Preclinical evaluation of drugs to block inflammation-driven preterm birth

Abstract

Intrauterine inflammation, the major cause of early preterm birth, can have microbial and sterile aetiologies. We assessed in a Transwell model the anti-inflammatory efficacies of five drugs on human extraplacental membranes delivered after preterm spontaneous labour (30–34 wk). Drugs [TPCA1 (IKKβ inhibitor), 5 z-7-oxozeaenol (OxZ, TAK1 inhibitor), inhibitor of NF-κB essential modulator binding domain (iNBD), SB239063 (p38 MAPK inhibitor) and N-acetyl cysteine (free radical scavenger free radicals)] were added after 12 h equilibration to the amniotic compartment. Concentrations of IL-6, TNF-α, MCP-1, IL-1β and PGE₂ in the media, and IL6, TNFA and PTGS2 mRNA expression levels in membranes, were determined after 12 h. Data were analysed using mixed models analyses. Thirteen of the 28 membranes had histological chorioamnionitis (HCA⁺); five were positive for bacterial culture and six for fetal inflammatory reaction. Baseline PGE₂ and cytokine production was similar between HCA^– and HCA⁺ membranes. Anti-inflammatory effects were also similar between HCA^– and HCA⁺ membranes. TPCA1 and OxZ were the most effective drugs; each inhibited amniotic secretion of 4/5 pro-inflammatory mediators and mRNA levels of 2/3, regardless of stimulus. We conclude that treatment with TPCA1 or OxZ, in combination with antibiotics, may minimise the adverse effects of intrauterine inflammation in pregnancy.

Keywords

Chorioamnionitis cytokine suppressive anti-inflammatory drugs intrauterine infection preterm birth

Introduction

Preterm birth (PTB) is a major cause of infant mortality and morbidity, with health and behavioural complications now known to persist into adulthood (reviewed in¹). It has been estimated that worldwide ∼15 million babies are born preterm each year.² The major cause of PTB prior to wk 34 of gestation is intrauterine infection and inflammation (reviewed in³). Intrauterine infection/inflammation (IUI) most commonly originates from microorganisms ascending from the vagina to colonise and disseminate throughout the amniotic cavity.⁴ Robust IUI triggers uterine contractions and onset of labour by activating the local innate immune system within the extraplacental membranes, resulting in histological chorioamnionitis (HCA) and elevated amniotic fluid (AF) concentrations of pro-inflammatory cytokines, chemokines and prostaglandins.⁵ In the most severe cases, IUI can lead to fetal inflammatory response syndrome (FIRS), which is associated with increased fetal expression of chemokines and cytokines and subsequent damage to the cardiovascular, pulmonary, hepatic and gastrointestinal systems,⁶ as well as neurological impairment associated with cerebral palsy (reviewed in⁷). Importantly, HCA has also been shown to occur in the absence of detectable amniotic bacteria and is now known to be an important cause of early PTB, both with and without preterm, prelabour rupture of membranes (PPROM).^8,9 This may be associated with colonisation by a fastidious or difficult-to-culture species, or sterile inflammation associated with oxidative stress-induced damage to fetal membranes (reviewed in^10,11).

Ideally, an effective treatment for IUI would both eliminate the infection, if present, and reduce the inflammatory response. In clinical trials, antimicrobial therapies alone have had only limited success at reducing rates of PTB and neonatal mortality and morbidity.^12–14 While this may, in part, be due to pharmacological deficiencies (poor placental transfer and/or efficacy profile) or suboptimal trial design (participant selection and timing of administration), there is also evidence that increased bacterial lysis in response to antibiotics can actually enhance agonism of the innate immune system increasing the generation of pro-inflammatory mediators and stimuli for labour.¹⁵

Despite the proven importance of IUI in the aetiology of PTB, the use of anti-inflammatory modalities to treat and prevent PTB is relatively unexplored. Non-steroidal anti-inflammatory drugs (NSAIDs), such as indomethacin, that act by blocking prostaglandin production, have been employed largely as tocolytics to stop labour, but their popularity has declined in recent years owing to their adverse effect profiles including an increased risk of spontaneous abortion and neonatal renal failure.^16,17 A key proof-of-principle clinical trial that provided important evidence that an anti-inflammatory modality administered in pregnancy to block inflammation before the onset of complications and preterm labour can significantly reduce rates of early PTB and improve neonatal outcomes was published in 2009. Shahin et al.¹⁸ found that the addition of N-acetyl cysteine (NAC), a free-radical scavenger and non-specific inhibitor of NF-κB and MAPK signalling, in conjunction with progestogen treatment for high-risk women with bacterial vaginosis in mid-pregnancy, greatly reduced the rates of PTB and neonatal morbidity/mortality. NAC has also been shown to prevent pro-inflammatory mediator production in vitro^19,20 and in vivo models of IUI.²¹ NAC is not always well tolerated in pregnancy,^18,22 and alternate drugs with similar or improved effects are still being sought.

The term ‘CSAID’ (cytokine-suppressive anti-inflammatory drug) applies to a recently described class of drugs which specifically target and block inflammatory signalling pathways (e.g. NF-κB or p38 MAPK) without the adverse and off-target effects of NSAIDs.^23,24 Examples include: TPCA1 (5-[p-fluorophenyl)-2-ureido] thiophene-3-carboxamide), an inhibitor of the IκB kinase subunit beta (IKK-β) that has been shown to reduce LPS-stimulated choriodecidual inflammatory gene expression with no effects on apoptosis;²⁵ NF-κB essential modulator (NEMO) binding domain inhibitor (iNBD), a cell-permeable peptide that inhibits activation of the IKK complex via NBD blockade that has been shown to inhibit a wide range of inflammatory responses in animal models;^26–28 SB239063 (trans-1-[4-hydroxycyclohexyl]-4-[4-fluorophenyl]-5-[2-[methoxy]pyrimidin-4-yl]imidazole), a MAPK inhibitor successfully used to block inflammation in animal models and in human fetal membranes;^29,30 and 5 z-7-oxozeaenol (OxZ), a selective inhibitor of TGF-β activated kinase 1 (TAK1, also known as MAP3K7) that has been shown to inhibit pro-inflammatory mediator production in murine fibroblasts,³¹ primary cortical neurons,³² dermal fibroblasts³³ and ear swelling models.³¹ We recently compared the effects of NAC and three of these CSAIDs (SB239063, TPCA1 and iNBD) on human and ovine gestational membranes stimulated ex vivo with γ-irradiation-killed Escherichia coli and showed that TPCA1 and SB239063, and to a lesser extent NAC, effectively suppressed cytokine and prostaglandin production within just 3 h.²⁰ Furthermore, we have shown in a large animal model of LPS-induced chorioamnionitis that intra-amniotic administration of a single dose of TPCA1 or OxZ can suppress LPS-induced intra-amniotic inflammatory responses, while fetal effects were minimal.³⁴

In the present study, we assessed the abilities of five CSAIDs, administered in a manner to replicate intra-amniotic delivery, to inhibit pro-inflammatory mediator production at both the amniotic and decidual faces of human, preterm extraplacental membranes delivered after spontaneous labour, both in the presence and absence of HCA and positive bacterial culture (infected; INF). This is important as inflammation is often well advanced (and usually asymptomatic) in women presenting with preterm labour, thereby constraining clinical diagnosis of inflammation and the inflammatory stimulus. Further, it is not yet known to what extent such NF-κB/MAPK inhibitors would be effective in women presenting with preterm labour arising from a variety of aetiologies and pathogens, including in the absence of HCA and microbial infection. It is possible that different stimuli and signalling cascades may exhibit differential sensitivity to pharmacological inhibitors. A Transwell model of intra-amniotic drug delivery was employed to assess the effects of localised (amniotic) administration of the drugs to the key sites of IUI, HCA and fetal inflammation, with the strategy of minimizing systemic maternal effects while maximizing fetal protection and therapeutic benefit. We hypothesised that the greatest inhibitory effects of these CSAIDs would be observed at the fetal (amniotic) face of membranes exhibiting the highest levels of histological inflammation. Unexpectedly, we found at baseline that cytokine and prostaglandin production was similar between HCA^– and HCA⁺ preterm membranes at both the mRNA and protein levels. We also found that the anti-inflammatory efficacies of the drugs were similar in HCA^– and HCA⁺ membranes, with drug effects largely restricted to amniotic compartments, supporting this localised therapeutic approach.

Materials and methods

Participant recruitment and ethics

Participants in this study gave written informed consent as approved by the Human Research Ethics Committee of the Western Australian Department of Health’s Women and Newborns Health Service (1834EW). Full-thickness extraplacental membranes from preterm placentae (30–34 wk of gestation) were harvested within 1 h of delivery after spontaneous onset of labour (Figure 1a). Inclusion criteria were spontaneous labour and PTB at 30–34 wk of gestation with or without PPROM; singleton or twin pregnancies [monochorionic-diamniotic (MCDA) or dichorionic diamniotic (DCDA)]; vaginal and Caesarean section deliveries. Exclusion criteria were pre-eclampsia, growth restriction, gestational diabetes, fetal genetic abnormalities and recreational drug abuse.

Figure 1.

Experimental design. (a) Six replicate Transwells were established within 1 h of delivery from the extraplacental membranes of women who delivered between 30 and 34 wk of gestation after spontaneous onset of labour; this enabled concurrent assessment of the anti-inflammatory efficacies of four CSAIDs and NAC compared with a vehicle control. Membranes were equilibrated for 12 h in culture prior to sampling of equilibration phase media and addition of treatments. The treatment phase involved a further 12 h of culture. (b) Transwells were prepared by stretching a full-thickness piece of human preterm extraplacental membrane across a 27-mm Transwell insert with original membrane removed (inset). Extraplacental membranes were held in place with an o-ring with the amnion internal to the Transwell such that treatments were administered to the amniotic face simulating intra-amniotic drug delivery.

Human extraplacental membrane Transwell model

Full-thickness, extraplacental membranes were secured over 27-mm Transwell inserts [Corning Inc., Lindfield, NSW, Australia; original membrane removed (Figure 1a, inset)] and held in place with an o-ring with the amnion internal to the Transwell such that treatments were administered to the amniotic face simulating intra-amniotic drug delivery. Six replicate Transwells were established from each membrane and placed into six-well culture plates as previously described (Figure 1b).²⁰ The outer ‘maternal’ or decidual-facing compartment contained 3.5 ml supplemented media [DMEM/Ham’s Nutrient Mixture F-12, phenol red-free, supplemented with 15 mM HEPES, pH 7.3 (Sigma Aldrich Pty Ltd, Castle Hill, NSW, Australia.), 0.5% endotoxin/fatty acid-free BSA (Bovogen Biologicals Pty Ltd, East Keilor, VIC, Australia) and 4 µg/ml azithromycin (Pfizer, New York, NY, USA)]. The inner ‘fetal’ or amniotic facing compartment contained 2.5 ml supplemented media. After 12 h incubation to allow tissue recovery and equilibration (37 ℃ in 5% CO₂), the conditioned ‘equilibration phase’ media from the amniotic and decidual compartments was removed and frozen for analysis and replaced with fresh supplemented media. Fluorescent Spherobeads (0.04–0.06 µm, 1% w/v; ProSciTech, Thurngawa, QLD, Australia) plus the drugs or vehicle control (1% DMSO) were added to the amniotic compartments. Drug concentrations based on previously published work as described above were as follows: 10 mM NAC (Enzo Life Sciences, New York, NY, USA); 10 μM iNBD (China Peptides, Shanghai, China); 7 μM TPCA1 (Merck Millipore, Darmstadt, Germany); 20 μM SB239063 (SB; Alexis Biochemicals, Lausen, Switzerland) and 3 μM OxZ (BioAustralis Fine Chemicals, Smithfield, NSW, Australia). Treated membranes were incubated for a further 12 h before sampling of the conditioned ‘treatment phase’ amniotic and decidual media and membranes. Ninety-two percent of HCA⁺ and 94% HCA^– Transwells were deemed intact, with ≥ 95% retention of Spherobeads within the amniotic compartment at the end of 24 h culture and were included in the analysis.

Membrane histology and microbiology

All placentas underwent routine microbiological culture and histopathology and were scored by a paediatric pathologist as either HCA⁺ or HCA^– based on the extent of inflammatory cell infiltration according to the Redline criteria.³⁵ Experiments were performed blind to obstetric, neonatal or histological details. Post-treatment, each full-thickness Transwell membrane was divided in half with one half formalin-fixed, paraffin-embedded, sectioned and stained with haematoxylin and eosin. Five-µm-thick stained sections were imaged using an Aperio ScanScope XT (Leica Biosystems, Nussloch, Germany) with 40 × objective and imaged at 20 × magnification using ImageScope version 11.2.0.780 (Aperio Technologies Inc., Leica Biosystems, Nussloch, Germany). Five random fields were assessed at low-power magnification and scored as follows based on a simplified Redline staging system:³⁵ 0 = no inflammatory cell infiltration; 1 = few polymorphonuclear (PMN) cells in subchorionic fibrin and/or membrane trophoblast layer (stage 1, grade 1); 2 = isolated foci or bands of PMN cells in subchorionic fibrin and/or membrane trophoblast layer (stage 1, grade 2); 3 = foci or continuous bands of PMN cells extending into amnion (stage 2, grade 2); and 4 = confluent PMN cells, amniocyte necrosis and/or amnion basement membrane thickening (stage 3, grade 2).

Quantitation of secreted pro-inflammatory mediators

Concentrations of IL-6, TNF-α and PGE₂ were measured in conditioned media as previously described.²⁰ IL-1β was quantified using Human IL-1β ELISA MAX™ Deluxe as per manufacturer’s instruction (Biolegend, San Diego, CA, USA). MCP-1 was quantified using Human MCP-1 Standard ELISA kit as per manufacturer’s instruction (Peprotech, Rocky Hill, NJ, USA). The highest calibration standards for the PGE₂, IL-6, TNF-α, MCP-1 and IL-1β assays were 1000, 6000, 6000, 1000 and 250 pg/ml, respectively. The lower limits of detection for the assays were 5.5, 65.2, 50.6, 24.4 and 0.8 pg/ml, respectively. Conditioned media samples were diluted 1:4 for the IL-6 assay, 1:5 for the PGE₂ assay, 1:5 for the MCP-1 assay, 1:2 for the TNF-α assay and 1:10 for the IL-1β assay, to ensure they were within the calibration range. Samples falling below the lower limit of detection were assigned concentrations equivalent to the lower limit of detection for statistical analysis. The intra-assay coefficients of variation (%CV) of the assays were 7%, 5%, 13%, 11% and 10% for PGE₂, IL-6, TNF-α, MCP-1 and IL-1β, respectively.

RNA extraction and quantitative real-time RT-PCR

The remaining halves of the post-treatment full-thickness Transwell membranes were separated into amnion and choriodecidua and stored in 750 µI RNAlater® RNA Stabilization Reagent (Qiagen, Limburg, the Netherlands) overnight at 4℃; an equivalent sized piece of untreated amnion and choriodecidua, taken directly from the placenta at the time of collection, was washed briefly in sterile PBS and prepared in the same manner. The following day, the majority of the RNAlater was removed and samples stored at –80℃ until analysis. Membranes were weighed in Precellys Tissue Homogenizing CKMix tubes (Bertin Technologies, Saint Quentin en Yvelines Cedex, France) containing 1 ml RNAzol® RT (Molecular Research Center, Cincinnati, OH, USA) and subject to three 30 s homogenisation cycles at 6000 rpm on a Precellys®24 Homogenizer (Bertin Technologies) with a 2-min incubation on ice between each cycle. Total RNA was extracted following the manufacturer’s protocol followed by treatment with DNase-I (Life Technologies, Mulgrave, VIC, Australia) to remove genomic DNA contamination. RNA yield and quality were determined by measuring 260:280 nm ratios using a Nanodrop 1000 (Thermo Fisher Scientific, Wilmington, DE, USA). cDNA was synthesised from 1 µg RNA using Moloney murine leukaemia virus reverse transcriptase with random hexamers (Bioline Pty Ltd, Alexandria, NSW, Australia) according to the manufacturer’s protocol. Quantitative real-time PCR was carried out using the Rotor-Gene Q cycler (Qiagen Pty Ltd, Chadstone, VIC, Australia). Reactions (10 µl) were set up using the following final concentrations: 5 µl of 2 × KiCqStart SYBR Green qPCR ready mix (Sigma Aldrich), 5 pmol each of sense and antisense Kiqstart primers (Sigma Aldrich) and 2 µl cDNA. DNA was amplified using the primer sequences and cycling conditions shown in Table 1. The amplicons were analysed by melt-curve analysis to confirm the absence of non-specific amplification products. Basal expression was computed using the 2^−ΔCt method with reference to the housekeeping gene succinate dehydrogenase complex, subunit A (SDHA). Relative expression was computed using the 2^−ΔΔCt method, with reference to SDHA and normalised to individual DMSO controls.

Table 1.

Primers and cycling conditions used in quantitative RT-PCR.

Gene	Primer sequence 5′-3′	Fragment size (bp)	Amplification and quantitation^a	Cycles
SDHA (NM_004168)	Sense: TGGGAACAAGAGGGCATCTG Antisense: CCACCACTGCATCAAATTCATG	86	95℃, 15 s 58℃, 15 s 60℃, 60 s	40
IL6 (NM_000600.3)	Sense: GACAGCCACTCACCTCCTCTTCA Antisense: TTCACCAGGCAAGTCTCCTC	211	95℃, 15 s 60℃, 15 s 72℃, 60 s	45
TNFA (NM_000594.3)	Sense: CTCAGCCTCTTCTCCTTC Antisense: AGAAGATGATCTGACTGCC	147	95℃, 15 s 58℃, 15 s 60℃, 60 s	45
PTGS2 (N M_000963.3)	Sense: AAGCAGGCTAATACTGATAGG Antisense: TGTTGAAAAGTAGTTCTGGG	113	95℃, 15 s 58℃, 15 s 60℃, 60 s	45

In all cases, denaturation was performed at 95℃ for 3 min with a final melt curve program of 72–95℃; 0.5℃/s.

Statistical analysis

Continuous data were summarised with medians, interquartile ranges (IQR) and ranges (R) and categorical data with frequency distributions. Univariate comparisons between HCA⁺ and HCA^– placental tissues were made using the Mann–Whitney test for continuous outcomes and the χ²or Fisher exact test for categorical outcomes. Cytokine and gene expression data were transformed to the natural logarithm for analysis to correct data normality. Mixed linear regression analysis with a random intercepts model was performed to assess the effects of CSAID treatments on cytokine and gene expression levels, while accounting for the correlation between treatments administered to common placental tissues. All models were assessed for the influence of fetal sex and covariates that differed at baseline, including gestation at threatened preterm labour, twin pregnancy, oxytocin administration, length of labour and vaginal/caesarean delivery. Models were also assessed for an interaction between baseline concentration level and treatment. SPSS (version 20.0; IBM, Armonk, NY, USA) and SAS (version 9.3; SAS Institute, Cary, NC, USA) statistical software were used for data analysis. P-Values < 0.05 were considered statistically significant.

Results

Cohort and clinical characteristics

A total of 28 membranes from 23 women (six twin pregnancies) who delivered live babies following spontaneous preterm labour between 30 and 34 wk of gestation were included in this study (Table 2). For all but one twin pregnancy (HCA^–, MCDA), membranes from both twins were included as separate cases. Ninety-six percent of participants received their last dose of antenatal glucocorticoids 24–48 h (median) prior to delivery, while 100% received antibiotics in labour; 28% of deliveries followed PPROM.

Table 2.

Maternal characteristics based on 28 extraplacental membranes.

		All (n = 28)^a	HCA⁺ (n = 13)	HCA^– (n = 15)	P-Value^b
Age (yr)		31 (26–33 [18–37])	27 (24–34 [18–37])	31 (28–34 [24–36])	n.s.
Gravidity		3 (2–3 [1–9])	3 (2–4 [1–9])	3 (1–3 [1–5])	n.s.
Parity		0 (0–2 [0–6])	1 (0–2 [0–6])	0 (0–1 [0–3])	n.s.
Smoker		7 (25%)	4 (31%)	3 (20%)	n.s.
History preterm birth		7 (25%)	5 (39%)	2 (13%)	n.s.
Pregnancy type	Singleton	17 (61%)	12 (92%)	5 (33%)	0.005
	MCDA twin	5 (18%)	1 (8%)	4 (27%)
	DCDA twin	6 (21%)	0	6 (40%)
GA at TPL (wk)		32 (30–33 [27–34])	32 (31–33 [30–34])	31 (30–32 [27–34])	n.s.
Tocolytics		23 (82%)	10 (77%)	13 (87%)	n.s.
GA at tocolytics (wk)		32 (30–33 [27–34]) n = 23	33 (32–34 [30–34]) n = 10	30 (30–32 [27–33]) n = 13	0.005
Antenatal glucocorticoids		27 (96%)	12 (92%)	15 (100%)	n.s.
Clinical chorioamnionitis		3 (11%)	2 (15%)	1 (7%)	n.s.
GA at antenatal antibiotics		32 (32–33 [29–34])	33 (32–34 [30–34])	32 (32–33 [29–34])	n.s.
ROM	Artificial	12 (43%)	5 (39%)	7 (47%)	n.s.
	In labour	8 (28%)	2 (15%)	6 (40%)
	PPROM	8 (28%)	6 (46%)	2 (13%)
Oxytocin		8 (29%)	1 (8%)	7 (47%)	0.038
Length of labour (h)		8 (4–13 [1–27])	5 (3–8 [1–18])	11 (6–19 [3–27])	0.019
Mode of delivery	SVD	16 (57%)	11 (85%)	5 (33%)	0.023
	AVD	5 (18%)	1 (8%)	4 (27%)
	NELUSCS	7 (25%)	1 (8%)	6 (40%)

Data are presented as median (IQR [range]) or n (%).

P-Values represent analysis of HCA + vs HCA- membranes.

n.s.: not significant (P > 0.05); TPL: threatened preterm labour; ROM: rupture of membrane; SVD: spontaneous vaginal delivery; AVD: assisted vaginal delivery; NELUSCS: non-elective lower uterine segment Caesarean section.

Forty-six percent of extraplacental membranes were characterised as HCA⁺, with two of these diagnosed with funisitis and two with villitis (Table 3). Of the HCA⁺ membranes, mild focal chorioamnionitis was detected in six (46%), with chorioamnionitis extending into chorionic plate present in seven (54%). Fetal inflammatory reaction (FIR) was associated with six HCA + membranes (46%; P = 0.005). Trimmed placenta mass was higher (134 g) in the HCA⁺group (P = 0.034). Five of the HCA⁺ placentas were positive for microorganisms (INF⁺) by standard microbiological culture, with Ureaplasma species being the most common organism detected. The presence of hypermature villi was seen more often in HCA^– membranes (P = 0.027). There were no differences between the HCA⁺and HCA^– groups in terms of maternal age, gravidity, parity, history of PTB or smoking (Table 2). Twin births occurred significantly more frequently in the HCA^– group (P = 0.005). Women in the HCA^– group also (a) received tocolytics approximately 3 wk earlier (P = 0.005); (b) had labours of approximately 5 h longer in duration (P = 0.019); (c) were more likely to require oxytocin in labour (P = 0.038); and (d) were more likely to require assisted vaginal or caesarean section delivery (P = 0.023). Overall, there were no differences in neonatal parameters between the HCA⁺and HCA^– groups (Table 4). The median gestational age (GA) at delivery was 33 wk (range 30–34 wk) and the median birth mass was 1910 g (range 1240–2654 g). Only one neonate (HCA^–) was diagnosed with sepsis and was blood culture-positive for Corynebacterium species, Viridians group Streptococci and Staphylococcus epidermidis.

Table 3.

Placental characteristics.

		All (n = 28)^a	HCA⁺(n = 13)	HCA^– (n = 15)	P-Value^b
Mass (g)		303 (226–416 [69–487])	326 (275–440 [69–480])	228 (198–313 [182–487])	0.034
Extraplacental membranes	Thin and translucent	26 (93%)	13 (100%)	13 (87%)	n.s.
Extraplacental membranes	Thick and opaque	2 (7%)	0	2 (13%)	n.s.
Histological chorioamnionitis	Mild focal	6 (21%)	6 (46%)	0	0.005
Histological chorioamnionitis	Extending into chorionic plate	7 (25%)	7 (54%)	0	0.005
FIR		6 (21%)	6 (46%)	0	0.005
Funisitis		2 (7%)	2 (15%)	0	n.s.
Vasculitis		4 (14%)	4 (31%)	0	0.035
Villitis		2 (7%)	2 (15%)	0	n.s.
Villi development	Appropriately developed	10 (36%)	7 (53%)	3 (20%)	0.027
	Immature	6 (21%)	4 (31%)	2 (13%)
	Hypermature	12 (43%)	2 (15%)	10 (67%)
Microbiology of chorionic plate	E. coli	1 (3.5%)	1 (8%)	0	0.035
Microbiology of chorionic plate	Ureaplasma species	4 (14%)	4 (31%)	0	0.035

Data are presented as median (IQR [range]) or n (%).

P-Values represent analysis of HCA⁺ vs. HCA^– membranes.

n.s.: not significant (P > 0.05).

Table 4.

Neonatal characteristics.

		All (n = 28)^a	HCA⁺(n = 13)	HCA^– (n = 15)	P-Value^b
GA at delivery (wk)		33 (32–33 [30–34])	33 (32–36 [30–34])	32 (32–33 [31–34])	n.s.
Birthmass (g)		1910 (1738–2249 [1240–2654])	2110 (1860–2301 [1240–2654])	1770 (1688–1980 [1440–2400])	n.s.
Sex (male)		13 (46%)	5 (39%)	8 (53%)	n.s.
Apgar score < 7 at:	1 min	10 (36%)	3 (23%)	7 (47%)	n.s.
Apgar score < 7 at:	5 min	0	0	0	n.s.
Admitted to SCN		27 (96%)	12 (92%)	15 (100%)	n.s.
Duration of SCN stay (d)		18 (7–27 [3–37])	18 (11–28 [3–37])	13 (7–27 [5–36])	n.s.
Sepsis (blood culture-positive)		1 (3.5%)	0 (0%)	1 (7%)	n.s.
Mode of separation	Discharged home	6 (21%)	3 (23%)	3 (20%)	n.s.
Mode of separation	Transferred	22 (79%)	10 (77%)	12 (80%)	n.s.

Data are presented as median (IQR [Range]) or n (%).

P-Values represent analysis of HCA + vs HCA- membranes.

SCN: special care nursery; n.s.: not significant (P > 0.05).

Influence of inflammation on equilibration phase production of pro-inflammatory mediators

Unexpectedly, we found no overall differences in IL-6, MCP-1 or TNF-α production in the equilibration phase (pre-treatment, basal levels) between HCA⁺and HCA^– membranes at either the amniotic or decidual faces (Figure 2a, b). In contrast, ∼2.4-fold higher equilibration phase concentrations of PGE₂ (P = 0.005) and ∼3.3-fold higher concentrations of IL-1β (P = 0.010) were measured in the decidual compartments of HCA⁺ membranes. Only basal concentrations of IL-1β tended to be elevated (∼2.5-fold) at the amniotic face of HCA + membranes (P = 0.056). There were no differences in equilibration phase production of any of the pro-inflammatory mediators at either face of HCA⁺FIR⁺ and HCA⁺FIR^– membranes. Interestingly, analysis of the effects of microbial colonisation revealed an approximate fourfold increase in decidual PGE₂ production (P = 0.001), a sixfold increase in decidual TNF-α production (P = 0.024) and a threefold increase in decidual MCP-1 production (P = 0.014) in HCA⁺INF^–membranes. Basal concentrations of PGE₂ in the amniotic compartment from twin pregnancies were marginally higher (∼1.5-fold, P = 0.045) compared with singletons, while MCP1 concentrations in the amniotic compartment were significantly lower in males compared with females (reduced by 59%, P = 0.042). There was no effect of the presence of hypermature villi on the basal concentrations and pro-inflammatory mediators. Post-treatment histological analysis revealed that the mean inflammatory cell infiltration scores across the six Transwell replicates for individual extraplacental membranes was higher for HCA⁺ membranes [mean 2.6 (range 1.0–3.5); P = 0.002, unpaired t-test] than the HCA^– membranes [mean 1.2 (range 0.2–2.0)]. These data were in concordance with the routine histopathology diagnosis (Table 3). The degree of variability in inflammatory cell infiltration scores observed between replicate Transwells was similar for the HCA⁺ and HCA^– groups [mean intra-membrane CV: 20% (range 0–39%) vs. 19% (range 0–39%), respectively].

Figure 2.

Influence of inflammation on equilibration phase production of pro-inflammatory mediators by human preterm extraplacental membranes. (a) Amniotic and (b) decidual pro-inflammatory mediator concentrations (PGE₂, IL-6, TNF-α, MCP-1 and IL-1β; ng/ml) in equilibration phase media (vehicle controls) of HCA^– and HCA⁺ membranes. Data represent the geometric mean concentration ±95% confidence interval for 28 extraplacental membranes. All concentrations were transformed to the natural logarithm for analysis with statistical significance representing effects for the logged values.

By comparing concentrations in vehicle control Transwells, we found that membranes (irrespective of HCA status) increased amniotic production of pro-inflammatory mediators in the treatment phase (12–24 h, post-treatment) compared with the equilibration phase (0–12 h, before addition of drugs). In amniotic compartments (Figure 3a), the geometric mean concentrations of PGE₂, IL-6 and IL-1β concentrations were increased 1.4-fold (P = 0.023), 1.3-fold (P = 0.033) and 2.2-fold (P = 0.008), respectively. Amniotic TNF-α production tended to decline in the treatment period (∼40% reduction, P = 0.055). In decidual compartments (Figure 3b), PGE₂, IL-6 and MCP-1 concentrations were comparable in the equilibration and treatment phases of the vehicle control Transwells. Production of IL-1β, however, increased by 20% (P = 0.012) and TNF-α decreased by 60% (P = 0.013) in the treatment phase. Final concentrations of IL-1β were significantly higher in the decidual compartments of HCA⁺ compared with HCA^– membranes (2.2 fold, P = 0.006). A significant positive association between length of labour (h) and final concentrations of amniotic (P = 0.030) and decidual (P = 0.002) production of IL-1β was also observed.

Figure 3.

Change over time in pro-inflammatory mediator production by human preterm extraplacental membranes. (a) Amniotic and (b) decidual pro-inflammatory mediator concentrations (PGE₂, IL-6, TNF-α, MCP-1 and IL-1β; ng/ml) in equilibration phase compared with treatment phase media (vehicle controls). Data represent the geometric mean concentration ±95% confidence interval for 28 extraplacental membranes (combined irrespective of HCA status). Changes over time were determined by Wilcoxon matched-pairs signed rank test after assessment for normality.

Effects of CSAIDs on pro-inflammatory mediator production by preterm membranes with and without chorioamnionitis

Overall, we found no differences in treatment efficacy for any of the CSAIDs between HCA⁺ and HCA^– groups with respect to amniotic production of PGE₂, IL-1β, IL-6, MCP-1 and TNF-α, and decidual production of PGE₂, IL-6, MCP-1 and TNF-α. As such, the drug response data from both HCA⁺ and HCA^– groups were combined for analysis.

In amniotic compartments (Figure 4a–e), TPCA1 treatment reduced PGE₂ concentrations by 62% (P < 0.001), IL-6 concentrations by 29% (P = 0.008), MCP-1 concentrations by 58% (P < 0.001) and IL-1β concentration by 50% (P = 0.007). No significant anti-inflammatory effects of TPCA1 were observed in decidual compartments (Figure 4f–j). SB239063 reduced PGE₂ concentrations by 45% (Figure 4a, P = 0.005) at the amniotic face, and by 36% at the decidual face (Figure 4f, P = 0.005). SB239063 also reduced amniotic IL-6 concentrations by 32% (Figure 4b, P = 0.003), amniotic MCP-1 concentrations by 32% (Figure 4d, P = 0.037) and trended towards a reduction in decidual IL-6 production (Figure 4g, 17%, P = 0.063). TPCA1 and SB239063 only inhibited amniotic production of TNF-α by membranes that had exhibited the highest concentrations of TNF-α during the equilibration phase (P = 0.047 and P = 0.004, respectively).

Figure 4.

Inhibition of pro-inflammatory mediator production by human preterm extraplacental membranes in response to amniotic CSAID treatment. Concentrations (ng/ml) of pro-inflammatory mediators (PGE₂, IL-6, TNF-α, MCP-1 and IL-1β) in (a–e) amniotic and (f–j) decidual compartments of human preterm extraplacental membrane Transwells in response to amniotic CSAID (iNBD, SB239063, TPCA1 and OxZ) or NAC treatment; all membranes combined irrespective of inflammatory status (HCA⁺, positive for histological chorioamnionitis; HCA^–, negative for histological chorioamnionitis). Data from a total of 28 (15 HCA^–, 13 HCA⁺), 27 (14 HCA^–, 13 HCA⁺), 22 (11 HCA^–, 11 HCA⁺), 24 (12 HCA^–, 12 HCA⁺), 24 (14 HCA^–, 10 HCA⁺) 25 (12 HCA^–, 13 HCA⁺) extraplacental membranes were available for analysis in response to DMSO, OxZ, iNBD, SB239063, TPCA1 and NAC treatment, respectively. All concentrations were transformed to the natural logarithm for statistical analysis and assessed for influence of covariates that differed at baseline including length of labour, use of oxytocin, fetal sex, mode of delivery, twin birth and GA at presentation in labour, and were analysed by mixed models. Data represent the geometric mean concentration ±95% confidence interval with statistical comparisons made to DMSO vehicle control.

OxZ was the most effective CSAID of those tested, reducing PGE₂ concentrations in amniotic compartments by 70% (Figure 4a, P < 0.001), IL-6 concentrations by 40% (Figure 4b, P < 0.001) and MCP-1 concentrations by 52% (Figure 4d, P < 0.001). OxZ was the only drug to significantly reduce IL-6 concentrations in decidual compartments (Figure 4g), although the effect was only modest (18%, P = 0.034). OxZ inhibited TNF-α production by 28% in amniotic compartments (Figure 4c, P = 0.014), with greatest effects again seen in membranes with the highest equilibration phase concentrations. Amniotic IL-1β concentrations were approximately 28% lower with OxZ treatment, although this did not reach statistical significance.

NAC treatment reduced amniotic MCP-1 concentrations by 55% (Figure 4d, P < 0.001) and trended towards an effect on amniotic IL-6 production (Figure 4b, 20% reduction, P = 0.072). TNF-α concentrations were reduced by NAC treatment in the amniotic compartment (Figure 4c, 33%; P = 0.003), with greatest anti-inflammatory effects again seen in membranes with elevated basal levels of amniotic TNF-α production. NAC had no effect on decidual pro-inflammatory mediator production (Figure 4f–j). Treatment with iNBD had no effect on any of the pro-inflammatory mediators measured. Overall, there were no significant differences in the efficacy of any of the CSAIDs tested between HCA⁺FIR⁺ and HCA⁺FIR^– membranes. The low number of colonised membranes precluded a similar analysis of efficacy in relation to bacterial colonisation status.

Effects of CSAIDs on amniotic and choriodecidual mRNA expression of pro-inflammatory cytokines and PTGS2

Fifteen to 20 amnion and 19–24 chorion samples per treatment group were available for analysis of mRNA expression of pro-inflammatory cytokines and prostaglandin–endoperoxide synthase 2 (PTGS2; also known as cyclooxygenase-2 or COX2). Levels of expression of PTGS2, IL6 and TNFA mRNA in separated amnion and choriodecidua were determined in untreated membranes, and in response to the three most effective CSAIDs: TPCA1, SB239063 and OxZ. We found no significant differences in basal expression of PTGS2 and IL6 in the amnion (Figure 5a) or choriodecidua (Figure 5b) of HCA^– and HCA⁺ membranes. TNFA mRNA levels were significantly increased (Figure 5a; ∼threefold, P = 0.039) in HCA⁺ amnion samples compared to HCA^–; no difference was found for the choriodecidua. Again, no differences in CSAID efficacies were observed for any gene when comparing HCA^– and HCA⁺ membranes. As such, all membranes were combined to determine the effects of each CSAID on fold-change in mRNA expression levels relative to the vehicle control.

Figure 5.

Baseline and post-treatment mRNA expression levels of pro-inflammatory mediators in amnion and choriodecidua of human preterm extraplacental membranes. (a) Amniotic and (b) choriodecidual mRNA expression levels of pro-inflammatory mediators (PTGS2, IL6, TNFA) in untreated membranes positive for histological chorioamnionitis (HCA⁺) and negative for histological chorioamnionitis (HCA^–) membranes. Data are presented as fold change relative to the mean of pooled HCA^– membranes for a total of 24 (14 HCA^–, 10 HCA⁺), 20 (12 HCA^–, eight HCA⁺) and 19 (nine HCA^–, 10 HCA⁺) extraplacental membranes for analysis of untreated PTGS2, IL6 and TNFA, respectively. Relative mRNA expression levels of pro-inflammatory mediators in (c, e, g) amnion and (d, f, h) choriodecidua separated from human preterm extraplacental membranes after amniotic CSAID (SB239063, TPCA1 and OxZ) administration (all membranes combined irrespective of inflammatory status). Ct values were normalised to SDHA and expressed as fold changes relative to vehicle control (DMSO). Gene expression data were transformed to the natural logarithm for analysis with outputs representing effects for the logged values. Data from a total of 20 (12 HCA^–, eight HCA⁺), 16 (10 HCA^–, six HCA⁺) and 15 (seven HCA^–, eight HCA⁺) extraplacental membranes were available for analysis of CSAID effects on PTGS2, IL6 and TNFA, respectively. Models were adjusted for untreated expression levels and assessed for the influence of covariates that differed at baseline including length of labour, use of oxytocin, mode of delivery, twin birth, GA at threatened preterm labour and fetal sex. All data are presented as geometric mean ±95% confidence interval.

In the amnion, PTGS2 mRNA expression levels (Figure 5c) were significantly reduced after treatment with both OxZ (57%, P = 0.008) and TPCA1 (47%, P = 0.048), with a trend towards a reduction with SB239063 (P = 0.053). SB239063 had a greater effect on PTGS2 expression in male fetuses (P = 0.043) compared with female, and in twins (P = 0.017) compared with singletons. IL6 mRNA expression levels in amnion (Figure 5e) were significantly reduced by treatment with OxZ (78%, P = 0.003) and TPCA1 (64%, P = 0.035) with no influence from fetal sex or twins observed. A reduction in TNFA expression in amnion was observed following TPCA1 treatment (Figure 5g, 56%, P = 0.003).

The CSAID treatments had less effect on choriodecidual gene expression (Figure 5d, f, h). However, TPCA1 treatment did have a significant inhibitory effect on PTGS2 mRNA expression levels in HCA^– membranes (79% reduction, P = 0.046) whilst IL6 mRNA levels were increased in women treated with oxytocin (310% increase, P = 0.002), decreased in twins (63%, P = 0.017) and decreased with increasing GA at time of labour (18% decrease for each additional wk gestation, P = 0.023). After adjusting for these, choriodecidual IL6 mRNA expression levels were reduced in response to TPCA1 (68%, P = 0.014) and SB239063 (67%, P = 0.018). Statistical analysis of CSAID efficacy in HCA⁺FIR⁺, or HCA⁺INF⁺ membranes, could not be performed owing to inadequate sample size.

Discussion

Using an ex vivo Transwell model, we assessed the anti-inflammatory efficacies of a number of novel CSAIDs administered to the fetal face of human fetal membranes delivered preterm after spontaneous labour. We hypothesised that preterm membranes characterised as HCA⁺ would have increased cytokine and prostaglandin production compared with HCA^– membranes. Consequently, we expected that HCA⁺ membranes would be more responsive to treatment.

Inflammation plays a key role in the pathogenesis of PTB, with up to half of all spontaneous PTBs (reviewed in³) and almost 70% of deliveries < 34 wk of gestation⁸ being associated with intrauterine inflammation. Microbial invasion of the amniotic cavity can result in activation of molecular pattern recognition receptors (PRRs), for example the Toll like receptors (TLRs), by pathogen associated molecular patterns (PAMPs) which leads to a cascade of inflammatory signalling events, culminating in enhanced production of pro-inflammatory cytokines, chemokines and prostaglandins (reviewed in³⁶). Routine placental microbiological analysis identified five from 13 HCA⁺ membranes to be culture-positive (INF⁺); all in the HCA^– group were INF^–, suggesting true colonisation in the HCA⁺ group and not sporadic contamination.

The inflammatory causes for the remaining eight HCA⁺ membranes were not identified (note: cases of gestational diabetes, pre-eclampsia and intrauterine growth restriction were all excluded from our study). While it is possible that routine microbiological culture did not identify all cases of colonisation,³⁷ these membranes most likely represent examples of sterile inflammation. Sterile intra-amniotic inflammation, defined as presence of an acute inflammatory response (e.g. elevated AF IL-6 levels) in the absence of detectable microorganisms,³⁸ has been reported in women delivering preterm with intact membranes,⁸ in asymptomatic women with a short cervix on ultrasound³⁹ and in women with PPROM presenting after 24 wk of gestation.⁹ While the precise triggers for sterile intra-amniotic inflammation are not yet fully defined, damage-associated molecular patterns (DAMPs) and alarmins associated with oxidative stress, such as the high mobility group box protein 1, have been identified as potential stimuli. These damage-associated triggers activate inflammation via p38 MAPK and NF-κB signalling cascades in a fashion largely indistinguishable from the effects of microbial exposure.^10,40,41

Contrary to our hypothesis, we found the baseline production of cytokines and prostaglandins to be reasonably similar between HCA⁺ and HCA^– membranes at both the mRNA and protein levels. A modest trend towards increased PTGS2, IL6 and TNFA mRNA expression in amnion of HCA⁺ membranes was observed, together with evidence of increased PGE₂ and IL-1β production at the decidual face. We have previously reported that levels of pro-inflammatory cytokines in amnion and choriodecidual membranes are increased with labour and in HCA⁺ membranes (reviewed in⁴²). All placentas included in this study were delivered following spontaneous onset of preterm labour, an inflammatory process in its own right (reviewed in⁴³). This, together with a number of other confounders that were identified in the present study, including the limited sample size, may have masked this expected trend; however, these were all taken into account when analysing the data. Glucocorticoids have anti-inflammatory properties that may have dampened cytokine responses. However, all but one pregnancy received glucocorticoids within 24–48 h of delivery, so this is unlikely to have accounted for the lack of differences observed.

A thorough analysis of maternal covariables showed that HCA^– membranes were collected from women who laboured significantly longer; were more likely to have received oxytocin and/or an assisted delivery (assisted vaginal or non-elective caesarean sections); and were more likely to be carrying a twin pregnancy. Oxytocin has been shown to activate NF-κB-mediated inflammatory pathways, resulting in enhanced pro-inflammatory gene expression.⁴⁴ Median levels of IL-1β and TNF-α have also been shown to be increased in mid-trimester AFs from twin gestations compared with singleton.⁴⁵ HCA^– placentas were also generally smaller and more likely to be described with hypermature villi, suggesting an alternate pathway to premature labour in this cohort: poor placentation/ischemia (reviewed in⁴⁶). All of these factors may have obscured inherent differences in basal inflammatory mediator production. Finally, it may be the case that the Transwell model is not optimal for the comparison of basal cytokine production between different preterm membranes, or that longer incubation times are required for assessing differential activation between HCA⁺ and HCA^– membranes. We note that membrane integrity was maintained in > 90% of both HCA⁺ and HCA^– Transwells, with those that were compromised excluded from analysis. Future studies are required to unravel this.

The CSAIDs we chose for this study target key signalling molecules within the cytokine and TLR-mediated NF-κB signal transduction pathway, including the upstream protein kinase TAK1 and the core IKK complex consisting of IKK-α, IKK-β and IKK-γ (also known as NEMO), and the p38 MAPK pathway, which intersects with the NF-κB signalling cascade. The location of the selected targets between the TLRs and the NF-κB and p38 MAPK molecules themselves supports our expectation that the CSAIDs will have broad-spectrum effects against a range of stimuli, DAMPS and PAMPs, with minimal off-target side effects on systemic maternal immunity or fetal immune development.⁴⁷ Irrespective of HCA or the inflammatory stimulus, we saw consistent anti-inflammatory efficacies of the CSAIDs at both protein and mRNA levels. This reinforces the clinical potential of these agents in a setting where multiple stimuli are possible, and identifying the inflammatory stimulus prior to treatment is likely to be impractical. TPCA1 and OxZ were the most effective inhibitors, as each inhibited amniotic secretion of four of five pro-inflammatory mediators measured, with anti-inflammatory efficacy also seen against at least two from three mediators at the mRNA level. SB239063 inhibited secretion of three mediators and mRNA expression of one at the amniotic face. TPCA1 and OxZ were notably more effective than NAC, which inhibited secretion of only two mediators in our study, while iNBD was completely ineffective. As such, the anti-inflammatory efficacies of NAC and iNBD were not assessed further at the mRNA level. In general, drug efficacy was largely restricted to amniotic compartments. This supports our previous studies using human and ovine membranes stimulated in utero or ex vivo with LPS and Ureaplasma parvum,^20,34 and could reflect the limited ability of the individual CSAIDs to penetrate the membrane barrier, restricting their actions to the amniotic epithelium. Alternatively, higher doses over a longer duration may be required to completely block transmembrane inflammatory signalling. This latter explanation is perhaps more likely, as stimulation of amnion has been shown to result in increased choriodecidual cytokine production via indirect action of amnion-derived mediators.⁴⁸ Nevertheless, this observation supports our hypothesis that intra-amniotic delivery of CSAIDs would allow localised targeting of inflamed amniotic and fetal tissues with minimal maternal exposure and thus negligible systemic immunomodulation and risk of maternal immune compromise (reviewed in⁴⁷). Of course, this research is still a long way from the first clinical trial; dose, timing, route of administration and the entry criteria for such a trial will need careful consideration.

This study was limited by the relatively low number of preterm human extraplacental membranes subsequent to stringent exclusion criteria to minimise confounding by other inflammation-associated pregnancy conditions, including gestational diabetes, intrauterine growth restriction and pre-eclampsia. This resulted, however, in a clearly defined cohort, albeit of limited sample size, which was tested in a well-validated human model⁴⁹ that replicates the physiologic separation of fetal and maternal compartments during intra-amniotic infection and inflammation in vivo. The greatest impact of the low numbers was seen in the analysis of gene expression data, where low RNA yields resulted in a number of missing samples. Furthermore, the lack of an observed group-by-treatment interaction effect in this study may have been due to the limited sample size and may have been detectable with increased power. The decline in TNF-α production in the second 12-h phase of this study, as previously reported,²⁰ meant that assessment of efficacy against TNF-α was more challenging. We note that OxZ, TPCA1 and SB239063 were all effective at inhibiting the secretion of TNF-α at the amniotic face of membranes which had the greatest levels of basal TNF-α production. This lack of differential efficacy between HCA^– and HCA⁺ membranes at the protein levels was verified at the mRNA level, with no overall difference in the response to OxZ, TPCA1 and SB239063 observed between HCA^– and HCA⁺ membranes.

In conclusion, and in contrast to expectations, our findings suggest that inflammatory mediator production in full-thickness fetal membranes delivered following spontaneous preterm labour is not markedly affected by leukocyte infiltration status. In our model of intra-amniotic administration, we showed effective inhibition of inflammatory gene expression and cytokine production to be primarily restricted to the amniotic face, suggesting limited penetration of the drugs through the fetal membranes, at least within the 12 h experimental window. Intra-amniotic treatment with selected CSAIDs, namely TPCA1 and OxZ, may prove effective in the future in suppressing localised, intra-amniotic inflammation in at risk women with no requirement to identify the nature of the inflammatory stimulant—microbial or sterile. Further, CSAIDs have the potential to be more effective and better tolerated than less selective inhibitors, such as TLR antagonists⁵⁰ or selective cytokine blockers, such as IL-1 receptor antagonists^51,52 or anti-TNF biologics.^52,53 This is because they specifically target key molecules involved in the pro-inflammatory signalling cascades linking activating molecules to the secretion of pro-inflammatory mediators that prematurely trigger labour and harm the fetus.⁴⁷

While this and other studies now support the further investigation of CSAIDs for the prevention of inflammation-mediated PTB, it is important to note that the inflammatory pathways that are activated in spontaneous preterm labour have not been fully characterised and are the subject of ongoing research. This and other important pharmacotherapeutic issues such as maternal and fetal toxicity and side effects, dose frequency, route of drug administration, appropriate identification of women for treatment, and the entry criteria for future clinical trials still need to be carefully addressed before clinical translation of these compounds can be considered. Despite the limitations described above, our findings support the view that CSAIDs are promising candidates as part of a combination protective therapy in conjunction with a broad-spectrum antibiotic capable of reaching the fetal and amniotic compartments, such as the recently described fluoroketolide solithromycin.⁵⁴ Such a combined therapeutic regimen has potential for the prevention and treatment of PTB and the protection of the fetus from the adverse effects of prematurity and exposure to IUI.

Footnotes

Acknowledgements

The authors wish to thank the mothers who donated placentas for this study; our research midwives Cherry Young RN RM and Diane Loh RN RM; the staff of the King Edward Memorial Hospital Labour and Birth Suite.

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was funded by the National Health and Medical Research Council of Australia (#GTN1024467; RA/1/54/1649) and the Women and Infants Research Foundation of Western Australia (WIRF) of Western Australia.

References

Saigal

Doyle

. An overview of mortality and sequelae of preterm birth from infancy to adulthood. Lancet 2008; 371: 261–269.

Lee

Katz

Blencowe

, et al. National and regional estimates of term and preterm babies born small for gestational age in 138 low-income and middle-income countries in 2010. Lancet Global health 2013; 1: e26–e36.

Goldenberg

Hauth

Andrews

. Intrauterine infection and preterm delivery. N Engl J Med 2000; 342: 1500–1507.

Kim

Romero

Gervasi

, et al. Widespread microbial invasion of the chorioamniotic membranes is a consequence and not a cause of intra-amniotic infection. Lab Invest 2009; 89: 924–936.

Gravett

Witkin

Haluska

, et al. An experimental model for intraamniotic infection and preterm labor in rhesus monkeys. Am J Obstet Gynecol 1994; 171: 1660–1667.

Hofer

Kothari

Morris

, et al. The fetal inflammatory response syndrome is a risk factor for morbidity in preterm neonates. Am J Obstet Gynecol 2013; 209: 542 e1–e11.

Bashiri

Burstein

Mazor

. Cerebral palsy and fetal inflammatory response syndrome: a review. J Perinatal Med 2006; 34: 5–12.

Romero

Miranda

Chaiworapongsa

, et al. Prevalence and clinical significance of sterile intra-amniotic inflammation in patients with preterm labor and intact membranes. Am J Reprod Immunol 2014; 72: 458–474.

Romero

Miranda

Chaemsaithong

, et al. Sterile and microbial-associated intra-amniotic inflammation in preterm prelabor rupture of membranes. J Matern Fetal Neonatal Med 2015; 28: 1394–1409.

10.

Menon

. Oxidative stress damage as a detrimental factor in preterm birth pathology. Front Immunol 2014; 5: 567–567.

11.

Lannon

Vanderhoeven

Eschenbach

, et al. Synergy and interactions among biological pathways leading to preterm premature rupture of membranes. Reprod Sci 2014; 21: 1215–1227.

12.

Lamont

. Antibiotics used in women at risk of preterm birth. Am J Obstet Gynecol 2008; 199: 583–584.

13.

Kenyon

Boulvain

Neilson

. Antibiotics for preterm rupture of membranes. Cochrane Database Syst Rev 2013; 12: CD001058–CD001058.

14.

Chapman

Reveiz

Illanes

Bonfill Cosp

. Antibiotic regimens for management of intra-amniotic infection. Cochrane Database Syst Rev 2014; 12: CD010976–CD010976.

15.

Holzheimer

. Antibiotic induced endotoxin release and clinical sepsis: a review. J Chemother 2001; 13: 159–172.

16.

Kaplan

Restaino

Raval

, et al. Renal failure in the neonate associated with in utero exposure to non-steroidal anti-inflammatory agents. Pediatr Nephrol 1994; 8: 700–704.

17.

Nakhai-Pour

Broy

Sheehy

Berard

. Use of nonaspirin nonsteroidal anti-inflammatory drugs during pregnancy and the risk of spontaneous abortion. CMAJ 2011; 183: 1713–1720.

18.

Shahin

Hassanin

Ismail

, et al. Effect of oral N-acetyl cysteine on recurrent preterm labor following treatment for bacterial vaginosis. Int J Gynaecol Obstet 2009; 104: 44–48.

19.

Lappas

Permezel

Rice

. N-Acetyl-cysteine inhibits phospholipid metabolism, proinflammatory cytokine release, protease activity, and nuclear factor-kappaB deoxyribonucleic acid-binding activity in human fetal membranes in vitro. J Clin Endocrinol Metab 2003; 88: 1723–1729.

20.

Stinson

Ireland

Kemp

, et al. Effects of cytokine-suppressive anti-inflammatory drugs on inflammatory activation in ex vivo human and ovine fetal membranes. Reproduction 2014; 147: 313–320.

21.

Paintlia

Singh

. Attenuation of lipopolysaccharide-induced inflammatory response and phospholipids metabolism at the feto-maternal interface by N-acetyl cysteine. Pediatr Res 2008; 64: 334–339.

22.

Wiest

Chang

Fanning

, et al. Antenatal pharmacokinetics and placental transfer of N-acetylcysteine in chorioamnionitis for fetal neuroprotection. J Pediatr 2014; 165: 672–7 e2.

23.

Keelan

. Pharmacological inhibition of inflammatory pathways for the prevention of preterm birth. J Reprod Immunol 2011; 88: 176–184.

24.

Lee

Rebar

Laydon

. Effect of SK&F 86002 on cytokine production by human monocytes. Agents Actions 1989; 27: 277–279.

25.

De Silva

Mitchell

Keelan

. Inhibition of choriodecidual cytokine production and inflammatory gene expression by selective I-kappaB kinase (IKK) inhibitors. Br J Pharmacol 2010; 160: 1808–1822.

26.

Grassia

Maddaluno

Musilli

, et al. The I{kappa}B kinase inhibitor nuclear factor-{kappa}B essential modulator-binding domain peptide for inhibition of injury-induced neointimal formation. Arterioscler Thromb Vasc Biol 2010; 30: 2458–2466.

27.

Shibata

Maeda

Hikiba

, et al. Cutting edge: the IkappaB kinase (IKK) inhibitor, NEMO-binding domain peptide, blocks inflammatory injury in murine colitis. J Immunol 2007; 179: 2681–2685.

28.

May

D’Acquisto

Madge

, et al. Selective inhibition of NF-kappaB activation by a peptide that blocks the interaction of NEMO with the IkappaB kinase complex. Science 2000; 289: 1550–1554.

29.

Barone

Irving

Ray

, et al. SB 239063, a second-generation p38 mitogen-activated protein kinase inhibitor, reduces brain injury and neurological deficits in cerebral focal ischemia. J Pharmacol Exp Ther 2001; 296: 312–321.

30.

Lappas

Permezel

Rice

. Mitogen-activated protein kinase proteins regulate LPS-stimulated release of pro-inflammatory cytokines and prostaglandins from human gestational tissues. Placenta 2007; 28: 936–945.

31.

Ninomiya-Tsuji

Kajino

Ono

, et al. A resorcylic acid lactone, 5 Z-7-oxozeaenol, prevents inflammation by inhibiting the catalytic activity of TAK1 MAPK kinase kinase. J Biol Chem 2003; 278: 18485–18490.

32.

Neubert

Ridder

Bargiotas

, et al. Acute inhibition of TAK1 protects against neuronal death in cerebral ischemia. Cell Death Differ 2011; 18: 1521–1530.

33.

Acuna

Wittwer

Ayers

, et al. Effects of (5 Z)-7-oxozeaenol on the oxidative pathway of cancer cells. Anticancer Res 2012; 32: 2665–2671.

34.

Ireland

Kemp

Miura

, et al. Intraamniotic pharmacological blockade of inflammatory signalling pathways in an ovine chorioamnionitis model. Mol Hum Reprod 2015.

35.

Redline

Faye-Petersen

Heller

, et al. Amniotic infection syndrome: nosology and reproducibility of placental reaction patterns. Pediatr Develop Pathol 2003; 6: 435–448.

36.

Thaxton

Nevers

Sharma

. TLR-mediated preterm birth in response to pathogenic agents. Infect Dis Obstet Gynecol 2010; 2010.

37.

Romero

Miranda

Kusanovic

, et al. Clinical chorioamnionitis at term I: microbiology of the amniotic cavity using cultivation and molecular techniques. J Perinatal Med 2015; 43: 19–36.

38.

Combs

Gravett

Garite

, et al. Amniotic fluid infection, inflammation, and colonization in preterm labor with intact membranes. Am J Obstet Gynecol 2014; 210: 125 e1–e15.

39.

Romero

Miranda

Chaiworapongsa

, et al. Sterile intra-amniotic inflammation in asymptomatic patients with a sonographic short cervix: prevalence and clinical significance. J Matern Fetal Neonatal Med 2014, pp. 1–52.

40.

Bredeson

Papaconstantinou

Deford

, et al. HMGB1 promotes a p38MAPK associated non-infectious inflammatory response pathway in human fetal membranes. PLOS ONE 2014; 9: e113799–e113799.

41.

Romero

Chaiworapongsa

Alpay Savasan

, et al. Damage-associated molecular patterns (DAMPs) in preterm labor with intact membranes and preterm PROM: a study of the alarmin HMGB1. J Matern Fetal Neonatal Med 2011; 24: 1444–1455.

42.

Keelan

Blumenstein

Helliwell

, et al. Cytokines, prostaglandins and parturition—a review. Placenta 2003; 24(Suppl. A): S33–S46.

43.

Christiaens

Zaragoza

Guilbert

, et al. Inflammatory processes in preterm and term parturition. J Reprod Immunol 2008; 79: 50–57.

44.

Kim

MacIntyre

Firmino Da Silva

, et al. Oxytocin activates NF-kappaB-mediated inflammatory pathways in human gestational tissues. Mol Cell Endocrinol 2015; 403: 64–77.

45.

Perni

Kalish

Hutson

, et al. Differential expression of immune system-related components in midtrimester amniotic fluid from singleton and twin pregnancies. Am J Obstet Gynecol 2005; 193: 942–946.

46.

Parker

Werler

. Epidemiology of ischemic placental disease: a focus on preterm gestations. Semin Perinatol 2014; 38: 133–138.

47.

Ireland

Keelan

. Drugs to block cytokine signaling for the prevention and treatment of inflammation-induced preterm birth. Front Immunol 2015; 6: 166–166.

48.

Thiex

Chames

Loch-Caruso

. Tissue-specific cytokine release from human extra-placental membranes stimulated by lipopolysaccharide in a two-compartment tissue culture system. Reprod Biol Endocrinol 2009; 7: 117–117.

49.

Miller

Loch-Caruso

. Comparison of LPS-stimulated release of cytokines in punch versus transwell tissue culture systems of human gestational membranes. Reprod Biol Endocrinol 2010; 8: 121–121.

50.

Kang

Lei

. Role of Toll-like receptor 4 in inflammation-induced preterm delivery. Mol Hum Reprod 2010; 16: 267–272.

51.

Nadeau-Vallee

Quiniou

Palacios

, et al. Novel noncompetitive IL-1 receptor-biased ligand prevents infection- and inflammation-induced preterm birth. J Immunol 2015; 195: 3402–3415.

52.

Fidel

Jr Romero

Cutright

, et al. Treatment with the interleukin-I receptor antagonist and soluble tumor necrosis factor receptor Fc fusion protein does not prevent endotoxin-induced preterm parturition in mice. J Soc Gynecol Invest 1997; 4: 22–26.

53.

Holmgren

Esplin

Hamblin

, et al. Evaluation of the use of anti-TNF-alpha in an LPS-induced murine model. J Reprod Immunol 2008; 78: 134–139.

54.

Saito

Payne

Miura

, et al. Polymyxin B agonist capture therapy for intrauterine inflammation: proof-of-principle in a fetal ovine model. Reprod Sci 2014; 21: 623–631.