Autolysin N617 Deamidation as a Molecular Target of Chelerythrine in Methicillin-Resistant Staphylococcus aureus

Abstract

Objective

Methicillin-resistant Staphylococcus aureus (MRSA) is a major clinical challenge due to its resistance to multiple antibiotics. Chelerythrine, a natural benzophenanthridine alkaloid, shows antibacterial activity against MRSA, but its precise molecular target and mechanism remain unclear. This study aimed to investigate whether protein deamidation, particularly at Autolysin residue N617, mediates the antibacterial effect of chelerythrine.

Methods

Label-free quantitative proteomics was performed to identify deamidated proteins in MRSA after chelerythrine exposure. A site-directed mutant strain mimicking deamidation at autolysin residue Asn617 (Alt N617D) was constructed. Growth kinetics, autolysis assays, and muramidase enzymatic activity were assessed. Molecular docking was used to investigate the interaction between chelerythrine and autolysin.

Results

A total of 333 deamidated proteins with 774 modification sites were identified. Chelerythrine specifically enhanced deamidation at Autolysin N617. The Alt N617D mutant exhibited slower growth, reduced autolytic capacity, and decreased muramidase activity compared to the wild-type strain. Molecular docking revealed hydrogen bonding between chelerythrine and Autolysin N617. The mutant strain was more sensitive to chelerythrine treatment than the wild-type at 10 mg/L.

Conclusion

Chelerythrine exerts antibacterial effects against MRSA by promoting site-specific deamidation of Autolysin at N617, thereby impairing its function. These findings uncover a novel antibacterial mechanism and suggest that targeting protein deamidation may represent a promising strategy against resistant pathogens.

Keywords

chelerythrine protein deamidation autolysin muramidase activity proteomics

Introduction

Methicillin-resistant Staphylococcus aureus (MRSA) continues to pose a critical global health threat, contributing to substantial morbidity and mortality in both healthcare and community settings.¹ Its resistance to first-line antibiotics, including β-lactams and glycopeptides, has severely limited therapeutic options and resulted in treatment failures across diverse infection types, including septicemia, pneumonia, osteomyelitis, and particularly skin and soft tissue infections (SSTIs), which are among the most common presentations of MRSA in both hospital-acquired and community-associated settings.^2–6 Moreover, MRSA and vancomycin-resistant S. aureus (VRSA) are recognized as major causes of post-surgical infections in critical hospital departments.⁷ Despite the use of last-resort agents such as vancomycin and linezolid, emerging resistance and toxicity concerns have intensified the search for alternative antimicrobials with novel mechanisms of action.^8,9

Natural products have long served as a reservoir for bioactive molecules, and several have demonstrated efficacy against antibiotic-resistant pathogens.^10–13 Chelerythrine, a benzophenanthridine alkaloid derived from Zanthoxylum species, has exhibited promising antibacterial activity against MRSA.¹⁴ Recent proteomic profiling indicated that chelerythrine treatment induces extensive reprogramming of bacterial metabolism, particularly targeting glycolysis, the TCA cycle, and amino acid biosynthesis.¹⁴ However, its precise molecular targets and direct mode of action remain largely unexplored, limiting the development of structure-based derivatives or synergistic therapeutic strategies.

Bacteria have evolved diverse regulatory strategies to adapt to antimicrobial stress, including alterations in metabolism, membrane composition, and protein activity. For example, exposure to ciprofloxacin has been shown to trigger the secretion of proteases and pentapeptide, which may modulate survival pathways under antibiotic pressure.^15,16 In addition to these well-characterized responses, recent studies have highlighted the role of post-translational protein modifications, particularly deamidation, as an emerging regulatory mechanism. Deamidation is a non-enzymatic process in which asparagine (Asn) residues are converted to aspartic acid (Asp), historically considered a spontaneous degradation event associated with protein aging.¹⁷ However, recent studies have revealed that deamidation may play an active role in bacterial regulation, particularly under antimicrobial stress. For instance, treatment of Cronobacter sakazakii with p-coumaric acid selectively induced deamidation of elongation factor Tu, correlating with impaired growth and energy metabolism.¹⁸ Likewise, deletion of the molecular chaperone DnaK in C. sakazakii resulted in widespread protein deamidation and compromised virulence traits such as acid resistance and tissue invasion.¹⁹ These findings suggest that induced deamidation may represent a previously underappreciated layer of antimicrobial action.

Although these insights highlight the potential relevance of deamidation in bacterial response to natural compounds, it remains unclear whether deamidation occurs in response to chelerythrine in MRSA, whether it involves functionally critical proteins, and whether it contributes directly to antibacterial efficacy. In particular, the potential for small molecules to induce site-specific deamidation at catalytically important residues has not been functionally validated in clinically relevant pathogens.

To address these questions, we investigated the deamidation landscape of chelerythrine-treated MRSA and explored its impact on the enzymatic activity of key bacterial effectors involved in cell wall metabolism. This study aims to uncover whether targeted deamidation represents a novel antibacterial mechanism of chelerythrine and to provide mechanistic insights that may guide rational design of deamidation-based antimicrobial strategies.

Materials and Methods

Bacterial Strains and Growth Conditions

The methicillin-resistant Staphylococcus aureus (MRSA) strain ATCC 43300, obtained from the American Type Culture Collection (Manassas, VA, USA), was used throughout this study. Bacteria were cultured in Luria-Bertani (LB) broth (BD Difco, USA) at 37 °C with constant shaking at 200 rpm.²⁰ For antimicrobial treatment, chelerythrine chloride (≥98% purity; Sigma-Aldrich) was dissolved in dimethyl sulfoxide (DMSO) to prepare a 1000× stock solution, which was freshly diluted into LB broth to the desired final concentrations immediately before use.

Quantitative Proteomic Analysis and Deamidation Site Identification

MRSA cultures were grown to mid-log phase (OD600 ∼ 0.6), treated with 10 mg/L chelerythrine or 0.1% DMSO control for 10 min, and immediately chilled on ice. Bacterial pellets were collected by centrifugation (12 000 × g, 10 min, 4 °C), washed with PBS, and lysed using 8 M urea in 50 mM Tris-HCl (pH 8.0) with protease inhibitor cocktail (Roche), as previously described.^21,22 Total protein was quantified by BCA assay (Thermo).

Proteins (100 μg per sample) were reduced with 5 mM DTT (37 °C, 30 min), alkylated with 15 mM iodoacetamide (room temperature, dark, 30 min), and digested with sequencing-grade trypsin (Promega) at a 1:50 enzyme-to-protein ratio overnight at 37 °C.²³ Peptides were desalted using C18 SPE cartridges (Waters), vacuum-dried, and resuspended in 0.1% formic acid.

Samples were analyzed on a Q Exactive Plus Orbitrap mass spectrometer (Thermo) coupled to an EASY-nLC 1200 system (Thermo). Peptides were separated on a C18 column (75 μm × 50 cm, 2 μm particle size) with a 120-min gradient of 5%-35% acetonitrile in 0.1% formic acid. MS data were acquired in data-dependent acquisition mode. Raw files were analyzed using MaxQuant (v1.6.10.43) with deamidation (NQ) as variable modification.²⁴ False discovery rate (FDR) for peptides and proteins was set at 1%. Site localization probability >0.75 was used to define confident deamidation sites.

Construction of Autolysin Deamidation-Mimic Mutant (Alt N617D)

The atl gene encoding Autolysin was amplified from MRSA genomic DNA using Phusion High-Fidelity DNA polymerase (NEB). Site-directed mutagenesis was performed using overlapping PCR to introduce the N617D substitution. The primer sequences used are listed in Table 1. The mutant fragment was cloned into the shuttle plasmid pKOR1 using T4 DNA ligase (NEB).²⁵ The construct was electroporated into RN4220 and then transduced into MRSA ATCC 43300 via phage-mediated transduction.²⁶ Allelic exchange was performed via temperature-sensitive selection and confirmed by colony PCR and Sanger sequencing.²⁷

Table 1.

Primers Used in This Study.

Primer name	Sequence (5′-3’)	Purpose
atl-F	GAGAGGTAATATATTTCTTGAG	Amplification of atl
atl-R	ATCACCGCTATTTTTGCTTGTGTATG	Amplification of atl
N617D-F	GTTTCATCATTAGACGGTGTTGCT	N617D mutation (forward)
N617D-R	AGCAACACCGTCTAATGATGAAAC	N617D mutation (reverse)
Check-F	CCTGGTACGAAACTTTATAC	Colony PCR (forward)
Check-R	GCTTCTTGTTTATAAGTGCC	Colony PCR (reverse)

Growth Curve Assays

Wild-type and Alt N617D strains were grown overnight, diluted 1:100 into fresh LB medium, and incubated at 37 °C with shaking, adapted from previously published protocols with minor modifications.²⁰ OD600 was measured every hour for 12 h using a BioTek Synergy HTX plate reader. For chelerythrine sensitivity assays, 10 mg/L chelerythrine or vehicle control was added at inoculation.

Autolysis Assays

Autolysis assays were performed as previously described with minor modifications.^28,29 Cells from mid-log phase cultures were harvested (OD600 ∼ 1.0), washed twice with cold PBS, and resuspended in autolysis buffer (50 mM Tris-HCl, pH 7.5, 0.05% Triton X-100) to OD600 = 1.0. Samples were incubated at 37 °C, and OD600 was measured every 15 min for 2 h. Results were expressed as percentage reduction in OD600 compared to time zero.

Cell-Free Protein Expression and Purification

Wild-type and N617D Autolysin proteins were expressed using the In Vitro Protein Synthesis Kit (NEB) according to the manufacturer's protocol.³⁰ Coding sequences were cloned into pET-28a(+) with a C-terminal His6-tag. Proteins were purified by Ni-NTA affinity chromatography (Qiagen) and analyzed by SDS-PAGE. Concentrations were determined using the BCA assay.

Muramidase Activity Assay and HPLC Analysis

Muramidase activity was evaluated using Micrococcus lysodeikticus cell wall suspension (Sigma-Aldrich).³¹ Purified proteins (2 μg) were incubated with 0.25 mg/mL substrate in 50 mM sodium phosphate buffer (pH 7.0, 100 μL) at 37 °C for 1 h. Reactions were terminated with 5% trichloroacetic acid. The supernatant was analyzed by HPLC using an Agilent 1260 system with a C18 column and a gradient of acetonitrile/water (0.1% TFA). Peak areas of degradation products were quantified at 210 nm.

Molecular Docking

The 3D structure of S. aureus Autolysin was predicted using AlphaFold2.³² Chelerythrine's structure (PubChem CID: 72304) was optimized using Chem3D with MMFF94 force field. Molecular docking was conducted using AutoDock Vina (v1.1.2). The docking grid was centered around residue N617 with a 22.5 Å cubic box. Ligand-receptor interactions were visualized using PyMOL and LigPlot+.

Statistical Analysis

All experiments were performed in at least three independent biological replicates. Data are presented as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 8.3.0.³³ Comparisons between two groups were assessed using unpaired two-tailed Student's t-tests. P-values < .05 were considered statistically significant.

Results

Chelerythrine Induces Extensive Protein Deamidation and Selectively Targets Autolysin N617

To determine whether chelerythrine alters the protein modification landscape of MRSA, label-free quantitative proteomics with deamidation-specific search parameters was performed. In total, 75 proteins were identified to harbor deamidation modifications, with 104 distinct deamidation sites detected across biological replicates (Figure 1A, Table S1). The molecular weights of the deamidated proteins ranged from approximately 12 kDa to 110 kDa, with a mean molecular weight of 43.6 kDa. Notably, chelerythrine treatment significantly increased the frequency of deamidation at specific residues, with the most prominent change observed at Asn617 (N617) of the major cell wall hydrolase Autolysin (Q2FZK7, Atl) (Figure 1B). This site exhibited a substantial increase in modification levels, suggesting a site-selective effect of the compound. To further investigate the interaction between chelerythrine and Atl, molecular docking was performed using an AlphaFold2-predicted model of Q2FZK7. The docking results revealed a binding energy of −8.8 kcal/mol, indicating a favorable interaction. Chelerythrine was predicted to form hydrogen bonds with residues GLN-733 and LYS-731, with bond lengths of 2.8 Å and 2.3 Å, respectively (Figure 1C). These interactions imply a structural association between Chelerythrine binding and increased deamidation at N617, although further investigation is needed to determine causality.

Figure 1.

Proteomic Identification and Structural Prediction of Chelerythrine-Induced Protein Deamidation in MRSA. (A) Bar Plot Illustrating the Top 15 MRSA Proteins with the Highest Number of Deamidation Sites Identified by Label-Free Quantitative Proteomics Following Chelerythrine Exposure. The x-Axis Shows UniProt IDs, and the y-Axis Indicates the Number of Unique Deamidation Sites. (B) Relative Deamidation Intensity at Residue Asn617 of the Autolysin Protein (Atl, UniProt ID: Q2FZK7) in MRSA Cells Treated with 10 mg/L Chelerythrine or Left Untreated. (C) Molecular Docking Model of Chelerythrine with the AlphaFold2-Predicted Structure of Atl (Q2FZK7), Showing the Binding Conformation and Key Interacting Residues.

Deamidation-Mimic Mutation at N617 Impairs MRSA Growth and Autolysis

To assess the functional relevance of Autolysin deamidation at N617, we constructed a deamidation-mimic mutant strain (Alt N617D) by replacing Asn617 with Asp through site-directed mutagenesis. Under standard LB culture conditions, the Alt N617D strain exhibited significantly attenuated growth compared to the wild-type (WT) strain (Figure 2A). The lag phase was prolonged, and the exponential growth rate was reduced, indicating a growth disadvantage conferred by the mutation. We next evaluated the autolytic activity of the mutant. In a Triton X-100–induced autolysis assay, the Alt N617D mutant demonstrated a markedly slower OD₆₀₀ decline relative to the WT strain (Figure 2B), suggesting reduced self-degradation capacity. These findings support the conclusion that N617 deamidation compromises Atl function and perturbs normal cell wall remodeling.

Figure 2.

Phenotypic Characterization of the Alt N617D Deamidation-mimic Mutant in MRSA. (A) Growth Curves of Wild-type (WT) and Alt N617D S. aureus Strains Cultured in LB Medium at 37 °C. Bacterial Viability was Monitored at the Indicated Time Points by Colony-forming Unit (CFU) Enumeration. (B) Autolysis Kinetics of WT and Alt N617D Strains in PBS Containing 0.05% Triton X-100, with OD₆₀₀ Measured Over 30 min. Each Assay was Performed with Three Independent Biological Replicates.

N617 Deamidation Reduces Muramidase Activity In Vitro

To evaluate whether deamidation at Asn617 compromises the enzymatic activity of Autolysin, both wild-type (WT) and deamidation-mimic (Alt N617D) proteins were expressed using a cell-free transcription-translation system and purified by Ni-NTA affinity chromatography. Muramidase activity was assessed by incubating equal amounts of purified enzyme with heat-killed Micrococcus lysodeikticus cell wall suspension, a standard substrate for detecting peptidoglycan hydrolase activity. WT Autolysin induced a rapid and sustained decline in OD450 over a 60-min incubation period, consistent with robust cell wall lysis. In contrast, the Alt N617D variant showed a significantly attenuated decline in OD450, with an overall reduction of only ∼36% relative to baseline, compared to ∼68% for the WT enzyme (Figure 3A). These results indicate a marked loss of muramidase-dependent cell wall solubilization in the mutant protein. Reaction supernatants were subjected to HPLC to quantify soluble peptidoglycan fragments released during enzymatic digestion. The WT enzyme yielded distinct product peaks corresponding to small-molecule cleavage products, whereas the Alt N617D variant produced markedly lower signal intensity across these peaks. Quantification of total peak area revealed a significant reduction in hydrolytic product accumulation in the Alt N617D sample compared to the WT (Figure 3B). Together, these data confirm that deamidation at N617—mimicked here by asparagine-to-aspartate substitution—significantly impairs the muramidase activity of autolysin.

Figure 3.

Comparative Enzymatic Analysis of Wild-Type and N617D-Mutant Autolysin Proteins. (A) Turbidity Reduction Assay Evaluating Muramidase Activity of Purified WT and Alt N617D Autolysin Proteins Incubated with Heat-Killed Micrococcus Lysodeikticus Cell Wall Suspension. OD₄₅₀ was Recorded Over 60 min. (B) HPLC-Based Quantification of Peptidoglycan Hydrolysis Products in Enzyme Reaction Supernatants, Including N-Acetylmuramic Acid (MurNAc), N-Acetylglucosamine (GlcNAc), and the MurNAc–GlcNAc Disaccharide. All Measurements Were Obtained from Three Independent Biological Experiments.

Alt N617D Mutant is More Susceptible to Chelerythrine

To investigate whether chelerythrine exerts enhanced antibacterial effects on cells mimicking a pre-deamidated state, we compared the drug susceptibility of wild-type (WT) and Alt N617D mutant strains under sub-inhibitory chelerythrine treatment. Cultures were exposed to 10 mg/L chelerythrine (1/2 MIC), and bacterial growth was assessed by both optical density (OD600) and colony-forming unit (CFU) enumeration over time. In the presence of chelerythrine, the Alt N617D mutant exhibited significantly greater growth inhibition than the WT strain (Figure 4). These data indicate increased susceptibility of the Alt N617D strain to chelerythrine under the tested conditions. Further analysis is needed to clarify the mechanistic basis of this observation.

Figure 4.

Evaluation of Chelerythrine Susceptibility in Wild-type and Alt N617D MRSA Strains. WT and Alt N617D S. aureus Strains were Cultured in the Presence of 10 mg/L Chelerythrine (1/2 MIC), and CFU Counts were Determined at the Indicated Time Points to Assess Bacterial Viability. Data are Presented as Mean ± SD from Three Independent Biological Replicates. Asterisks Indicate Statistically Significant Differences between Groups.

Discussion

Our findings highlight a previously unrecognized antimicrobial strategy: post-translational deamidation of a key bacterial enzyme as a mechanism to compromise MRSA viability. Protein deamidation (conversion of asparagine to aspartate/isoaspartate) is generally considered a spontaneous aging process rather than a targeted antimicrobial action.¹⁷ Only recently was this paradigm challenged by Lu et al (2022), who showed that a natural compound (p-coumaric acid) can promote site-specific L-asparagine deamidation in Cronobacter elongation factor Tu, correlating with bacterial growth inhibition.¹⁸ That study was the first to demonstrate an exogenous “bacteriostatic” molecule actively inducing protein deamidation in bacteria, establishing proof-of-concept that deamidation can be exploited as an antibacterial strategy. Our work builds on this emerging concept by identifying autolysin Atl of MRSA as a new deamidation target of the alkaloid chelerythrine. Moreover, a recent investigation by Lu et al (2023) linked protein deamidation to bacterial fitness and virulence, showing that deletion of the chaperone DnaK in Cronobacter elevates cellular deamidation levels and attenuates multiple virulence factors.¹⁹ This suggests that bacteria actively rely on chaperones to suppress detrimental deamidation, and disrupting this balance can impair pathogenicity. In this context, our discovery that chelerythrine drives a harmful deamidation on a critical MRSA enzyme (Atl Asn617) underscores the novelty and significance of deamidation as an antimicrobial mechanism in combating antibiotic-resistant infections.

Our results also offer a new perspective on chelerythrine's mode of action, complementing recent proteomic studies. Previous proteome-wide analyses of MRSA exposed to chelerythrine found broad metabolic perturbations. For example, Liao et al (2025) reported that chelerythrine caused widespread downregulation of enzymes in glycolysis, the TCA cycle, and arginine catabolism, suggesting a collapse of energy production as the primary cause of growth inhibition.¹⁴ They noted that, unlike classic antibiotics which target cell wall synthesis or DNA/RNA processes, chelerythrine's bactericidal effect appeared to stem mainly from metabolic disruption rather than direct damage to the cell envelope.¹⁴ In contrast, our targeted analysis reveals that chelerythrine also directly undermines cell wall maintenance by inactivating autolysin via deamidation. This finding aligns with observations in other bacteria – for instance, chelerythrine (as chelerythrine chloride) was shown to disrupt cell wall integrity and membrane function in Streptococcus agalactiae, causing cell shrinkage, leakage of intracellular contents, and oxidative stress.³⁴ Such evidence of cell envelope damage helps reconcile the apparent discrepancy between a primarily metabolic mode of action and our identification of a specific cell wall enzyme target. It appears that chelerythrine is a multi-faceted agent: it induces a metabolic shutdown on a global scale and triggers a precise post-translational modification that cripples a cell-wall hydrolase. By integrating these insights, we propose that the metabolic stress reported by Liao et al may synergize with the autolysin dysfunction uncovered here – energy depletion could hinder repair of cell wall defects, while autolysin inactivation exacerbates structural abnormalities – jointly sensitizing MRSA cells to collapse. Our study therefore expands the understanding of chelerythrine's mechanism, indicating that beyond metabolic perturbations, site-specific autolysin deamidation is a critical new facet of its antimicrobial activity. However, whether N617 deamidation influences susceptibility to other antibiotics beyond chelerythrine remains to be explored in follow-up studies

Mechanistically, the deamidation of Autolysin at Asn617 provides a direct explanation for how chelerythrine impairs MRSA cell wall homeostasis. Atl is the major autolysin in S. aureus, a bifunctional enzyme (amidase and glucosaminidase) responsible for cleaving peptidoglycan to allow daughter cell separation and cell wall remodeling.^35–37 Loss or inactivation of Atl is known to produce chained or clumped cells that fail to separate, as seen in atl knock-out mutants which form large cell clusters and show abnormal division morphology.³⁸ In our study, chelerythrine-treated MRSA exhibited hallmarks of autolysin dysfunction, including reduced autolytic activity in detergent-induced lysis assays and accumulation of cell wall material, consistent with an inability to properly hydrolyze peptidoglycan. By using mutagenesis, we confirmed that substituting Asn617 (the identified hot-spot) with a deamidation-mimicking residue abrogates Atl's enzymatic activity, mirroring the effect of the drug. This pinpoint modification likely perturbs the enzyme's active site or structural stability – a single Asn→Asp change can introduce local backbone rearrangements (especially if an isoaspartate forms), which for a enzyme like Atl could be catastrophic for substrate binding or catalysis. Additionally, autolysin inactivity could trap cell surface proteins (as Atl also facilitates release of certain surface factors³⁹), potentially reducing virulence. Thus, the site-specific deamidation of Atl essentially “disarms” a vital enzymatic function required for cell wall turnover and normal cell cycle progression in MRSA. Our enzymatic assays and bacteriolysis measurements collectively support that this molecular lesion is sufficient to diminish MRSA viability, underscoring how a targeted post-translational modification can translate into a profound antimicrobial effect.

More broadly, our work underscores how attacking bacterial stress defenses can tip the balance in favor of eradication, especially against antibiotic-resistant strains. Bacterial pathogens employ diverse mechanisms to withstand antibiotic stress, including robust stress-response networks and protein quality control systems that repair or mitigate drug-induced damage.^40–42 Molecular chaperones like DnaK, for example, play a crucial role in helping bacteria survive under antibiotic assault: they refold misfolded proteins, alleviate antibiotic-triggered oxidative stress, and maintain cell envelope integrity, thereby contributing to tolerance.^43,44 Correspondingly, a dnaK-deficient strain of Riemerella anatipestifer was shown to be far more sensitive to multiple antibiotics than the wild-type, highlighting how disrupting chaperone function weakens bacterial defenses.⁴³ Likewise, combining agents that inflict metabolic or proteotoxic stress with those that damage the cell envelope has proven highly effective, achieving synergistic lethality against multidrug-resistant bacteria.¹⁴ In this light, chelerythrine's multi-pronged action—simultaneously collapsing MRSA's energy metabolism and disabling its cell-wall hydrolase—exemplifies an approach that overwhelms the pathogen's adaptive capacity. These insights illustrate a broader principle: by sabotaging the stress-response circuits and maintenance mechanisms that bacteria rely on to endure antibiotics, we can markedly enhance the efficacy of antimicrobial interventions.

Nevertheless, certain limitations should be considered. This study was conducted under in vitro conditions, and the physiological relevance of Autolysin N617 deamidation during infection remains to be validated in vivo. Moreover, the N617D mutant provides a useful functional mimic but does not fully capture the structural heterogeneity of spontaneous or drug-induced deamidation. Finally, although proteomic profiling revealed widespread deamidation, we focused primarily on Autolysin, and the contribution of other modified proteins to chelerythrine's antibacterial activity warrants further investigation.

Overall, our study identifies a novel antimicrobial mechanism—targeted deamidation of Autolysin—and provides a framework for exploiting post-translational protein damage in combating resistant bacterial pathogens. These findings open new directions for antimicrobial design. Targeting bacteria through induced post-translational modification—rather than classical enzyme inhibition—could evade existing resistance pathways. Chelerythrine may also serve as a potentiator for combination therapy, as earlier studies showed it enhances antibiotic sensitivity in MRSA. Atl and its N617 residue thus represent promising molecular targets for developing deamidation-inducing compounds with better pharmacokinetics or reduced toxicity.

Conclusion

Our study reveals that chelerythrine inhibits MRSA by inducing site-specific deamidation of Autolysin at Asn617, impairing its enzymatic function and disrupting cell wall homeostasis. These findings establish deamidation as a novel antibacterial mechanism and highlight its potential as a therapeutic target in combating antibiotic-resistant pathogens.

Limitations

This study was limited to in vitro analyses. The in vivo efficacy and safety of chelerythrine remain to be evaluated, especially considering its known cytotoxicity. Structural validation of its binding to Atl is still required, and the potential roles of other autolysins and compensatory pathways should be further explored.

Supplemental Material

sj-xlsx-1-npx-10.1177_1934578X251383041 - Supplemental material for Autolysin N617 Deamidation as a Molecular Target of Chelerythrine in Methicillin-Resistant Staphylococcus aureus

Supplemental material, sj-xlsx-1-npx-10.1177_1934578X251383041 for Autolysin N617 Deamidation as a Molecular Target of Chelerythrine in Methicillin-Resistant Staphylococcus aureus by Jianhua Liao, Chunyan Meng, Baoqing Liu, Yuechun Wang and Jun Cheng in Natural Product Communications

Footnotes

Acknowledgment

We would like to express our gratitude to the anonymous peer reviewers for their constructive feedback and suggestions, which significantly improved the quality of this work.

ORCID iDs

Yuechun Wang

Jun Cheng

Ethics Approval

No human or animal subjects were involved in this study.

Statement of Informed Consent

There are no human subjects in this article and informed consent is not applicable.

Author Contributions (CRediT):

J.L.: methodology, formal analysis, investigation, writing – original draft. C.M.: methodology, investigation, writing – original draft. B.L.: methodology, data curation, writing – review & editing. Y.W.: investigation, data curation, visualization. J.C.: conceptualization, supervision, project administration, writing – review & editing.

Funding

The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was partly supported by a grant from the Zhejiang Traditional Chinese Medicine Administration (2023ZL221).

Declaration of Conflicting Interests

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Data Availability Statement

All datasets generated for this study are included in the manuscript and/or the Supplementary Files. All of the MS proteomics data have been deposited to iProX () and can be accessed with the accession IPX0010506000.^45,46

Use of AI Tools Declaration

The authors declare they have not used Artificial Intelligence (AI) tools in the creation of this article.

Statement of Human and Animal Rights

This research did not involve human participants, human tissue, or any procedures requiring human subjects. Additionally, animal experiments were not conducted in this study.

Supplemental Material

Supplemental material for this article is available online.

References

Pal

Reubma

Regessa

Zende

. Methicillin-Resistant Staphylococcus Aureus (Mrsa) remains a major threat to public health. Am J Public Health Res. 2024;12(3):48-53.

Vena

Castaldo

Magnasco

, et al.

Current and emerging drug treatment strategies to tackle invasive community-associated methicillin-resistant Staphylococcus aureus (MRSA) infection: what are the challenges?

Expert Opin Pharmacother. 2023;24(3):331-346.

Zhang

Shen

Xie

Liu

. Septicaemia with deep venous thrombosis and necrotising pneumonia caused by acute community-acquired methicillin-resistant Staphylococcus aureus in an infant with a three-year follow-up: a case report. BMC Infect Dis. 2022;22(1):189.

Mahjabeen

Saha

Mostafa

, et al. An update on treatment options for methicillin-resistant Staphylococcus aureus (MRSA) bacteremia: a systematic review. Cureus. 2022;14(11):e31486.

Peng

K-T

Chen

P-C

Chen

J-L

, et al. A comparative phenotypic and genomic analysis of methicillin-resistant Staphylococcus aureus ST45 isolates from cellulitis and osteomyelitis in Taiwan. J Infect Dis. 2024;230(3):e568-e578.

Gouleu

Daouda

Oye Bingono

, et al. Temporal trends of skin and soft tissue infections caused by methicillin-resistant Staphylococcus aureus in Gabon. Antimicrob Resist Infect Control. 2024;13(1):68.

Rahimkhani

Rajabi

. MRSA And VRSA isolated from patients hospitalized in the ICU, NICU and surgical departments of hospitals. Proceedings of the National Academy of Sciences, India Section B: Biological Sciences. 2024;94(3):653-657.

C-S-Z

Han

M-F

Gao

Dong

H-L

Z-L

. Vancomycin and linezolid: severe cutaneous adverse reactions to drugs. Expert Opin Drug Saf. 2024;(1):1-8.

Al-Zehhawi

PAM

Jaddoa

NTM

. Linezolid versus vancomycin in vitro activity against methicillin-resistant Staphylococcus aureus biofilms. Microb Pathog. 2025;201(1):107371.

10.

Guedes

Krambeck

Durazzo

, et al. Natural antibiotics against antimicrobial resistance: sources and bioinspired delivery systems. Braz J Microbiol. 2024;55(3):2753-2766.

11.

Wang

Kang

. Antibacterial mechanism of chelerythrine isolated from root of Toddalia asiatica (Linn) Lam. BMC Complement Altern Med. 2018;18(1):261.

12.

Zhao

Xia

Gao

Kang

Wei

. Advances in the detection of virulence genes of Staphylococcus aureus originate from food. Food Science and Human Wellness. 2020;9(1):40-44.

13.

Zheng

J-Q

Yan

Jiang

H-J

Yin

T-P

. Carbon dots derived from corn silk and their antimicrobial properties. Food & Medicine Homology. 2026;3(1):9420094.

14.

Liao

Meng

Shao

Wang

. Proteomic insights into the antimicrobial mechanism of chelerythrine against methicillin-resistant Staphylococcus aureus. Nat Prod Commun. 2025;20(3):1934578X251330198.

15.

Dörries

Schlueter

Lalk

. Impact of antibiotics with various target sites on the metabolome of Staphylococcus aureus. Antimicrob Agents Chemother. 2014;58(12):7151-7163.

16.

Ołdak

Trafny

. Secretion of proteases by Pseudomonas aeruginosa biofilms exposed to ciprofloxacin. Antimicrob Agents Chemother. 2005;49(8):3281-3288.

17.

Taraj

. Review on characterization of deamidation in therapeutic proteins by mass spectrometric methods. Technium BioChemMed. 2025;13(1):13-26.

18.

Xue

Dong

Chen

. Proteomic analysis revealed metabolic inhibition and elongation factor Tu deamidation by p-coumaric acid in Cronobacter sakazakii. Front Microbiol. 2022;13(1):888103.

19.

Xue

Chen

. DnaK-mediated protein deamidation: a potential mechanism for virulence and stress adaptation in Cronobacter sakazakii. Appl Environ Microbiol. 2023;89(7):e0050523.

20.

Fujikawa

Morozumi

. Modeling Staphylococcus aureus growth and enterotoxin production in milk. Food Microbiol. 2006;23(3):260-267.

21.

Xue

Shi

. Opposing regulation of Gig2 by RecA and GlrK controls redox-linked desiccation tolerance in Cronobacter sakazakii. Food Microbiol. 2025;132(1):104860.

22.

Xue

Shi

. Hydrophilic guardians: putative core proteins unaltered by 22 gene deletions mediate desiccation resistance in Cronobacter sakazakii. Food Microbiol. 2025;131(1):104814.

23.

Reis

APC

Celestrino

Souza Siqueira

, et al. Optimized protein extraction protocol from human skin samples. Biology Methods and Protocols. 2025;10(1):bpaf035.

24.

Tyanova

Temu

Cox

. The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat Protoc. 2016;11(12):2301-2319.

25.

Bae

Schneewind

. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid. 2006;55(1):58-63.

26.

Mašlaňová

Stříbná

Doškař

Pantůček

. Efficient plasmid transduction to Staphylococcus aureus strains insensitive to the lytic action of transducing phage. FEMS Microbiol Lett. 2016;363(19):fnw211.

27.

Bae

Liu

, et al. Contribution of staphylococcal enterotoxin B to Staphylococcus aureus systemic infection. J Infect Dis. 2021;223(10):1766-1775.

28.

Zeng

Wang

Zhu

, et al. Sub-inhibitory concentrations of fosfomycin enhance Staphylococcus aureus biofilm formation by a sarA-dependent mechanism. Microbiol Spectr. 2025;13(1):e01521-e01525.

29.

Jiang

Wang

Bai

, et al. Genomic and phenotypic adaptations of methicillin resistant Staphylococcus aureus during vancomycin therapy. Sci Rep. 2025;15(1):15346.

30.

Buss

Lund

Chen

Deng

Magnelli

. Automated cell-free protein expression and purification for high-throughput screening using NEBExpress® cell-free E. coli protein synthesis system and NEBExpress Ni-NTA magnetic beads. Gene. 2024;5(1):3.

31.

Salton

MRJ

. Cell wall of Micrococcus lysodeikticus as the substrate of lysozyme. Nature. 1952;170(4331):746-747.

32.

Park

Myung

Baek

. Advancing protein structure prediction beyond AlphaFold2. Curr Opin Struct Biol. 2025;90(1):102985.

33.

Swift

. Graphpad prism, data analysis, and scientific graphing. J Chem Inf Comput Sci. 1997;37(2):411-412.

34.

Xin

Wang

, et al. Antibacterial activity and mechanism of chelerythrine against Streptococcus agalactiae. Front Vet Sci. 2024;11(1):1408376.

35.

Wang

Buist

van Dijl

. Staphylococcus aureus cell wall maintenance–the multifaceted roles of peptidoglycan hydrolases in bacterial growth, fitness, and virulence. FEMS Microbiol Rev. 2022;46(5):fuac025.

36.

Bose

Lehman

Fey

Bayles

. Contribution of the Staphylococcus aureus Atl AM and GL murein hydrolase activities in cell division, autolysis, and biofilm formation. 2012.

37.

Götz

Heilmann

Stehle

. Functional and structural analysis of the major amidase (Atl) in Staphylococcus. Int J Med Microbiol. 2014;304(2):156-163.

38.

Zhang

Zhong

, et al. A novel autolysin AtlASS mediates bacterial cell separation during cell division and contributes to full virulence in Streptococcus suis. Vet Microbiol. 2019;234(1):92-100.

39.

Leonard

Goncheva

Gilbert

, et al. Autolysin-mediated peptidoglycan hydrolysis is required for the surface display of Staphylococcus aureus cell wall-anchored proteins. Proc Natl Acad Sci USA. 2023;120(12):e2301414120.

40.

Harms

Maisonneuve

Gerdes

. Mechanisms of bacterial persistence during stress and antibiotic exposure. Science. 2016;354(6318):aaf4268.

41.

Dawan

Ahn

. Bacterial stress responses as potential targets in overcoming antibiotic resistance. Microorganisms. 2022;10(7):1385.

42.

Lee

Hinz

Bauerle

, et al. Targeting a bacterial stress response to enhance antibiotic action. Proc Natl Acad Sci USA. 2009;106(34):14570-14575.

43.

Guo

Shi

Huang

, et al. Functional characterization of the chaperone DnaK of Riemerella anatipestifer in antibiotic resistance and pathogenicity. Poult Sci. 2025;104(9):105362.

44.

Fay

Philip

Saha

Hendrickson

Glickman

Burns-Huang

. The DnaK chaperone system buffers the fitness cost of antibiotic resistance mutations in mycobacteria. MBio. 2021;12(2):10-1128.

45.

Chen

, et al. Iprox: an integrated proteome resource. Nucleic Acids Res. 2019;47(D1):D1211-D1217.

46.

Chen

Liu

, et al. Iprox in 2021: connecting proteomics data sharing with big data. Nucleic Acids Res. 2022;50(D1):D1522-D1527.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.01 MB