 µg; cholecalciferol, 62.5 µg; DL-α-tocopheryl acetate, 20 mg; menadione, 3 mg; vitamin B₁₂, 18 µg; riboflavin, 4 mg; niacin, 40 mg; pantothenic acid, 15 mg; choline chloride, 400 mg; folic acid, 700 µg; thiamin, 1.5 mg; pyridoxine, 3 mg; biotin, 100 µg; Zn, 80 mg (ZnSO₄·7H₂O); Mn, 20 mg (MnSO₄·5H₂O); Fe, 83 mg (FeSO₄·H₂O); Cu, 25 mg (CuSO₄·5H₂O); I, 0.48 mg (KI); Se, 0.36 mg (Na₂SeO₃·5H₂O).

Based on diets containing cornstarch.

Calculated.

Analyzed.

Experimental design

The piglets (n = 6) were assigned randomly to one of four treatments: (1) non-challenged control (CONTR; pigs receiving a control diet and administered 0.9% NaCl solution); (2) LPS-challenged control [LPS; pigs receiving the same control diet and administered E. coli LPS (E. coli serotype 055:B5; Potency ≥ 500,000 EU/mg; Sigma Chemical, St. Louis, MO, USA)]; (3) LPS + 0.5% Asn treatment (pigs receiving a 0.5% Asn diet and administered LPS); and (4) LPS + 1.0% Asn treatment (pigs receiving a 1.0% Asn diet and administered LPS). The doses of Asn (purity > 99%; Amino Acid Bio-Chemical, Wuhan, China) were used in accordance with our previous study.²⁶ We supplemented 1.35%, 0.68% and 0% alanine (purity > 99 %; Amino Acid Bio-Chemical Co) to the control, 0.5% Asn and 1.0% Asn diets, respectively, to create isonitrogenous diets. BM and feed consumption were measured on d 1 and 21. On d 21, the challenged groups were administered i.p. with E. coli LPS at 100 µg/kg BM, and the control group was administered the equivalent amount of 0.9% NaCl solution. The dose of LPS was chosen in accordance with our previous studies.^23,24

Intestinal sample collections

At 4 h after saline or LPS administration, all piglets were euthanized by i.m. injection of sodium pentobarbital (80 mg/kg BM). Immediately after slaughter, the small intestinal tract was dissected from the abdominal cavity. The intestinal samples were taken from two different sites along the proximo-distal axis: mid-jejunum at 50% between proximal jejunum and proximal ileum; mid-ileum at 50% between proximal ileum and ileo-caecal junction. The 3-cm and 10-cm segments were cut from the mid-jejunum and mid-ileum according to previous experiments.^24,27 A variety of studies have shown that, within 3–6 h after injection, LPS results in morphologic impairment and barrier dysfunction in small intestine (such as jejunum and ileum), which is related with increased production of intestinal pro-inflammatory cytokines.^23,28,29 Therefore, the time point of 4 h following saline or LPS administration was chosen for experimental measurements.

Intestinal segments (3 cm) were gently flushed and stored in 10% neutral-buffered formalin for histological analysis.^23,24 Additional 10-cm intestinal samples were opened longitudinally and flushed gently to remove luminal chyme. Mucosa samples were then collected via scraping with sterile glass slides, rapidly frozen in liquid nitrogen and stored at –80℃. All intestinal samples were collected within 15 min of slaughter. The frozen intestinal mucosal samples were weighed, homogenized in ice-cold 0.9% NaCl solution with a 1:10 (w/v) ratio, and then centrifuged at 600 g for 10 min at 4℃ to collect the supernatants for analysis of diamine oxidase (DAO) activity and TNF-α concentration. The protein concentration of the supernatant was measured by the Bradford protein assay method.³⁰

Intestinal morphology analysis

After a 24-h fixation, the intestinal segments were dehydrated using a graded series of ethanol and cleared up with xylene, embedded in paraffin, cut into cross sections at a thickness of approximately 5 µm with a microtome, and then stained with hematoxylin and eosin.³¹ The method for measurements of villus height and crypt depth was the same as described previously.²³

Intestinal mucosa DAO activity

Intestinal mucosa DAO activity was analyzed according to the method described by Liu et al.³² The results were expressed as U/mg protein.

Intestinal mucosa TNF-α concentration

Intestinal mucosa TNF-α concentration was analyzed using a commercially available porcine ELISA kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. Briefly, the 100 µl of standard (23.4, 46.9, 93.8, 188, 375, 750, 1500 pg/ml TNF-α), control or diluted intestinal samples were added to a 96-well microtiter plate and incubated at room temperature (21–25℃) for 2 h. Following incubation, each well was aspirated and the plate was washed five times. After washing, a 100 -µl solution of conjugate was added to the wells. The plate was incubated at room temperature for 2 h and then washed five times. After that, 100 µl substrate solution was added. After incubation for 30 min at room temperature, 100 µl stop solution was added, and the plates were read at 450 nm using an ELISA plate reader (Model 550; Bio-Rad, Hercules, CA, USA). Results obtained using natural porcine TNF-α show dose–response curves that are parallel to the standard curves. The minimum detectable concentration was 3.7 pg/ml. The TNF-α concentration in intestine was expressed as pg/mg protein.

mRNA abundance analysis

Total RNA extraction, quantification, reverse transcription and real-time PCR were carried out as previously described.²⁴ Briefly, total RNA was isolated using the TRIzol reagent [#9108, TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian, China]. Total RNA was quantified using the NanoDrop ND-2000 UV-VIS spectrophotometer (Thermo Scientific, Wilmington, DE, USA) by measuring the absorbance at 260 nm. Reverse transcription were carried out using PrimeScript RT reagent kit with gDNA eraser [#RR047A; TaKaRa Biotechnology (Dalian) Co., Ltd.]. Real-time PCR for gene expression analysis was performed using a SYBR® Premix Ex TaqTM (Tli RNaseH Plus) qPCR kit [#RR420A, TaKaRa Biotechnology (Dalian) Co., Ltd.] on an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Life Technologies, Foster City, CA, USA). The PCR program was as follows: 95℃ for 30 s, followed by 40 cycles of 95℃ for 5 s and 60℃ for 34 s. The primer pairs used for real-time PCR are listed in Table 2. The relative abundance of target genes vs. housekeeping gene (GAPDH) was analyzed using the formula 2^–ΔΔCT as previously described.³³ We tested several housekeeping genes by analyzing gene stability as described by Vandesompele et al.³⁴ We found the expression of GAPDH to be more stable than that of other housekeeping genes, and there was no variation in the expression of GAPDH among intestinal segments and treatments. Relative mRNA abundance of every target gene was normalized to the control group.

Table 2.

Primer sequences used for real-time PCR.

Gene	Forward (5′-3′)	Reverse (5′-3′)	Efficiency (%)	Product length (bp)	Accession numbers
TLR4	TCAGTTCTCACCTTCCTCCTG	GTTCATTCCTCACCCAGTCTTC	96	166	GQ503242.1
MyD88	GATGGTAGCGGTTGTCTCTGAT	GATGCTGGGGAACTCTTTCTTC	102	148	AB292176.1
IRAK1	CAAGGCAGGTCAGGTTTCGT	TTCGTGGGGCGTGTAGTGT	96	115	XM_003135490.1
TRAF6	CAAGAGAATACCCAGTCGCACA	ATCCGAGACAAAGGGGAAGAA	101	122	NM_001105286.1
NOD1	CTGTCGTCAACACCGATCCA	CCAGTTGGTGACGCAGCTT	97	57	AB187219.1
NOD2	GAGCGCATCCTCTTAACTTTCG	ACGCTCGTGATCCGTGAAC	99	66	AB195466.1
RIPK2	CAGTGTCCAGTAAATCGCAGTTG	CAGGCTTCCGTCATCTGGTT	103	206	XM_003355027.1
GAPDH	CGTCCCTGAGACACGATGGT	GCCTTGACTGTGCCGTGGAAT	100	194	AF017079.1

Protein abundance analysis

The analysis of protein abundance in intestinal mucosa was carried out according to the method described previously.²⁴ Briefly, the intestinal mucosa samples (150–200 mg) were homogenized in 600 µl lysis buffer containing phenylmethanesulfonyl fluoride, protease and phosphatase inhibitors, and centrifuged at 12,000 g for 15 min at 4℃ to collect supernatants. Equal amounts of intestinal mucosa protein (65 µg) were transferred onto 10–15% polyacrylamide gel and separated via SDS-PAGE, and then transferred to polyvinylidene difluoride membranes for immunoblotting. Immunoblots were blocked with 5% nonfat milk in Tris-buffered saline/Tween-20 for 3 h at room temperature (21–25℃). The membranes were incubated overnight at 4℃ with primary Abs, and then with the secondary Ab for 2 h at room temperature. Specific primary Abs included rabbit anti-human ODC (polyclonal; 51 kDa; 1:500; #bs-1294R) from Bioss (Bioss Inc., Beijing, China), rabbit anti-human claudin-1 (polyclonal; 22 kDa; 1:1000; #51-9000) and rabbit anti-human occludin (polyclonal; 59 kDa, 1:1000; #ab31721) from Invitrogen (Invitrogen Technology Inc., Danvers, MA, USA), rabbit anti-human caspase-3 (polyclonal; 35 kDa; 1:1000; #9661), rabbit anti-human p38 (polyclonal; 43 kDa; 1:1000; #9212), rabbit anti-human phosphorylated p38 (polyclonal; 43 kDa; 1:1000; #9211), rabbit anti-rat extracellular signal-related kinase 1/2 (ERK1/2; polyclonal; 42/44 kDa; 1:1000; #9102) and rabbit anti-human phosphorylated ERK1/2 (polyclonal; 42/44 kDa; 1:1000; #9101) from Cell Signaling (Cell Signaling Technology Inc., Danvers, MA, USA), and mouse anti-β-actin (monoclonal; 42 kDa; 1:10000; #A2228) from Sigma Aldrich (Sigma Aldrich Inc., St. Louis, MO, USA). The secondary Abs included goat anti-rabbit IgG-HRP (polyclonal; 1:5000; #ANT020) and goat anti-mouse IgG-HRP (polyclonal; 1:5000; #ANT019) (Antgene Biotech, Wuhan, China). Blots were developed using an Enhanced Chemiluminescence Western blotting kit (Amersham Biosciences, Solna, Sweden), and visualized using a Gene Genome bioimaging system. Bands were analyzed by densitometry using Gene Tools software (Syngene, Frederick, MD, USA). β-Actin was used as a loading control in Western blotting analysis. The relative abundance of target proteins (ODC, claudin-1, occludin and caspase-3) were expressed as the target protein/β-actin protein ratio. Phosphorylated form of p38 and ERK1/2 were normalized with the total protein content of p38 and ERK1/2, respectively.

Eight samples from four treatments (n = 2) were run in one gel. Thus, 24 samples from four treatments (n = 6) were run in three gels at one time to minimize the gel-to-gel variations. The analyses were conducted in duplicate.

Statistical analysis

Data were analyzed by ANOVA appropriate for randomized complete-block designs using the GLM procedure of SAS (SAS Institute, Cary, NC, USA). Planned contrasts were used for comparison: CONTR vs. LPS, LPS vs. LPS + 0.5% Asn, LPS vs. LPS + 1.0% Asn. The LPS pigs (0% Asn) were compared with CONTR pigs to determine the effect of LPS challenge, and with LPS + 0.5% or 1.0% Asn pigs to determine the effect of Asn treatment within LPS-challenged pigs. Least significant differences were calculated with the LSMEANS statement. All data were expressed as means ± SE. P < 0.05 was considered as statistically significant.

Results

Growth performance

During the 21-d feeding trial (before LPS or saline injection), there were no differences in average daily feed intake (767 ± 68 g), average daily gain (488 ± 5 0 g) and feed/gain ratio (1.51 ± 0.14) among the four groups.

Intestinal morphology

Injection of LPS caused fever, vomiting, shivering, anorexia and inactivity within 1 h in all pigs (data not shown). The LPS pigs had higher crypt depth (P < 0.01; Figure 1) and lower villus height/crypt depth ratio (VCR) (P < 0.05) in ileum than CONTR pigs. Relative to LPS pigs, the LPS + 0.5% Asn pigs had higher villus height in ileum (P < 0.05). Relative to LPS pigs, the LPS + 1.0% Asn pigs displayed higher villus height (P < 0.01) and VCR (P < 0.05) in jejunum, and lower crypt depth in ileum (P < 0.01).

Figure 1.

Effects of Asn supplementation on (a) villus height, (b) crypt depth and (c) villus height/crypt depth ratio of weaning piglets after 4 h of E. coli LPS challenge. Values are means with SE, n = 6 (1 pig/pen). CONTR vs. LPS: ^*P < 0.05, ^**P < 0.01; LPS vs. LPS + 0.5% Asn: ⁺P < 0.05; LPS vs. LPS + 1.0% Asn: ⁺P < 0.05, ⁺⁺P < 0.01.

Intestinal DAO activity, and protein expression of ODC and tight junction proteins

The LPS pigs had lower protein expression of ODC, claudin-1 and occludin in jejunum (P < 0.01; Table 3; Figure 2), and lower DAO activity (P < 0.01) and ODC protein expression (P < 0.05) in ileum than CONTR pigs. Compared with LPS pigs, the LPS + 0.5% Asn pigs had higher DAO activity (P < 0.05), and claudin-1 (P < 0.01) and occludin (P < 0.05) protein expression in jejunum. Compared with LPS pigs, the LPS + 1.0% Asn pigs had higher DAO activity (P < 0.05) and protein expression of ODC (P < 0.05), claudin-1 (P < 0.01) and occludin (P < 0.05) in jejunum, and higher claudin-1 protein expression in ileum (P < 0.05).

Table 3.

Effects of Asn supplementation on intestinal DAO activity and protein expression of ODC and tight junction proteins after 4 h E. coli LPS challenge in weaned pigs.

Item	CONTR	LPS	LPS + 0.5% Asn	LPS + 1.0% Asn
Jejunum
DAO, U/mg protein	54 ± 4	67 ± 9	93 ± 7⁺	92 ± 6⁺
ODC/β-actin	0.146 ± 0.009^**	0.111 ± 0.006	0.100 ± 0.005	0.139 ± 0.010⁺
Occludin/β-actin	0.353 ± 0.082^**	0.170 ± 0.045	0.308 ± 0.077⁺	0.299 ± 0.099⁺
Claudin-1/β-actin	65.9 ± 6.7^**	28.9 ± 3.6	66.5 ± 11.6⁺⁺	64.1 ± 5.8⁺⁺
Ileum
DAO, U/mg protein	135 ± 10^**	103 ± 4	120 ± 3	94 ± 7
ODC/β-actin	0.116 ± 0.008^*	0.093 ± 0.005	0.085 ± 0.005	0.102 ± 0.007
Occludin/β-actin	0.145 ± 0.059	0.140 ± 0.047	0.138 ± 0.043	0.099 ± 0.027
Claudin-1/β-actin	11.7 ± 2.3	11.7 ± 0.8	11.3 ± 2.2	18.1 ± 2.6⁺

CONTR vs. LPS: ^*P < 0.05, ^**P < 0.01; LPS vs. LPS + 0.5% Asn: ⁺P < 0.05, ⁺⁺P < 0.01; LPS vs. LPS + 1.0% Asn: ⁺P < 0.05, ⁺⁺P < 0.01.

Figure 2.

Effects of Asn supplementation on protein expression of ODC, occludin, claudin-1 and caspase-3 in (a) jejunum and (b) ileum after 4 h of E. coli LPS challenge in weaned piglets. The bands were the representative Western blot images of ODC, occludin, claudin-1, caspase-3 and β-actin.

Intestinal caspase-3 protein expression and TNF-α concentration

The LPS pigs had higher TNF-α concentration in jejunum than CONTR pigs (P < 0.05; Table 4; Figure 2). Compared with LPS pigs, both the LPS + 0.5% Asn pigs and the LPS + 1.0% Asn pigs had lower caspase-3 protein expression in ileum (P < 0.01), and lower TNF-α concentration in jejunum (P < 0.01) and ileum (P < 0.05).

Table 4.

Effects of Asn supplementation on intestinal caspase-3 protein expression and TNF-α concentration after 4 h E. coli LPS challenge in weaned pigs.

Item	CONTR	LPS	LPS + 0.5% Asn	LPS + 1.0% Asn
Jejunum
Caspase-3/β-actin	35.5 ± 1.5	30.7 ± 4.1	31.3 ± 1.6	35.4 ± 5.2
TNF-α, pg/mg protein	13.4 ± 0.9^*	16.0 ± 0.8	10.0 ± 0.9⁺⁺⁺	12.0 ± 0.3⁺⁺
Ileum
Caspase-3/β-actin	13.5 ± 0.9	17.2 ± 2.0	8.4 ± 1.9⁺⁺	10.2 ± 1.7⁺⁺
TNF-α, pg/mg protein	16.4 ± 0.7	15.1 ± 0.7	12.8 ± 0.5⁺	11.4 ± 0.6⁺⁺

CONTR vs. LPS: ^*P < 0.05; LPS vs. LPS + 0.5% Asn:⁺P < 0.05, ⁺⁺P < 0.01, ⁺⁺⁺P < 0.001; LPS vs. LPS + 1.0% Asn: ⁺⁺P < 0.01.

Intestinal mRNA expression of TLR4 and NODs and their downstream signals

The LPS pigs had higher mRNA expression of MyD88 (P < 0.001; Table 5), NOD2 (P < 0.01) and RIPK2 (P < 0.01) in jejunum, and higher mRNA expression of TLR4 (P < 0.05), TRAF6 (P < 0.05), NOD2 (P < 0.05) and RIPK2 (P < 0.001) in ileum. Relative to LPS pigs, the LPS + 0.5% Asn pigs had lower mRNA expression of MyD88 (P < 0.01) and RIPK2 (P < 0.05) in jejunum, and lower mRNA expression of TLR4 (P < 0.05), MyD88 (P < 0.01), TRAF6 (P < 0.01), NOD1 (P < 0.01), NOD2 (P < 0.01) and RIPK2 (P < 0.01) in ileum. Relative to LPS pigs, the LPS + 1.0% Asn pigs had lower mRNA expression of MyD88 (P < 0.001), TRAF6 (P < 0.05), NOD2 (P < 0.05) and RIPK2 (P < 0.05) in jejunum, and lower mRNA expression of TLR4 (P < 0.05), MyD88 (P < 0.01), IRAK1 (P < 0.05), TRAF6 (P < 0.01), NOD1 (P < 0.01), NOD2 (P < 0.05) and RIPK2 (P < 0.01) in ileum.

Table 5.

Effects of Asn supplementation on intestinal mRNA abundance of TLR4 and NODs and their downstream signals after 4 h E. coli LPS challenge in weaned pigs.

Item	CONTR	LPS	LPS + 0.5% Asn	LPS + 1.0% Asn
Jejunum
TLR4	1.00 ± 0.06	1.30 ± 0.30	1.21 ± 0.16	1.07 ± 0.17
MYD88	1.00 ± 0.10^***	1.85 ± 0.14	1.16 ± 0.11⁺⁺	0.95 ± 0.13⁺⁺⁺
IRAK1	1.00 ± 0.11	0.97 ± 0.13	0.79 ± 0.09	0.82 ± 0.15
TRAF6	1.00 ± 0.15	1.04 ± 0.12	0.87 ± 0.07	0.67 ± 0.08⁺
NOD1	1.00 ± 0.11	1.28 ± 0.43	0.86 ± 0.17	0.92 ± 0.25
NOD2	1.00 ± 0.22^**	2.33 ± 0.51	1.48 ± 0.19	1.15 ± 0.19⁺
RIPK2	1.00 ± 0.12^**	2.66 ± 0.65	1.47 ± 0.17⁺	1.51 ± 0.20⁺
Ileum
TLR4	1.00 ± 0.08^*	1.35 ± 0.14	0.94 ± 0.04⁺	0.98 ± 0.14⁺
MYD88	1.00 ± 0.11	1.07 ± 0.06	0.67 ± 0.06⁺⁺	0.73 ± 0.06⁺⁺
IRAK1	1.00 ± 0.02	1.14 ± 0.11	1.09 ± 0.08	0.87 ± 0.07⁺
TRAF6	1.00 ± 0.08^*	1.33 ± 0.12	0.89 ± 0.13⁺⁺	0.83 ± 0.10⁺⁺
NOD1	1.00 ± 0.11	1.29 ± 0.25	0.67 ± 0.08⁺⁺	0.69 ± 0.04⁺⁺
NOD2	1.00 ± 0.10^*	1.58 ± 0.18	0.90 ± 0.18⁺⁺	0.96 ± 0.16⁺
RIPK2	1.00 ± 0.08^***	2.15 ± 0.08	1.56 ± 0.16⁺⁺	1.52 ± 0.17⁺⁺

CONTR vs. LPS: ^*P < 0.05, ^**P < 0.01, ^***P < 0.001; LPS vs. LPS + 0.5% Asn:⁺P < 0.05, ⁺⁺ P < 0.01; LPS vs. LPS + 1.0% Asn: ⁺P < 0.05, ⁺⁺P < 0.01, ⁺⁺⁺P < 0.001.

Intestinal ERK and p38 protein expression

The LPS pigs had a higher p-p38/t-p38 ratio (P < 0.01; Figure 3) and a lower p-ERK/t-ERK ratio (P < 0.05) in jejunum. Relative to LPS pigs, both the LPS + 0.5% Asn pigs and the LPS + 1.0% Asn pigs had a lower ratio of p-p38/t-p38 in jejunum (P < 0.01), and higher p-ERK/t-ERK ratio in jejunum and ileum (P < 0.05).

Figure 3.

Effects of Asn supplementation on the phosphorylated p38 (p-p38)/ total p38 (t-p38) ratio (a) and phosphorylated ERK (p-ERK)/ total ERK (t-ERK) ratio (b) of weaning piglets after 4 h of E. coli LPS challenge. The bands are the representative Western blot images of p-p38, t-p38, p-ERK and t-ERK. Values are means with SEs, n = 6 (1 pig/pen). CONTR vs. LPS: ^*P < 0.05, ^**P < 0.01; LPS vs. LPS + 0.5% Asn:⁺⁺P < 0.01, ⁺⁺⁺P < 0.001; LPS vs. LPS + 1.0% Asn:⁺P < 0.05, ⁺⁺P < 0.01.

Discussion

Asn is an amino acid with similar chemical structure to Gln (with one less methylene group). It can be synthesized from aspartate and Gln. Thus, traditionally, it is considered as a nutritionally dispensable amino acid in mammals.^35,36 However, some studies in vitro have shown that Asn, like Gln, is a powerful stimulator of ODC and stimulates cell proliferation in various cell types, including intestinal epithelial cells.^20,22 To date, unlike Gln, the in vivo studies related to Asn modulation of intestinal health are limited. Thus, the aim of this experiment was to investigate whether Asn could mitigate intestinal damage induced by LPS challenge. Our previous studies (unpublished data) showed that, before LPS challenge, dietary addition of 0.5% and 1.0% Asn had no effect on growth performance, total and differential leukocyte counts and serum biochemical parameters of weanling pigs, suggesting that the Asn level in the basal diet was adequate to maintain growth and physiological function of weaned piglets in normal physiological condition. However, after LPS challenge, 0.5% Asn mitigated mass loss, and both 0.5% and 1.0% Asn mitigated the changes of total and differential leukocyte counts and serum biochemical parameters induced by LPS in weanling pigs,²⁶ indicating the importance of exogenous Asn supply under inflammatory situations. Therefore, in the current study, we focused on investigating the effect of dietary 0.5% and 1.0% Asn supplementation on intestinal variables in pigs subjected to LPS challenge, and did not investigate the effect of Asn in pigs without LPS challenge.

Indicators of intestinal morphology include villus height, crypt depth and VCR. Thus, an increase in villus height or VCR and a decrease in crypt depth indicate improvement in nutrient digestion and absorption.^23,27 Many studies have shown that LPS challenge can result in a variety of morphologic alterations in the intestine such as submucosal edema, hemorrhage, mucosal necrosis and epithelial lifting, reduced villus height and increased crypt depth.^23,28,29 As expected, our present results also showed that LPS challenge decreased ileal VCR and increased ileal crypt depth, indicating that LPS induced intestinal morphologic injury. Relative to LPS pigs, dietary addition of Asn increased villus height and VCR, and decreased crypt depth. These findings support the notion that Asn beneficially attenuates LPS-induced intestinal morphologic damage. Similarly, Papaconstantinou et al.²¹ reported that addition of Asn resulted in increased cell number and viability in Gln-deprived rat intestinal epithelial cells. We speculate that the beneficial effect of Asn on intestinal morphology might be due to the following mechanisms. Polyamines are required for optimal cell growth and proliferation.²⁰ Intracellular polyamine levels are dependent primarily on the activity of ODC, which catalyzes the first rate-limiting step in polyamine biosynthesis, the decarboxylation of ornithine to form the diamine putrescine.²⁰ Many studies in vitro have demonstrated that Asn stimulates ODC activity and cellular polyamine levels, and thus improves intestinal mucosal growth and proliferation.^20,22 In addition, our data in vivo also demonstrated that dietary Asn supplementation increased intestinal ODC protein expression in weanling piglets compared with LPS pigs, which further supports that Asn is a stimulator of ODC in intestine.

Intestinal epithelial barrier is important in the maintenance of gut homeostasis by preventing the penetration of luminal bacteria and dietary allergens into the mucosa.¹ Intestinal barrier function can be commonly evaluated by many indices including intestine mucosal permeability³⁷ and DAO activity.³⁸ Intestinal epithelial integrity is maintained by cohesive interactions between cells via forming tight junctions.³⁹ Members of the occludin and claudin family play a key role in tight junction formation, and determine permeability characteristics in many tissues, including the intestine.³⁹ Generally, decreased levels of tight junction proteins are associated with dysfunction of the epithelial barrier.⁴⁰ In addition to intestinal morphology, LPS challenge can have a detrimental effect on intestinal barrier function.³² In accordance with this view, our present results also showed that LPS decreased ileal DAO activity, and jejunal claudin-1 and occludin protein expression. Relative to LPS pigs, dietary supplementation of Asn increased intestinal DAO activity, and claudin-1 and occludin protein expression, suggesting that Asn improves intestinal barrier function. Some research demonstrated that polyamines were necessary for the synthesis and stability of tight junction proteins and that polyamine depletion disrupts the epithelial barrier function, at least partially, by decreasing tight junction proteins.^41,42 Our present data demonstrate that, as a stimulator of ODC, Asn might attenuate LPS-induced injury of intestinal barrier function partially by increasing the expression of intestinal tight junction proteins possibly via enhancing polyamine synthesis.

Intestinal epithelial cell turnover, including crypt cell proliferation, migration along the small intestine crypt–villus axis, differentiation and cell death via apoptosis, are dynamic processes.²³ To some degree, normal intestinal morphology is determined by the balance of epithelial cell turnover.²³ Increased enterocyte apoptosis may be one of key factors that contributes to intestinal morphological injury and barrier dysfunction.²³ Caspases are key mediators of programmed cell death (apoptosis). Among them, caspase-3 is a frequently activated death protease, catalyzing the specific cleavage of many key cellular proteins.²⁷ Caspase-3 has been shown to be an important marker of enterocyte apoptosis.²⁷ Consistent with improved intestinal structure and barrier function, dietary addition of Asn decreased ileal caspase-3 protein expression compared with LPS pigs. Similar to our data, Papaconstantinou et al.²¹ reported that Asn protected against the induction of apoptosis in Gln-deprived rat intestinal epithelial cells. The protective effect of Asn was completely blocked by a Gln synthetase inhibitor, suggesting that the conversion of Asn to Gln was required for protection against apoptosis.²¹ In our present study, it is possible that dietary Asn supplementation mitigated the LPS-induced intestinal structure and barrier damage partially via inhibiting enterocyte apoptosis.

We hypothesized that Asn exerted its beneficial effect on the intestine by reducing intestinal inflammatory response. A high level of intestinal pro-inflammatory cytokines, especially TNF-α, is an important marker of inflammation in intestine.²³ TNF-α is rapidly induced in the intestinal mucosa upon initial activation of immune cells, and is important for the further acceleration of the inflammatory response.⁴³ TNF-α has been identified to decrease the barrier function by disrupting tight junctions between the intestinal epithelial cells.⁴⁴ In the current study, consistent with improved intestinal structure and barrier function, Asn addition reduced intestinal TNF-α concentration compared with LPS pigs. These results support the notion that dietary supplementation with Asn is effective in reducing intestinal inflammatory response in weanling pigs.

To explore the molecular mechanism(s) by which Asn might alleviate the intestinal inflammatory response, we examined the role of inflammatory signaling pathways. TLRs and NODs are important protein families of inflammatory signaling pathways. They play a central role in detection of invading pathogens and induction of innate antibacterial and inflammatory responses by recognizing PAMPs.^8–10 The intestine expresses multiple TLRs and NODs.^12–15 Current research has demonstrated that activation of TLR and NOD signaling is associated with multi-layered inflammatory intestinal diseases.^5,6 The binding of TLRs or NODs with their specific PAMPs triggers downstream signaling events that lead to activation of multiple intracellular signaling pathways, predominantly including NF-κB pathway, as well as MAPKs pathways, which include the Jun N-terminal kinase, ERK1/2 and p38.^8,9 Activation of these intracellular signaling pathways further leads to expression and release of pro-inflammatory cytokines such as IL-1β, IL-6 and TNF-α.¹⁷ In the current experiments, consistent with decreased intestinal TNF-α concentration, addition of Asn down-regulated intestinal mRNA expressions of TLR4 and its downstream signals (MyD88, IRAK1 and TRAF6), and NOD1, NOD2 and their adaptor molecule (RIPK2) compare with LPS pigs. In addition, Asn reduced intestinal p38 phosphorylation. The inhibition of p38, which can effectively suppress the expression of inflammatory mediators, significantly improves post-ischemic intestinal epithelial barrier functional recovery.^45,46 Feng and Li⁴⁵ reported that human intestinal microvascular endothelial cells, intestinal epithelium, fibroblasts and myofibroblasts, which participate in inflammatory bowel disease, are affected by p38 directly or indirectly. Therefore, the beneficial effects of Asn addition on intestinal structure and barrier function might be related to reducing TNF-α via inhibition of TLR4 and NODs and p38 signaling.

Interestingly, unlike p38, our present study showed that LPS decreased intestinal ERK1/2 phosphorylation, and Asn attenuated LPS-induced decrease of ERK1/2 phosphorylation, which is inconsistent with decreased intestinal TNF-α concentration. In addition to regulation of inflammation, MAPKs also play a critical role in regulation of cell apoptosis. Some studies have shown that p38 and ERK1/2 may play opposing roles in cell apoptosis. The p38 pathway has a pro-apoptotic effect, and but ERK pathway has a protective effect on cell apoptosis.^47–49 In some models of cell apoptosis, activation of p38 and concurrent inhibition of ERK are critical for induction of cell apoptosis.^47–49 Thus, it is possible that Asn supplementation attenuated LPS-induced enterocyte apoptosis via inhibition of p38 and activation of ERK1/2.

In our current study, the effects of LPS challenge or Asn supplementation on some of intestinal measurements differ between two intestine segments. This may be associated with the difference in the anatomy and physiology among the various segments of the intestine.⁵⁰ Currently, it is not clear whether Asn affected intestinal integrity and inflammatory signaling pathways directly or indirectly by influencing ODC, and awaits further investigations.

In summary, as a stimulator of intestinal ODC, dietary Asn supplementation attenuates LPS-induced damage of intestinal morphology and barrier function. The beneficial effects of Asn on the intestine may be closely related to: (1) decreasing expression of intestinal pro-inflammatory cytokine via inhibiting TLR4 and NODs and p38 signaling pathways; (2) decreasing enterocyte apoptosis via inhibition of p38 and activation of ERK1/2.

Footnotes

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The authors express their gratitude to the National Natural Science Foundation of China (31422053 and 31372318) and the Hubei Provincial Department of Education (T201508) for the financial support.

References

Blikslager

Moeser

Gookin

, et al. Restoration of barrier function in injured intestinal mucosa. Physiol Rev 2007; 87: 545–564.

Scharek-Tedin

Pieper

Vahjen

, et al. Bacillus cereus var. Toyoi modulates the immune reaction and reduces the occurrence of diarrhea in piglets challenged with Salmonella Typhimurium DT104. J Anim Sci 2013; 91: 5696–5704.

Xiao

Wang

Liu

, et al. Effects of chitosan on intestinal inflammation in weaned pigs challenged by enterotoxigenic Escherichia coli. PLoS One 2014; 9: e104192–e104192.

Boyer

D'Costa

Edwards

, et al. Early-life dietary spray-dried plasma influences immunological and intestinal injury responses to later-life Salmonella typhimurium challenge. Br J Nutr 2015; 113: 783–793.

Leaphart

Cavallo

Gribar

, et al. A critical role for TLR4 in the pathogenesis of necrotizing enterocolitis by modulating intestinal injury and repair. J Immunol 2007; 179: 4808–4820.

Werts

Rubino

Ling

, et al. Nod-like receptors in intestinal homeostasis, inflammation, and cancer. J Leukoc Biol 2011; 90: 471–482.

Narimatsu

Higashiyama

Kurihara

, et al. Toll-like receptor (TLR) 2 agonists ameliorate indomethacin-induced murine ileitis by suppressing the TLR4 signaling. J Gastroenterol Hepatol 2015; 30: 1610–1617.

Fukata

Vamadevan

Abreu

. Toll-like receptors (TLRs) and Nod-like receptors (NLRs) in inflammatory disorders. Semin Immunol 2009; 21: 242–253.

Takeuchi

Akira

. Pattern recognition receptors and inflammation. Cell 2010; 140: 805–820.

10.

Kim

Zhao

Zheng

, et al. A novel crosstalk between TLR4- and NOD2-mediated signaling in the regulation of intestinal inflammation. Sci Rep 2015; 5: 12018–12018.

11.

Alvarez

Revilla

Doménech

, et al. Expression of toll-like receptor 2 (TLR2) in porcine leukocyte subsets and tissues. Vet Res 2008; 39: 13–13.

12.

Uddin

Kaewmala

Tesfaye

, et al. Expression patterns of porcine Toll-like receptors family set of genes (TLR1-10) in gut-associated lymphoid tissues alter with age. Res Vet Sci 2013; 95: 92–102.

13.

Tohno

Shimazu

Aso

, et al. Molecular cloning and functional characterization of porcine nucleotide-binding oligomerization domain-1 (NOD1) recognizing minimum agonists, meso-diaminopimelic acid and meso-lanthionine. Mol Immunol 2008a; 45: 1807–1817.

14.

Tohno

Ueda

Azuma

, et al. Molecular cloning and functional characterization of porcine nucleotide-binding oligomerization domain-2 (NOD2). Mol Immunol 2008b; 45: 194–203.

15.

Parlato

Yeretssian

. NOD-like receptors in intestinal homeostasis and epithelial tissue repair. Int J Mol Sci 2014; 15: 9594–9627.

16.

Curtiss

Tobias

. Emerging role of Toll-like receptors in atherosclerosis. J Lipid Res 2009; 50(Suppl.): S340–S345.

17.

Doyle

Zhang

Abdel Fattah

, et al. Toll-like receptor 4 mediates lipopolysaccharide-induced muscle catabolism via coordinate activation of ubiquitin-proteasome and autophagy-lysosome pathways. FASEB J 2011; 25: 99–110.

18.

Wang

Qiao

. Amino acids and gut function. Amino Acids 2009; 37: 105–110.

19.

Heeneman

Deutz

Buurman

. The concentrations of glutamine and ammonia in commercially available cell culture media. J Immunol Methods 1993; 166: 85–91.

20.

Ray

Johnson

. Regulation of intestinal mucosal growth by amino acids. Amino Acids 2014; 46: 565–573.

21.

Papaconstantinou

Powell

Hellmich

, et al. Glutamate and asparagine protect against the induction of apoptosis in glutamine-deprived intestinal epithelial cells. Gastroenterology 1998; 114: A899–A899.

22.

Wang

Viar

Blanner

Johnson

. Expression of the ornithine decarboxylase gene in response to asparagine in intestinal epithelial cells. Am J Physiol 1996; 271: G164–G171.

23.

Liu

Huang

Hou

, et al. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Br J Nutr 2008; 100: 552–560.

24.

Liu

Shi

, et al. Dietary supplementation of Aspartate enhances intestinal integrity and energy status in weanling piglets after lipopolysaccharide challenge. J Nutr Biochem 2014; 25: 456–462.

25.

NRC. Nutrient requirements of swine. 10th ed. Washington, DC: National Academic Press, 1998.

26.

Liu

Shi

, et al. Effects of asparagine on growth performance, blood cell differential count and blood biochemical indices of weaned pigs challenged with lipopolysaccharide. Chinese J Anim Nutr 2012; 24: 2450–2458.

27.

Hou

Wang

Zhang

, et al. Protective effects of N-acetylcysteine on intestinal functions of piglets challenged with lipopolysaccharide. Amino Acids 2012; 43: 1233–1242.

28.

Mercer

Smith

Cross

, et al. Effects of lipopolysaccharide on intestinal injury; potential role of nitricoxide and lipid peroxidation. J Surg Res 1996; 63: 185–192.

29.

Touchette

Carroll

Allee

, et al. Effect of spray-dried plasma and lipopolysaccharide exposure on weaned pigs: I. Effects on the immune axis of weaned pigs. J Anim Sci 2002; 80: 494–501.

30.

Bradford

. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72: 248–254.

31.

Luna LG. Manual of histologic staining methods of the armed forces institute of pathology. 3rd ed. New York: McGraw-Hill, 1968, p. 258.

32.

Liu

Han

Huang

, et al. Dietary L-arginine supplementation improves intestinal function in weaned pigs after an Escherichia coli lipopolysaccharide challenge. Asian-Aust J Anim Sci 2009; 22: 1667–1675.

33.

Livak

Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and 2^–ΔΔCT method. Methods 2001; 25: 402–408.

34.

Vandesompele

De Preter

Pattyn

, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002; 3: RESEARCH0034–RESEARCH0034.

35.

. Amino acids: metabolism, functions, and nutrition. Amino Acids 2009; 37: 1–17.

36.

Bazer

Davis

, et al. Important roles for the arginine family of amino acids in swine nutrition and production. Livest Sci 2007; 112: 8–22.

37.

Travis

Menzies

. Intestinal permeability: functional assessment and significance. Clin Sci (Lond) 1992; 82: 471–488.

38.

Song

Zhang

, et al. Soluble intercellular adhesion molecule-1, D-lactate and diamine oxidase in patients with inflammatory boweldisease. World J Gastroenterol 2009; 15: 3916–3919.

39.

Weight

Jones

Horn

, et al. Elucidating pathways of Toxoplasma gondii invasion in the gastrointestinal tract: Involvement of the tight junction protein occludin. Microbes Infect 2015; 17: 698–709.

40.

Wang

Zhang

, et al. Glutamine enhances tight junction protein expression and modulates corticotropin-releasing factor signaling in the jejunum of weanling piglets. J Nutr 2015; 145: 25–31.

41.

Guo

Rao

Liu

, et al. Polyamines are necessary for synthesis and stability of occludin protein in intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 2005; 288: G1159–G1169.

42.

Orlando

Linsalata

Notarnicola

, et al. Lactobacillus GG restoration of the gliadin induced epithelial barrier disruption: the role of cellular polyamines. BMC Microbiol 2014; 14: 19–19.

43.

Noti

Corazza

Mueller

, et al. TNF suppresses acute intestinal inflammation by inducing local glucocorticoid synthesis. J Exp Med 2010; 207: 1057–1066.

44.

Pedersen

LaCasse

Seidelin

, et al. Inhibitors of apoptosis (IAPs) regulate intestinal immunity and inflammatory bowel disease (IBD) inflammation. Trends Mol Med 2014; 20: 652–665.

45.

Feng

. The role of p38 mitogen-activated protein kinase in the pathogenesis of inflammatory bowel disease. J Dig Dis 2011; 12: 327–332.

46.

Zheng

, et al. Inhibition of p38 mitogen-activated protein kinase may decrease intestinal epithelial cell apoptosis and improve intestinal epithelial barrier function after ischemia- reperfusion injury. World J Gastroenterol 2005; 11: 656–660.

47.

Tang

Liang

Qian

, et al. Opposing role of JNK-p38 kinase and ERK1/2 in hydrogen peroxide-induced oxidative damage of human trophoblast-like JEG-3 cells. Int J Clin Exp Pathol 2014; 7: 959–968.

48.

Xia

Dickens

Raingeaud

, et al. Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 1995; 270: 1326–1331.

49.

Nagata

Todokoro

. Requirement of activation of JNK and p38 for environmental stress-induced erythroid differentiation and apoptosis and of inhibition of ERK for apoptosis. Blood 1999; 94: 853–863.

50.

Chen SL. Animal physiology. 3rd ed. Beijing: Peking University Press, 2005.