Expression of Versican and ADAMTS1,4,and 5 During Bone Development in the Rat Mandible and Hind Limb

Abstract

Extracellular matrix (ECM) remodeling is achieved by both production and degradation of ECM molecules during bone development. ADAMTS (a disintegrin and metalloprotease with thrombospondin type 1 motifs) constitutes a family of extracellular proteases which are implicated in cleaving the protein versican. The present study was designed to investigate the expression of versican and ADAMTS1, 4, and 5 mRNA during bone development in rat mandibles and hind limbs by RT-PCR and in situ hybridization. Versican was localized by immunohistochemistry. The process of bone development from day 14 postcoitum through week 6 postnatum was divided into the beginning of osteogenesis, woven bone, and lamellar bone stages. Versican protein was abundant in the woven bone matrix, but decreased in the lamellar bone matrix. Versican mRNA was prominent in some osteoblasts with corresponding localization of the cognate protein. The temporal and spatial mRNA expression pattern of ADAMTS1, 4, and 5 was comparable to that of versican. These results suggest that woven bone rich in versican alters into lamellar bone containing little versican during bone development in both mandibles and hind limbs, where some osteoblasts may be involved in production as well as degradation of versican by secreting ADAMTS1, 4, and 5.

Keywords

versican ADAMTS bone development osteoblast extracellular matrix remodeling in situ hybridization immunohistochemistry RT-PCR

Bone development is a dynamic biological process involving extensive remodeling of extracellular matrix (ECM), which eventually supports growth of the body. The ECM remodeling is achieved by both production and degradation of ECM molecules, and a large number of proteolytic enzymes are implicated in bone and cartilage development (Werb and Chin 1998; Sasano et al. 2002; Ortega et al. 2003).

ADAMTS (a disintegrin and metalloprotease with thrombospondin type 1 motifs) is a family of extracellular proteases. It has a characteristic ADAM-like protease domain, a disintegrin-like and a cysteine-rich domain, and possess some thrombospondin type 1 motifs. To date, 20 members of the ADAMTS family have been identified. Unlike the ADAMs, these proteins lack transmembrane domains and are, therefore, secreted into the extracellular environment (Tang 2000). Although a distinct proteolytic activity has been demonstrated for several members of ADAMTS (Apte 2004), little information is available about involvement of ADAMTS in bone remodeling and development.

ADAMTS4 (aggrecanase-1) and ADAMTS5/11 (aggrecanase-2) are the proteases responsible for cleaving aggrecan, a major proteoglycan in the ECM of cartilage (Abbaszade et al. 1999; Tortorella et al. 1999). ADAMTS1 is also capable of cleaving aggrecan (Kuno et al. 2000). ADAMTS4 also cleaves brevican, which is a brain-specific ECM proteoglycan (Matthews et al. 2000). Furthermore, it has been suggested that ADAMTS1, 4, and 5 also have the ability to degrade versican, which is a member of the lectican family that includes aggrecan, neurocan, and brevican. Versican is a large chondroitin sulfate proteoglycan. Its N-terminal globular domain (G1) binds to the glycosaminoglycan hyaluronan, and its carboxy-terminal globular domain (G3) consists of two epidermal growth factor-like domains, a lectin-like domain, and a complement regulatory protein-like domain. Four splice variants (V0-V3) of versican are known (Wight 2002). Recent studies showed cleavage of versican V0 and V1 by ADAMTS1 and ADAMTS4 (Sandy et al. 2001; Russell et al. 2003), and cleavage of versican V2 by ADAMTS4 (Westling et al. 2004).

Aggrecan is most abundant in cartilage, whereas versican has a rather wide tissue distribution (Zako et al. 1995). It has been suggested that a large proteoglycan presumed to be versican is present in the bone matrix during early bone formation (Lee et al. 1998). However, the profile of expression and degradation of this proteoglycan during bone development remains unknown. We hypothesized that versican is expressed in bone and its putative degrading enzymes ADAMTS1, 4, and 5 are also expressed and involved in versican remodeling during bone development. To test our hypothesis, we investigated the expression of versican mRNA and ADAMTS1, 4, and 5 mRNAs in rat mandibles and hind limbs at various stages of bone development and growth, by RT-PCR and in situ hybridization. Immunohistochemistry was used to detect versican polypeptides.

Materials and Methods

Preparation of Tissue

The principles of laboratory animal care (NIH publication no. 86–23, revised 1985) were followed, as were specific national laws. The preparation was performed according to animal protocols that were institutionally approved by Tohoku University. Wistar rat embryos 14–20 days postcoitum (E14–E20) and male Wistar rats 1, 3, and 6 weeks postnatum (W1, W3, and W6) were used. At least three embryos or postnatal animals at each stage were examined. Heads and hind limbs were resected from embryos and immediately fixed by immersion in a mixture of 4% paraformaldehyde and 0.5% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4, at 4C overnight. The postnatal rats were anesthetized with 50 mg/ml sodium pentobarbital (0.1 ml/100 g of body weight) and perfused through the aorta with a mixture of 4% paraformaldehyde and 0.5% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4. Mandibles were resected and kept in the same fixative overnight at 4C. The fixed specimens were decalcified in 10% EDTA in 0.01 M phosphate buffer, pH 7.4, for 1–6 weeks at 4C. The EDTA solution was autoclaved before use. After dehydration through a graded series of ethanol solutions, the tissues were embedded in paraffin. Serial sections 5 μm thick were cut and the adjacent sections were stained with hematoxylin-eosin or processed for in situ hybridization or immunohistochemistry.

RT-PCR

The total RNA was extracted from embryonic rat mandibles and hind limbs using the RNeasy Mini Kit (Qiagen; Hilden, Germany) and processed as follows. cDNA was synthesized using 1.0 μg of total RNA primed with 1.5 μg of random primers (Invitrogen; Carlsbad, CA) in the presence of reverse transcriptase at 100 U/μg RNA, in the reverse transcription buffer supplied by Invitrogen. For cDNA amplification, 1.0 μl of reverse transcription products was incubated in the presence of 20 pmol of two specific primers (Table 1), 1.5 mM MgCl₂, 0.2 mM of the four dNTPs (Invitrogen), and 0.05 U of Taq polymerase, in the manufacturer's reaction buffer (Invitrogen). The reaction mixture was subjected to one cycle of denaturation for 3 min, 50 sec at 95C, followed by 50 cycles of an amplification sequence that consisted of denaturation for 1 min, 10 sec at 95C, annealing for 1 min, 10 sec at 64C for ADAMTS4 and versican, 62C for ADAMTS1, and 58C for ADAMTS5, and extension for 1 min, 30 sec, with an additional 8 min, 30 sec extension for the last cycle.

After amplification, equal amounts of PCR products were size-separated by electrophoresis through a 3.0% agarose gel and visualized by ethidium bromide staining and ultraviolet transillumination. All samples were amplified at least twice on different occasions to control for any variations in the PCR technique. Images of the stained gels were captured using the Electrophoresis Documentation and Analysis System (Kodak; Rochester, NY).

Preparation of Riboprobes

Digoxigenin-labeled, single-stranded riboprobes were prepared using the DIG RNA-labeling kit (Roche; Mannheim, Germany) according to the manufacturer's instructions.

Fragments encoding rat versican (423–1039 bp: Gen-Bank AF072892), rat ADAMTS1 (76–520 bp: GenBank NM024400), rat ADAMTS4 (625–1226 bp: GenBank XM237904), and rat ADAMTS5 (1548–2305 bp: GenBank NM198761) were obtained from the total RNA of embryonic rat limbs using RT-PCR and subcloned into the plasmid pCRIITOPO (Invitrogen). Oligonucleotide primers used for the RT-PCR are shown in Table 1. The identities of the cDNAs were verified by digestion with restriction enzymes and confirmed by dideoxynucleotide sequencing. Riboprobes were generated as indicated in Table 2. An 818-bp fragment (223–1040 bp: GenBank AF062402) encoding rat versican was obtained from total RNA of rat brain, and a fragment encording rat pro-α 1 (I) collagen (2838–4329 bp: GenBank Z78279) was obtained from the total RNA of rat skin using RT-PCR, and both were subcloned into the pT7T3-a18 plasmid (Life Technologies; Grand Island, NY). The plasmid was linearized and transcribed by RNA polymerases to generate riboprobes as indicated in Table 2.

Table 1

Oligonucleotide primers

Rat versican (617 bp)
Upper primer	5’ CCTTGCCCACCTTACCACC 3'
Lower primer	5’ GAACACATCGCCGTCCAGA 3'
Rat versican (818 bp)
Upper primer	5’ ACACAGGGAGAAACCCAGGA 3'
Lower primer	5’ TGTCTTGTTTTCTCTGACCT 3'
Rat ADAMTS1
Upper primer	5’ GGCGGAGGACGAAGAGT 3'
Lower primer	5’ GGAAGCGAGGAGTAGCAAC 3'
Rat ADAMTS4
Upper primer	5’ CTACAACCACCGAACCGAC 3'
Lower primer	5’ TGCCAGCCACCAGAACTT 3'
Rat ADAMTS5
Upper primer	5’ GGCTGTGGTGTGCTGTG 3'
Lower primer	5’ CTGGTCTTTGGCTTTGAAC 3'
Rat pro-α 1 (I) collagen
Upper primer	5’ CCCAAGCTTGCGTGGTGTGGTCGGTCT 3'
Lower primer	5’ GATGGAGGGAGTTTACACGA 3'
ADAMTS: a disintegrin and metalloprotease with thrombospondin motifs.

In Situ Hybridization

The protocol used in the present study has been reported elsewhere (Zhu et al. 2001; Sasano et al. 2002) and is only briefly described as follows.

The sections were deparaffinized and washed in PBS, pH 7.4, and then immersed in 0.2 N HCl for 20 min. After being washed in PBS, the sections were incubated in proteinase K (20 g/ml; Roche) in PBS for 30 min at 37C.

The sections were then dipped in 100% ethanol and dried in air and incubated with the antisense probe or the sense control probe (400 ng/ml) in a hybridization mixture for 16 hr at 45C.

The sections were washed and treated with RNase (Type 1a, 20 μg/ml; Sigma, St Louis, MO) for 30 min at 37C. After washing, the hybridized probes were detected immunologically using the Nucleic Acid Detection Kit (Roche), counterstained with methyl green, and mounted with a mounting medium.

At least two sections from each of five embryos or three postnatal animals at each stage were examined using the same probe. The intensity of hybridization signals was evaluated by observing at least three fields of every section.

Immunohistochemistry

The protocol used in the present study has been reported elsewhere (Sasano et al. 2001; Nakamura et al. 2004) and is only briefly described as follows.

The sections were deparaffinized and immersed in 3.0% hydrogen peroxide in absolute methanol for 10 min at room temperature.

After being washed in PBS containing 0.025% Triton X-100 (PBS-TX), the sections were incubated with the monoclonal mouse antibody against a large chondroitin-sulfate proteoglycan from bovine sclera (5D5) for 2 hr at room temperature. The antibody 5D5 was a generous gift of Dr. Firoz Rahemtulla, Department of Oral Biology, School of Dentistry, University of Alabama. The antibody recognizes the core protein of versican from sclera, tendon, aorta, and periodontium, but does not react with aggrecan (Bratt et al. 1992; Larjava et al. 1992; Hakkinen et al. 1993; Lee et al. 1998; Mizoguchi et al. 1998). The antibodies were diluted 1:500 with 5% normal goat serum in PBS-TX (NGS-PBS-TX).

Table 2

RNA polymerases and restriction enzymes used for riboprobes

RNA probes	Antisense	Sense
Versican (617 bp)	SP6, Xhol	T7, BamHI
Versican (818 bp)	T7, HindIII	T3, EcoRI
ADAMTS1	SP6, EcoRV	T7, BamHI
ADAMTS4	T7, BamHI	SP6, EcoRV
ADAMTS5	SP6, EcoRV	T7, Spel
Pro-α 1 (I) collagen	T7, HindIII	T3, EcoRI
ADAMTS: a disintegrin and metalloprotease with thrombospondin motifs.

After being washed in PBS-TX, the sections were incubated in Histofine Simple Stain rat MAX-PO (MULTI) (NICHIREI Co.; Tokyo, Japan) for 30 min at room temperature.

The sections were washed and immunoreactivity was visualized by immersion in Histofine Simple Stain DAB (3, 3'-diaminobenzidine) solution (NICHIREI Co.) for 5 min at room temperature. The sections were counterstained with methyl green and mounted with a mounting medium.

Control sections were processed as described previously, except that preimmune NGS-PBS-TX was used as a substitute for the specific antibody.

Results

Identification of Versican and ADAMTSs

RT-PCR demonstrated that the versican and ADAMTS1, 4, and 5 genes are expressed in developing mandibles and hind limbs (Figure 1).

Expression Pattern of Versican and ADAMTSs

The process of bone development was categorized into the following three stages: the beginning of osteogenesis, the formation of woven bone, and the formation of lamellar bone. The mRNA expression of pro-α 1 (I) collagen (COL1) (Figure 2F, Figure 3D, Figure 4C, Figure 5D, Figure 6D, Figure 7C, Figure 8D, and Figure 9D) was used to identify the phenotype of osteoblasts as described previously (Zhu et al. 2001; Sasano et al. 2002).

Beginning of Osteogenesis

Mandibles. Mesenchymal cell condensate in the putative osteogenic region expressed versican mRNA and protein at E14 (data not shown). The expression of versican mRNA was not detected in cuboidal osteoblasts lining osteoid at E15, whereas mesenchymal cells surrounding the cuboidal osteoblasts express versican diffusely (Figure 2A). Versican protein was localized within osteoid (Figure 2C). The expression of ADAMTS1, 4 (Figure 2D), and 5 mRNAs was identified in mesenchymal cells diffusely surrounding the cuboidal osteoblasts but not in the osteoblasts themselves.

Figure 1.

RT-PCR demonstrates that genes of versican (617 bp; Lanes 4 and 8), ADAMTS1 (445 bp; Lanes 1 and 5), ADAMTS4 (602 bp; Lanes 2 and 6), and ADAMTS5 (758 bp; Lanes 3 and 7) are expressed in E20 mandibles and hind limbs. Lane M contains a 1-kb DNA ladder (Invitrogen).

Hind Limbs. Osteogenesis began in the middle of the cartilaginous template at E18, whereas osteoid was hardly detectable, unlike E15 mandibles described previously. Some cells in the perichondrium (the future periosteum) expressed versican mRNA (Figure 3A) and ADAMTS1, 4 (Figure 3C), and 5 mRNAs, whereas osteoblasts that expressed COL1 (Figure 3D) did not express these molecules. Versican protein was localized around some perichondrial cells, but not in osteoblasts (Figure 3B).

Woven Bone

Mandibles. Flat osteoblasts on the bone surface showed intense expression of versican mRNA and COL1 at E18 (Figures 4A and 4C). In contrast, cuboidal osteoblasts expressed COL1 but not versican mRNA (Figures 4A and 4C). Versican protein was detected in flat osteoblasts (Figure 4B), which corresponded to the mRNA expression pattern. In addition, intense immunoreactivity was seen in the bone matrix (Figure 4B). The expression of ADAMTS1 (Figure 4D), 4 (Figure 4E), and 5 (Figure 4F) mRNA was also detected in flat osteoblasts but not cuboidal osteoblasts. Some osteocytes expressed versican and these ADAMTSs.

Figure 2.

E15 mandibles. (A) Versican mRNA is expressed in mesenchymal cells surrounding the osteogenic region. (B) No hybridization signal is detected in sections processed with control sense riboprobes for versican. (C) The versican protein is localized within osteoid (asterisk). (D) The mRNA expression of ADAMTS4 is demonstrated in mesenchymal cells. (E) No hybridization signal is identified in sections processed with control sense riboprobes for ADAMTS4. (F) Cuboidal osteoblasts express pro-α 1 (I) collagen mRNA. Arrowheads: mesenchymal cells; arrows: cuboidal osteoblasts. Bars = 50 μm.

Figure 3.

E18 femurs. (A) Versican mRNA is present in some perichondrial cells. (B) Versican protein is localized around some periosteal cells. (C) ADAMTS4 is present in some perichondrial cells. (D) Cuboidal osteoblasts and perichondrial cells express pro-α 1 (I) collagen mRNA. Arrowheads: cuboidal osteoblasts; arrows: perichondrial cells; M: muscle. Bars = 50 μm.

Figure 4.

E18 mandibles. (A) Flat osteoblasts express versican mRNA at high levels. (B) Intense immunoreactivity of versican in flat osteoblasts and the bone matrix. (C) Flat and cuboidal osteoblasts express pro-α 1 (I) collagen mRNA. Intense expression of (D) ADAMTS1, (E) ADAMTS4, and (F) ADAMTS5 mRNAs in flat osteoblasts. Arrowheads: flat osteoblasts; double arrowheads: cuboidal osteoblasts. Bars = 20 μm.

Hind Limb. The intense hybridization signals of versican (Figure 5A and Figure 6A) and ADAMTS1, 4 (Figure 5C and Figure 6C), and 5 were identified in flat osteoblasts and in a confined population of osteocytes, whereas cuboidal osteoblasts showed little expression of these molecules at E20. Periosteal cells expressed versican and these ADAMTSs strongly. Immunoreactivity for versican in osteoblasts corresponded to the mRNA expression pattern. The bone matrix around some osteocytes also showed versican immunoreactivity. The periosteum and the bone matrix showed strong immunoreactivity (Figure 5B and Figure 6B).

Lamellar Bone

The periosteum covered the outer surface of lamellar bone, whereas the endosteum lined the bone surface facing the marrow cavity. The periosteum consisted of osteoblasts lining the bone matrix and the fibrous layer of periosteal cells overlying the osteoblasts, whereas the endosteum was composed of the osteoblastic layer with little fibrous tissue.

Mandibles. In lamellar bone of the body of the mandible at W3 and W6, endosteal osteoblasts showed hybridization signals for versican (Figure 7A) and ADAMTS1 (Figure 7D), 4 (Figure 7E), and 5 (Figure 7F). In contrast, mRNA expression of these mRNAs was weak in periosteal osteoblasts and periosteal cells. These endosteal and periosteal osteoblasts were of varied morphology: cuboidal or flat, and some intermediate. Some osteocytes expressed versican and these ADAMTSs.

The versican immunoreactivity was localized in the periosteum and, very weakly, in the bone matrix. The protein was hardly detectable in the endosteum (Figure 7B).

Hind Limbs. In lamellar bone of the femur at W3 and W6, intense hybridization signals for versican (Figure 8A) and ADAMTS1, 4 (Figure 8C), and 5 were seen in endosteal osteoblasts, whereas expression of these mRNA was weak in periosteal osteoblasts (data not shown). These endosteal and periosteal osteoblasts were heterogeneous in morphology, as they were in the mandibles.

The versican immunoreactivity was localized in the periosteum and very weakly in the bone matrix. The protein was hardly detectable in the endosteum (Figure 8B).

Periodontal Ligaments. Some cells of periodontal ligaments at W3 and W6 expressed versican mRNA (Figure 9A) and ADAMTS1, 4 (Figure 9C), and 5 mRNA. The versican protein was localized in periodontal ligaments (Figure 9B). Flat osteoblasts and some osteocytes showed strong expression of these molecules in alveolar bone. The versican protein was more abundant in the matrix of alveolar bone around periodontal ligaments than the body of the mandible.

Figure 5.

E20 femurs. (A) The intense expression of versican mRNA is identified in flat osteoblasts and some periosteal cells. (B) Intense versican immunoreactivity is recognized in flat osteoblasts, the periosteum, and the bone matrix (asterisk). (C) The intense expression of ADAMTS4 mRNA is identified in flat osteoblasts and some periosteal cells. (D) Flat and cuboidal osteoblasts express pro-α 1 (I) collagen mRNA. Arrowheads: flat osteoblasts; double arrowheads: cuboidal osteoblasts; arrows: periosteal cells. Bars = 50 μm.

Figure 6.

E20 femurs. (A) Expression of versican mRNA in flat osteoblasts, (B) Versican protein detected in flat osteoblasts and the bone matrix (asterisk). (C) ADAMTS4 and (D) pro-α 1 (I) collagen mRNAs expression in flat osteoblasts. Arrowheads: flat osteoblasts. Bars = 20 μm.

Controls

No hybridization signal was identified in the sections processed with the sense RNA probes (Figures 2B and 2E). None of the controls for immunohistochemistry showed labeling.

Discussion

The present study described the expression of versican and ADAMTS1, 4, and 5 during a long span of bone development (i.e., from embryonic 14 days to 6 weeks postnatum). Our results support a recent study that reported that cultured osteoblasts express ADAMTS1, 4, and 5, and ADAMTS1 protein is localized to regions associated with osteogenesis in postnatal rat hind limbs (Lind et al. 2005). We investigated mRNA expression and immunolocalization of versican protein during bone development in E14 to W6 rat mandibles and hind limbs. During this period, versican mRNA expression was prominent in a certain population of osteoblasts with corresponding localization of the cognate protein. ADAMTS1, 4, and 5, all proteases capable of cleaving versican (Sandy et al. 2001; Russell et al. 2003; Westling et al. 2004), also exhibited a temporal and spatial mRNA expression pattern similar to that of versican. This suggests that versican is degraded by these ADAMTSs in bone.

Figure 7.

W3 mandibles. (A) The mRNA of versican is detected in endosteal osteoblasts but only weakly in periosteal osteoblasts. (B) Versican immunoreactivity is present in the periosteum and at low levels in the bone matrix. (C) Endosteal and periosteal osteoblasts express pro-α 1 (I) collagen mRNA. The mRNAs of (D) ADAMTS1, (E) ADAMTS4, and (F) ADAMTS5 are detected in endosteal osteoblasts but only weakly in periosteal osteoblasts. Arrowheads: osteoblasts; arrows: the periosteum. Bars = 25 μm.

Figure 8.

W6 femurs. (A) Endosteal osteoblasts express the mRNA of versican. (B) Immunolocalization of versican is hardly detectable in the endosteum. (C) Endosteal osteoblasts express the mRNA of ADAMTS4. (D) Endosteal osteoblasts express the mRNA of pro-α 1 (I) collagen. Arrowheads: osteoblasts. Bars = 20 μm.

We found that the mRNA expression patterns of ADAMTS1, 4, and 5 were comparable to one another during bone development. It has been reported that the ability of ADAMTS4 to cleave aggrecan is higher than that of ADAMTS5 (Tortorella et al. 2002). In addition, ADAMTS4 has been reported to be more active than ADAMTS1 toward both versican and aggrecan (Sandy et al. 2001). These studies suggest that ADAMTS1, 4, and 5 do not contribute equally to the degradation of versican during bone development.

In this study, we divided the process of bone development into three stages: the beginning of osteogenesis, the formation of woven bone and the formation of lamellar bone. Immunoreactivity for versican in the bone matrix was intense at the stage of woven bone, and subsequently became weaker at the stage of lamellar bone. These findings suggest that extensive remodeling of the ECM occurs in the formation of lamellar bone from woven bone, including a decrease in versican levels during bone development. In addition, the present study has shown that versican may be one of the most characteristic ECM molecules that distinguish woven bone from lamellar bone, because woven bone has been indicated to contain more proteoglycan than lamellar bone (Ross et al. 2003).

The expression of the versican protein corresponded to the expression of versican mRNA in osteoblasts, except in osteoid in mandibles, in the endosteum, and in the periosteum of lamellar bone in both mandibles and hind limbs. In E15 mandibles, versican proteins were localized within osteoid, whereas versican mRNA was not detected in osteoblasts lining osteoid, but was present mesenchymal cells surrounding the osteoblasts. In E14 mandibles, versican mRNA and protein were detected in the mesenchymal cell condensate in a putative osteogenic region (Hall and Miyake 2000; Sasano et al. 2000; Zhu et al. 2001). Versican may therefore be expressed by mesenchymal cells, but not osteoblasts, before differentiation of osteoblasts, and accumulated in osteoid, which may facilitate subsequent osteoblast differentiation. Although mRNA expression was detected, little versican protein was found in the endosteum of lamellar bone in both mandibles and hind limbs. We assume that this is because production of versican surpasses its degradation by ADAMTS1, 4, and 5 or other proteases in the endosteum of lamellar bone. In contrast, the expression of versican mRNA was very weak in the periosteum of lamellar bone, where immunoreactivity was strong. Periosteal cells in the fibrous layer overlying the active osteogenic region expressed high level of versican mRNA in woven bone. The versican expression in the periosteal cells decreased as woven bone developed to lamellar bone. We assume that the versican protein accumulates in the periosteum because production of versican exceeds its degradation in lamellar bone. Osteoblasts may be involved in both production and degradation of versican and regulate the balance between them, possibly by secreting these ADAMTSs.

Figure 9.

W3 periodontal ligaments. (A) Some periodontal ligament cells and flat osteoblasts in alveolar bone show signals of versican. (B) The versican protein is localized in periodontal ligaments and alveolar bone (asterisk). (C) Some periodontal ligament cells and flat osteoblasts in alveolar bone show signals of ADAMTS4. (D) Periodontal ligament cells, flat and cuboidal osteoblasts, and osteocytes express pro-α 1 (I) collagen mRNA intensely. Arrowheads: osteoblasts; arrows: cells of periodontal ligaments; AB: alveolar bone; PL: periodontal ligaments; D: dentin. Bars = 50 μm.

We examined the process of bone development in both mandibles and hind limbs. There were distinct differences between mandibles and hind limbs in the beginning stage of osteogenesis. The intramembranous ossification of the mandible may be characterized by formation of osteoid rich in versican, whereas the endochondral ossification of the hind limbs may be characterized by little osteoid, where osteoid matures into bone immediately after it is deposited on the surface of calcified cartilage (Sasano et al. 2000). Thereafter, both mandibles and hind limbs proceed with the common sequential process in which woven bone is formed and gradually altered to become lamellar bone.

Osteoblasts are generally considered to be cuboidal in shape, whereas we demonstrated that flat osteoblasts producing COL1 express versican and ADAMTS1, 4, and 5. Previous studies showed that these flat osteoblasts express bone sialoprotein, osteopontin (Zhu et al. 2001), MMP8, and MMP13 (Sasano et al. 2002). Besides osteoblasts, bone lining cells are known as cells on the bone surface, which are flat in shape and quiescent in bone formation (Marks and Odgren 2002). The flat osteoblast identified in the present study may differ from the bone lining cell, because the flat osteoblast seems to be actively involved in bone formation by expressing ECM molecules. At the stage of woven bone, both cuboidal and flat osteoblasts expressed COL1, whereas expression of versican mRNA and ADAMTS1, 4, and 5 mRNAs was detected in flat osteoblasts and barely detected in cuboidal osteoblasts. Flat osteoblasts that express versican and ADAMTS1, 4, and 5 may play an important role in remodeling proteoglycans in the woven bone matrix. Osteocytes may be also involved in production and degradation of versican by secreting ADAMTS1, 4, and 5.

It is not known whether cuboidal and flat osteo-blasts are the same cells and change their morphological characteristics depending on functional requirements. Alternatively, they may be distinct phenotypes of osteoblasts and have different assignments in bone formation and degradation. Further studies will be required to clarify the functional significance of these cuboidal and flat osteoblasts.

Based on the present results, we propose the following. Versican is expressed before differentiation of osteoblasts and is localized in osteoid during intramembranous ossification. In endochondral ossification, versican is expressed in periosteal cells overlying the active osteogenic region on the surface of calcified cartilage. Thereafter, bones undergoing either type of ossification proceed with the common sequential process of bone development. The bone matrix expands and woven bone rich in versican is formed. Versican expression in the bone matrix is decreased as woven bone is altered into lamellar bone, where ADAMTS1, 4, and 5 are involved. Osteoblasts may be involved in both production and degradation of versican by secreting ADAMTSs.

Further investigation of versican and ADAMTSs may provide a better understanding of remodeling of the extracellular matrix during bone development.

Footnotes

Acknowledgements

This work was supported in part by grants-in-aid (15390550, 16500285) from the Ministry of Education, Science, Sports and Culture of Japan.

We wish to thank Mr. Masami Eguchi and Mr. Yasuto Mikami, Division of Craniofacial Development and Regeneration, Tohoku University Graduate School of Dentistry, for their excellent assistance in this study. We also wish to thank Dr. Firoz Rahemtulla, Department of Oral Biology, School of Dentistry, University of Alabama, for generously providing the antibody. We would like to thank Dr. Paul Kretchmer for reviewing this manuscript.

References

Abbaszade

Liu

Yang

Rosenfeld

Ross

Link

Ellis

(1999) Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family. J Biol Chem 274: 23443–23450

Apte

(2004) A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the ADAMTS family. Int J Biochem Cell Biol 36: 981–985

Bratt

Anderson

Mansson-Rahemtulla

Stevens

Zhou

Rahemtulla

(1992) Isolation and characterization of bovine gingival proteoglycans versican and decorin. Int J Biochem 24: 1573–1583

Hakkinen

Oksala

Salo

Rahemtulla

Larjava

(1993) Immunohistochemical localization of proteoglycans in human periodontium. J Histochem Cytochem 41: 1689–1699

Hall

Miyake

(2000) All for one and one for all: condensations and the initiation of skeletal development. Bioassays 22: 138–147

Kuno

Okada

Kawashima

Nakamura

Miyasaka

Ohno

Matsushima

(2000) ADAMTS-1 cleaves a cartilage proteoglycan, aggrecan. FEBS Lett 478: 241–245

Larjava

Hakkinen

Rahemtulla

(1992) A biochemical analysis of human periodontal tissue proteoglycans. Biochem J 284: 267–274

Lee

Ono

Lee

Omiya

Moriya

Takagi

(1998) Immunocytochemical localization and biochemical characterization of large proteoglycans in developing rat bone. J Oral Sci 40: 77–87

Lind

McKie

Wendel

Racey

Birch

(2005) The hyalectan degrading ADAMTS-1 enzyme is expressed by osteo-blasts and up-regulated at regions of new bone formation. Bone 36: 408–417

10.

Marks

Odgren

(2002) Structure, and Development of the Skeleton. In Bilezikian

Raisz

Rodan

eds. Principles of Bone Biology, 2nd ed. San Diego, Academic Press, 3–15

11.

Matthews

Gary

Zerillo

Pratta

Solomon

Arner

Hockfield

(2000) Brain-enriched hyaluronan binding (BEHAB)/brevican cleavage in a glioma cell line is mediated by a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) family member. J Biol Chem 275: 22695–22703

12.

Mizoguchi

Scott

Dodd

Rahemtulla

Sasano

Kuwabara

Satoh

(1998) An immunohistochemical study of the localization of biglycan, decorin and large chondroitin-sulphate proteoglycan in adult rat temporomandibular joint disc. Arch Oral Biol 43: 889–898

13.

Nakamura

Sato

Hirata

Yamamoto

(2004) Immunolocalization of matrix metalloproteinase-13 on bone surface under osteoclasts in rat tibia. Bone 34: 48–56

14.

Ortega

Behonick

Stickens

Werb

(2003) How proteases regulate bone morphogenesis. Ann NY Acad Sci 995: 109–116

15.

Ross

Kaye

Pawlina

(2003) Bone. In Histology, 4th ed. Philadelphia, Lippincott Williams & Wilkins, 180–213

16.

Russell

Doyle

Ochsner

Sandy

Richards

(2003) Processing and localization of ADAMTS-1 and proteolytic cleavage of versican during cumulus matrix expansion and ovulation. J Biol Chem 278: 42330–42339

17.

Sandy

Westling

Kenagy

Iruela-Arispe

Verscharen

Rodriguez-Mazaneque

Zimmermann

(2001) Versican V1 proteolysis in human aorta in vivo occurs at the Glu441-Ala442 bond, a site that is cleaved by recombinant ADAMTS-1 and ADAMTS-4. J Biol Chem 276: 13372–13378

18.

Sasano

Zhu

Imanaka-Yoshida

Mizoguchi

Kagayama

(2000) Immunohistochemical localization of type I collagen, fibronectin and tenascin C during embryonic osteogenesis in the dentary of mandibles and tibias in rats. Histochem J 32: 591–598

19.

Sasano

Maruya

Sato

Zhu

Takahashi

Mizoguchi

Kagayama

(2001) Distinctive expression of extracellular matrix molecules at mRNA and protein levels during formation of cellular and acellular cementum in the rat. Histochem J 33: 91–99

20.

Sasano

Zhu

Tsubota

Takahashi

Onodera

Mizoguchi

Kagayama

(2002) Gene expression of MMP8 and MMP13 during embryonic development of bone and cartilage in the rat mandible and hind limb. J Histochem Cytochem 50: 325–332

21.

Tang

(2000) ADAMTS: a novel family of extracellular matrix protease. Int J Biochem Cell Biol 33: 33–44

22.

Tortorella

Burn

Pratta

Abbaszade

Hollis

Liu

Rosenfeld

(1999) Purification and Cloning of aggrecanase-1: a member of the ADAMTS family of proteins. Science 284: 1664–1666

23.

Tortorella

Liu

Burn

Newton

Arner

(2002) Characterization of human aggrecanase 2 (ADAM-TS5): substrate specificity studies and comparison with aggrecanase 1 (ADAM-TS4). Matrix Biol 21: 499–511

24.

Werb

Chin

(1998) Extracellular matrix remodeling during morphogenesis. Ann NY Acad Sci 857: 110–118

25.

Westling

Gottschall

Thompson

Cockburn

Perides

Zimmermann

Sandy

(2004) ADAMTS4 (aggrecanase-1) cleaves human brain versican V2 at Glu405-Gln406 to generate glial hyaluronate binding protein. Biochem J 377: 787–795

26.

Wight

(2002) Versican: a versatile extracellular matrix proteoglycan in cell biology. Curr Opin Cell Biol 14: 617–623

27.

Zako

Shinomura

Ujita

Ito

Kimata

(1995) Expression of PG-M(V3), an alternatively spliced form of PG-M without a chondroitin sulfate attachment in region in mouse and human tissues. J Biol Chem 270: 3914–3918

28.

Zhu

Sasano

Takahashi

Mizoguchi

Kagayama

(2001) Temporal and spatial gene expression of major bone extracellular matrix molecules during embryonic mandibular osteogenesis in rats. Histochem J 33: 25–35