Endothelin in a Murine Model of Cerebral Malaria

Infection of Mice.

Six- to eight-week-old female C57BL/6 mice (Taconic, Germantown, NY) were infected with 10⁵ PbA-parasitized RBCs via intraperitoneal injection. Infected mice were compared to age- and sex-matched uninfected controls (N = 6 for each group). The parasitized blood was obtained from previously infected mice on the day of infection and was diluted in phosphate-buffered saline to provide 10⁵ PbA parasitized RBCs in an 0.2-ml injection. At Day 5 postinfection, the mice were euthanized using carbon dioxide and the brains were harvested, frozen in liquid nitrogen, and then stored at −80°C for future analysis. For histopathology, brains were immediately placed in buffered formalin and stored at room temperature.

RNA Extraction and cDNA Determination by Reverse Transcription–Polymerase Chain Reaction (RT-PCR) and Real-Time Quantitative PCR.

Using the TRIzol reagent, RNA was extracted from brain homogenates according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA). Five nanograms of RNA was used to prepare cDNA: we used a Superscript II reverse transcriptase kit (Invitrogen), per the manufacturer’s manual, employing a 50-min incubation at 42°C in a RT mixture consisting of 0.5 mM deoxynucleoside triphosphates; 20 mM dithiothreitol; 30 mM Tris-HCl, pH 8.3; 75 mM KCl; 3 mM MgCl₂; 500 ng oligo dT, and 200 U of superscript RT RNase H-reverse transcriptase.

Quantitative PCR was performed using primers for ET-1 (ET-1 forward: 5′CTGCCACCTGGACATCATC 3′; ET-1 reverse: 5′TCCTTCCTTCCACCAGCTG 3′, which amplified a 280–base pair [bp] endothelin-1 gene fragment); ET_A (ET_A forward: 5′CCCTTAGTGAGCACCTCAAA 3′; ET_A reverse: 5′CACACCGGTTCTTATCCATC 3′, which amplified a 147-bp endothelin type A receptor gene fragment); and ET_B (ET_B forward: 5′CGCTCTGTATTT-GGTGAGCA 3′; ET_B reverse: 5′AGTGAGATTCGGC-GAGTGTT 3′). The quantitative PCR was run using 2 mM MgCl₂ and the PCR Sybr Green Master Mix (Roche Applied Science, Indianapolis, IN) in a final volume of 20 μl. Reaction mixes were loaded into Roche Light Cycler Capillaries, capped, centrifuged for 10 secs at 2000 rpm, and placed in the Light Cycler (Roche). The reaction was run at 95°C at 20°C/sec ramp for 10 mins, followed by 45 cycles of 95°C at 20°C/sec ramp for 5 secs; 58°C at 20°C/sec ramp for 7 secs; and 72°C at 20°C/sec ramp for 20-sec hold. The fluorescence intensity was acquired at 72°C. The third phase of the real-time PCR was the melt phase, which was performed at 95°C at 20°C/sec ramp for 0-sec hold, then 65°C at 20°C/sec ramp for 30-sec hold, and finally 95°C at 0.1°C/sec ramp for 0-sec hold. During the melting phase, the acquisition setting was set at “continuous.” Finally, a cooling phase of 30 secs at 40°C at 20°C/sec was used. Data were acquired and analyzed with Light Cycler (version 3.0) software. For each run, there was a negative control with no added DNA template.

To generate PCR standards, genomic DNA was isolated from control murine brain tissues using the Qiagen DNeasy kit following the manufacturer’s protocol (Qiagen, Inc., Valencia, CA). A standard curve in the range of 5 pg to 50 ng for the quantification of respective products by quantitative PCR was developed using above-described primers and conditions. The result was normalized by dividing the number of copies of mRNA (cyclins) by the number of copies of GAPDH mRNA for each sample. The primer sequence used for GAPDH forward was 5′AACTT TGGCATTGTGGAAGG 3′ and for GAPDH reverse was 5′ACACATTGGGGGTAGGAACA 3′, amplified on a 225-bp GAPDH gene fragment. The conditions for quantitative PCR used for quantification of GAPDH are the same as above. A t test was used for statistical analysis.

RT-PCR was performed using Taq polymerase (Gibco-BRL, Gaithersburg, MD) in a PTC-100 thermal cycler (MJ Research, Watertown, MA). The reaction conditions comprised 35 cycles of 1 min at 94°C, 1 min at 54°C, and 2 mins at 72°C, with a final extension step of 7 mins at 72°C. The primers used for the quantitative PCR of ET-1 were also used for this reaction. For ECE, the primers used were as follows: ECE forward: 5′ATGACGCCGCCCATGGTGAAC 3 ′, and ECE reverse: 5′TGGTTGGGCTAAGACATAAC 3′. For each set of primers, a negative sample (water) was run in parallel. The PCR products were subsequently separated by acrylamide gel electrophoresis and stained with silver nitrate.

Immunohistochemistry.

Brain tissue was fixed in buffered formalin, embedded in paraffin, and sectioned into 4-μm sections. Sections were then deparaffinized and boiled at 95°C for 20 mins in sodium citrate solution (DAKO, Carpinteria, CA) for antigen retrieval. Immunohistochemistry was performed using rabbit antibody to ionized calcium binding adaptor molecule 1 (Iba1) (Wako Chemicals USA, Inc., Richmond, VA) at a 1:300 dilution, incubated overnight at 4°C, as well as mouse immunoglobulin G1 against unphosphorylated neurofilament epitope SMI32 (Sternberger Monoclonals, Baltimore, MD) at 1:500 dilution, with overnight incubation at 4°C. A standard ABC method was used for the secondary antibodies (anti-mouse and anti-rabbit) using a kit from Vector Immunolab (Burlingame, CA) at 1:200 with 1-hr incubation. Slides were counterstained with hematoxylin after immunolabeling.

MRI.

MRI of the mice was performed using a 9.4T horizontal bore Varian Inova system at 6 days postinfection for both control (n = 4) and PbA-infected (n = 4) mice. The blood flow values found in uninfected mice were comparable to those obtained from a database of uninfected C57BL/6 mice using a similar protocol (n = 8), where the average value of cerebral blood flow (CBF) was 94 ± 26 ml/100 g/min (12). CBF measurements were acquired using a flow-alternating arterial inversion spin-labeling method. Single voxel proton spectroscopy (18 μl) was used to measure the relative concentrations of N-acetyl aspartate (NAA), creatine (Cr), and choline from the caudate and putamen. Student’s t test was used for statistical analysis, as previously described (12).

Survival and Parasitemia.

As demonstrated in Figure 1A, murine CM is a fatal disease, with mortality occurring between 7 and 10 days. At the time of death, parasitemia usually measures from 10%–20% (Fig. 1B). This phenomenon was observed in several mice during interrodent passage of the parasitized blood and is well cited in the literature (2, 5, 6). There was no parasitism or mortality observed in the uninfected mice.

MRI.

Consistent with our previous data, there is a significant reduction in CBF in mice at advanced stages of disease from CM, when compared to controls (3). The average CBF in control mice was 109 ± 23 ml/100 g/min, versus 57 ± 13 ml/100 g/min in infected mice, which corresponds to a 48% decrease in CBF associated with CM (P < 0.05) (Fig. 2A). Similarly, we observed a 15% reduction in the NAA to Cr ratio in the caudate putamen of the infected mice; 0.91 ± 0.07 as opposed to 1.07 ± 0.04 in control mice (P < 0.01) (Fig. 2B). We found that there was in fact a direct correlation between the CBF and NAA to Cr ratio (data not shown) (3), which may indicate that a decrease in blood flow to the brain is associated with the neuronal damage that occurs with CM.

Endothelin Studies.

We observed a significant increase in several components of the endothelin pathway in these mice. Both ET-1 and ECE mRNA expression were markedly increased by RT-PCR (Fig. 3A), and when analyzed quantitatively by quantitative PCR, we observed a 3-fold increase in the mRNA expression of ET-1 in infected mice compared to uninfected controls (P < 0.05; Fig. 3B). Correspondingly, when we looked at the endothelin receptors by quantitative PCR, we were also able to demonstrate a 1.5-fold increase in the mRNA expression of ET_A in the infected mice (P < 0.05; Fig. 4A) as well as a 6.4-fold increase in the mRNA expression of ET_B in these mice (P < 0.05; Fig. 4B).