C5a Increases the Injury to Primary Neurons Elicited by Fibrillar Amyloid Beta

Reagents

Hanks' balanced salt solution (HBSS), serum-free neurobasal media (NB), B27 supplement (50x), L-glutamine, Prolong Gold anti-fade reagent with 4′,6-diamidino-2-phenylindole (DAPI), SuperScript III reverse transcriptase, SYBR/Green Master mix, and Alexa 405-, 488-, or 555-conjugated secondary antibodies were obtained from ThermoFisher. Poly-L-lysine hydrobromide, cytosine β-D-arabinofuranoside hydrochloride (Ara-C), and anti-actin antibody were from Sigma. Microtubule-associated protein 2 (MAP-2) antibody was obtained from Abcam. C5aR1 antibody (10/92) was obtained from SeroTec (Ager et al., 2010). Anti VGLUT1 and anti GAD67 antibodies were obtained from Millipore. HRP-conjugated F(ab')₂ antibodies were from Jackson ImmunoResearch Laboratories. Human C5a peptide was obtained from CompTech. PMX53 was obtained from Cephalon. All buffers are made with Millipore-purified water with additional filters to eliminate LPS and are periodically tested for endotoxin using the Limulus amebocyte lysate clot assay (all solutions added to cells were <0.1 EU/mL; 1 EU is equivalent to 0.1 ng/mL LPS).

β-Amyloid Synthesis, Purification, and Conformation Characterization

Human β-amyloid (1–42) (Aβ_1-42), provided by Dr. Charles Glabe (University of California at Irvine), was synthesized by fluoren-9-ylmethoxy carbonyl chemistry using a continuous flow semiautomatic instrument as described previously (Burdick et al., 1992). The peptide was reconstituted in filter-sterilized water at a concentration of 1 mM after which an equal volume of 2 × TBS (0.033 M Tris, 0.267 M NaCl) was added (final concentration 500 µM Aβ). After 20 to 24 hr at 4 ℃ to allow fibril formation, aliquots were frozen for future use. The peptide conformation was analyzed by circular dichroism (CD) to confirm β-sheet conformation. Briefly, after using 1 × TBS as a blank, 200 µl of the peptide at 50 µM was run on a Jasco J-720 CD spectrometer and read from 200 nm to 250 nm with a step resolution of 0.5 nm and a scan speed of 20 nm/min. Four scans were acquired and averaged to generate the CD spectra of the peptide (Supplemental Figure S1; Li et al., 2004). OPEN IN VIEWER

Animals, Neuron Isolation, and Culture

All animal experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee of University of California, Irvine. C57BL/6J were purchased from Jackson Laboratory and C5aR1 knock out (C5aR1KO) mice were originally a gift provided by Dr. Rick Wetsel (Hollmann et al., 2008). Pregnant mice were sacrificed by exposure to CO₂ followed by cervical dislocation as a secondary method of euthanasia, after which the E15-E16 embryos were quickly removed, and the whole brains kept in Hank's balanced salt solution free of calcium and magnesium (CMF) and cleaned of meninges. Cerebral cortices were dissected out and exposed to 0.125% of trypsin in CMF for 7 min at 37 ℃. Cortical tissues were then resuspended in Dulbecco's modified eagle medium (DMEM) supplemented with fetal bovine serum (DMEM/FBS10%; endotoxin concentration ≤ 0.06 EU/mL) and dissociated by trituration using flame polished siliconized Pasteur pipettes. Viable cells, quantified by trypan blue exclusion, were plated at 1 to 2 × 10⁵ cells per well in 0.5 mL of DMEM/FBS10% on poly L-lysine (100 µg/mL) coated glass coverslips (Neuvitro) in 24-well plates (Costar, Cambridge, MA, USA). After 2 hr, the media was replaced with 0.5 mL serum-free neurobasal medium supplemented with B27 (NB/B27). On Day 3, the media was supplemented with Ara-C at 10 nM to reduce glia proliferation, and cultures were grown for 7 to 10 days in vitro before stimulation with 5 µM fAβ, human C5a (1, 10, and 100 nM; Benoit and Tenner, 2011) or PMX53 (100 nM). The concentration of fAβ chosen was previously shown to confer partial damage to primary rat neurons (Li et al., 2004) and confirmed with mouse neurons (Benoit et al., 2013). The dose of 100 nM C5a was selected for further interaction studies with fAβ after preliminary studies demonstrated 100 nM of C5a caused the biggest decrease in MAP-2 (Supplemental Figure S2). In some experiments, TNF-alpha was added on Day 7 at 0, 10, and 100 ng/mL for 24 hr, followed by lysis of neurons for RNA isolation for C5aR1 qRT-PCR.

Immunocytochemistry

Neurons were fixed with 3.7% paraformaldehyde and permeabilized with 0.1% Triton X-100. Immunocytochemistry was performed as described previously (Benoit and Tenner, 2011). Briefly, after blocking with 10% FBS in PBS, neurons were incubated with chicken anti-MAP-2 antibody (dilution: 1:10,000) for 24 hr at 4 ℃. After three washes, coverslips were incubated with Alexa fluor 488-conjugated anti-chicken IgG antibody (dilution: 1:1,000) at room temperature (RT) for 1 hr. For colocalization experiments after blocking, cells were incubated with chicken anti MAP-2 antibody (9 μg/mL) and mouse anti GAD67 (1.5 μg/mL, clone 1G10.2, Millipore) or mouse anti VGLUT1 (1 μg/mL, Millipore) for 1 hr at RT. Cells were then incubated with the corresponding secondary antibodies, Alexa fluor 488-conjugated anti chicken IgG (dilution: 1:1,000) and Alexa 555 conjugated anti mouse IgG (dilution: 1:300) respectively for 1 hr at RT. The slides were mounted with 5 µL of Prolong Gold anti-fade reagent with DAPI. Cells were examined using the Axiovert 200 inverted microscope with AxioCam digital camera controlled by Axiovision program (Zeiss) or the Nikon Eclipse Ti-E fluorescent microscope and the NIS-Element AR 3.00 software. For each coverslip (three per condition, per experiment), three to five micrographs were taken to represent the entirety of the coverslip. The MAP-2 area was quantified using ImageJ software (Benoit et al., 2013). Briefly, the images were converted to grayscale, using the adjust “threshold” function under default conditions, the MAP-2 stained neurons were highlighted as regions of interest, and the area (as measured in pixels) was quantified using the “measure” function. The loss of MAP2 immunoreactivity has been demonstrated to be directly proportional to neuronal death (Brooke et al., 1999).

For colocalization of MAP-2 and GAD67 or VGLUT-1, images were analyzed using Zeiss Axiovision 4.6 software and percent of immunopositive area (% Field Area) (immunopositive area/total image area × 100) was determined. The mean % Field Area of each condition was obtained by averaging five to seven images per coverslip (three per condition).

Western Blot

Neurons plated in 12-well plates at 2.5 × 10⁵ cells per well were washed with 1 mL Hank's Balanced Salt Solution (HBSS) and lysed with 200 µL of SDS reducing sample buffer. Samples were boiled for 5 min and equal amount of volume was loaded and separated by a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose membrane (GE Healthcare), and then incubated with blocking buffer (5% powdered milk in Tris buffered saline (TBS)/Tween 0.1%) for 1 hr at RT. After washing, membranes were incubated overnight at 4 ℃ with rat anti-C5aR1 antibody (dilution: 1:1,000). After three washes, the membranes were incubated with HRP-conjugated anti-rat antibody (dilution: 1:5,000) for 1 hr at RT. The blots were developed using enhanced chemiluminescence plus (ECL+, GE Healthcare) and analyzed using the Nikon D700 digital SLR camera (Khoury et al., 2010) and ImageJ software. Equal protein loading for each lane per gel was confirmed by subsequent actin probing with mouse anti-actin antibody (dilution: 1:2,000) followed by HRP-conjugated anti-mouse antibody (dilution 1:5,000).

RNA Extraction and qRT-PCR

Total RNA from cortical neuronal cultures was extracted using the Illustra RNAspin mini isolation kit (GE Healthcare). cDNA synthesis was performed using Superscript III reverse transcriptase following manufacturer's instructions. Quantitative RT-PCR was performed using the iCycler iQ and the iQ5 software (Bio-Rad) using SYBR/Green Master Mix. Mouse C5aR1 and HPRT primers were designed using primer-blast (ncbi.nlm.nih.gov) and obtained from Eurofins (Louisville, KY): C5aR1: Forward 5′-3′: GGGATGTTGCAGCCCTTATCA; Reverse 5′-3′: CGCCAGATTCAGAAACCAGATG. HPRT: Forward 5′-3′: AGCCTAAGATGAGCGCAAGT; Reverse 5′-3′: ATCAAAAGTCTGGGGACGCA. Quantitative RT-PCR data were only accepted if detected below 40 cycles of amplification.

Statistical Analysis

All of the data are presented as mean ± SEM. Using Prism GraphPad, two-group comparisons were analyzed by the unpaired two-tailed Student's t test, and multiple-group comparisons were performed by one-way ANOVA uncorrected Fisher's LSD test as noted in Figure legends. Values of p < .05 were considered statistically significant. Each independent experiment consisted of a neuronal culture derived from its own unique litter of pups to attain biological replicates.

Mouse Primary Neurons Express C5aR1

C5aR1 has previously been observed on a subset of neurons from both human and murine samples (O'Barr et al., 2001; Woodruff et al., 2010). To investigate whether the C5aR antagonist benefit seen in our previous in vivo AD mouse models could be in part due to a direct protective effect on neurons, primary mouse neuron cultures from E15.5 cortical neurons were cultured for 7 days and qRT-PCR was performed to determine C5aR1 expression in those primary mouse cultures. Unstimulated primary neurons showed C5aR1 mRNA in wild type primary neuron cultures but not neurons derived from C5aR1KO mice (Figure 1(a)). The expression of C5aR1 was upregulated by TNF-α in a dose-dependent manner (Figure 1(b)) within 24 hr of treatment in wild type but not C5aR1KO primary neurons. Protein expression in these neuronal cultures was below the level of detection with the proven specific anti C5aR1 antibody (10/92) by immunohistochemistry and by Western blot analysis. Anti-C5aR1 antibody reactivity was confirmed in primary neonatal microglia culture lysates derived from C5aR1-sufficient pups and which was absent in microglia from C5aR1KO pups (data not shown and Ager et al., 2010).

C5a Is Toxic to Primary Neurons via C5aR1

Given that neuronal C5aR1 has been implicated in neurodegeneration and has been shown to lead to apoptosis of cultured neurons (Pavlovski et al., 2012), we tested whether purified human C5a was neurotoxic to our primary mouse cortical neurons. After 24 hr of exposure to C5a, the 10 nM and 100 nM concentrations of C5a tested were found to be damaging to neurons, as assayed by MAP-2 staining (a surrogate marker of neuronal health more sensitive than other assays, Brooke et al., 1999). The maximal concentration of 100 nM C5a led to the greatest MAP-2 loss (Figure 2(a)–(d), (f)). Pretreating the neurons with equal molar concentrations of the specific insurmountable C5aR1 antagonist, PMX53, completely prevented the MAP-2 loss induced by C5a (Figure 2(e)–(f)). To further confirm that C5a was acting through C5aR1 on neurons, primary neuron cultures were isolated from C5aR1KO mice, cultured and tested as with wild type neurons. Addition of C5a at 100 nM did not decrease MAP-2 compared with untreated C5aR1KO neurons (Figure 2(g)–(i)). OPEN IN VIEWER

C5a Enhances the Toxicity of Fibrillar Amyloid Beta

Complement components have been found to be upregulated in the AD brain, with many studies suggesting a detrimental role for complement in AD (Fonseca et al., 2009; Veerhuis, 2011). To determine whether C5a can further damage neurons treated with fAβ, 7- to 10-day primary neuronal cultures were exposed to fAβ that was verified to have beta-sheet structure by circular dichroism (Supplemental Figure S1). While 5 μM fAβ alone reduced MAP-2 by 18.5% within 24 hr (Figure 3(a)–(b)), addition of 100 nM C5a to fAβ-treated neurons further decreased MAP-2 by 20.8% relative to fAβ alone (Figure 3(d) and (k)). The additional decrease of MAP-2 observed after addition of C5a was blocked by pretreatment with PMX53 (Figure 3(e) and (k)). Neuron cultures derived from C5aR1KO mice did not show a decrease in MAP-2 relative to fAβ-treated neurons after C5a was added to the cultures (Figure 3(g)–(i), (l)). As expected, pretreatment with PMX53 did not protect C5aR1KO neurons from the fAβ-mediated toxicity (Figure 3(i), (j), and (l)). OPEN IN VIEWER

VGLUT1 and GAD67 Staining in Mouse Neuron Cultures

To characterize the neuronal populations present in the 7- to 10-day mouse cultures and determine if either neuronal population was selectively affected by treatments, staining for GABAergic (GAD67+) and glutamatergic (VGLUT1+) markers was performed. The neuronal cultures were positive for both markers (Figure 4) and when treated with Aβ or C5a, no decrease in a selective population of neurons (glutamatergic or GABAergic) was seen (Supplemental Figure S3). OPEN IN VIEWER