Abstract
We carried out molecular analyses of the novel flaky skin mutation, Ttc7 fsn-Jic (a synonym for fsn Jic ), which we found in a previous study. It was revealed that this mutation involved a genomic in-frame deletion including exons 9 and 10 of the Ttc7 gene, and that the genomic deletion in Ttc7 fsn-Jic may disrupt the tetratricopeptide repeat-2B domain of the TTC7 protein. Based on a comparison of three Ttc7 mutations, including Ttc7 fsn-J (a synonym for fsn) and Ttc7 fsn-hea (a synonym for hea), it was suggested that either exon 9 or exon 10 or both may play a more important role than the other exons of the Ttc7 gene. Ttc7 gene expression analyses using Northern blotting revealed that Ttc7 mRNA is expressed in 11 tissues, except muscle. In conclusion, we confirmed that the Ttc7 fsn-Jic mutation, as well as the Ttc7 fsn-J and Ttc7 fsn-hea mutations, is responsible for abnormal phenotypes observed in various tissues of mice with the flaky skin mutation.
Introduction
Flaky skin ( fsn) mice are used as an animal model of human psoriasis because they develop thick scales with associated patchy alopecia (1, 2). So far, three flaky skin mutants have been reported. The fsn mutation (hereafter referred to as Ttc7 fsn-J ) arose spontaneously in A/J mice (3), and during study of this mutant the fsn locus was assigned to chromosome 17 (3, 4). The hea mutant (hereafter referred to as Ttc7 fsn-hea ) was reported by Shimizu et al. (5) and White et al. (6), and fsn Jic (hereafter referred to as Ttc7 fsn-Jic ) was reported by us (7). Recently, it was demonstrated that the Ttc7 fsn-J mutation is caused by the insertion of an ETn transposon (8, 9), and that the Ttc7 fsn-hea mutation is caused by a large deletion of exons 1–14 of 20 exons (8).
It is well known that flaky skin mice have a pleiotropic disease phenotype, with such features as a smaller body; anemia; low iron metabolism; low hematocrit; enlargement of the liver, spleen, and heart; increased nucleated red blood cells; fragile erythrocyte membranes; and lymphocyte infiltration in the liver and kidneys (3, 10–14). Studies using Ttc7 fsn-J mice have focused on immunologic dysfunction (10, 11, 14, 15) and autoimmunity (16–23). As a result, it has been recognized that the TTC7 protein may be an important regulator of lymphocyte development and function.
Different life spans of three Ttc7 congenic mice with the BALB/c genetic background have been found. Ttc7 fsn-hea homozygotes have the shortest life span (about 7 days; Ref. 6), and Ttc7 fsn-Jic homozygotes live about 10 days (7). In contrast, the life span of the Ttc7 fsn-J homozygotes is about 3 months. This phenomenon suggests that these three mutant alleles are generated by different mutations.
In the present study we attempted a mutation search of the novel mutation, Ttc7 fsn-Jic , in order to identify differences between it and the other Ttc7 mutations. We also carried out expression studies in 12 tissues using Northern blotting.
Materials and Methods
Mice and Genetic Nomenclature.
The B6.INT-Ttc7 fsn-Jic mice maintained in our laboratory were used in this study. The flaky skin phenotypes of the mice are described elsewhere (7). CBy.A-Ttc7 fsn-J was purchased from the Jackson Laboratory (Bar Harbor, ME). C57BL/6JJcl mice were purchased from CLEA Japan (Tokyo, Japan) and were used as the normal mice in this study.
In accordance with information in the Mouse Genome Informatics Database (http://www.informatics.jax. org/mgihome/nomen/), the following gene symbols are used in this paper: Ttc7 fsn-J for fsn J , Ttc7 fsn-hea for fsn hea , and Ttc7 fsn-Jic for fsn Jic .
Mutation Search.
Extraction of Genomic DNA and Messenger RNA.
Genomic DNA was extracted using the standard method. Extraction of messenger RNA was performed using Trizol reagent (Invitrogen, Carlsbad, CA) in accordance with the manufacturer’s instruction.
Genomic Polymerase Chain Reaction (PCR) and Reverse Transcriptase (RT)-PCR.
Genomic PCR was performed to amplify the Ttc7 exons. The primer sets derived from flanking sequences 50 bp upstream and downstream of Ttc7 are shown in Table 1. Conditions for genomic PCR were: 35 cycles of 30 secs at 94°C, 30 secs at 60°C, and 30 secs at 72°C, using Ex-Taq polymerase (TaKaRa, Kyoto, Japan) in accordance with the manufacturer’s instruction. Two-percent agarose gels (Nippon Gene, Tokyo, Japan) were used as analytical gels and were prepared in Tris-acetate-EDTA buffer.
RT-PCR was carried out using a Superscript III First-Strand cDNA synthesis kit (Invitrogen) in accordance with the manufacturer’s instruction. Agarose gels (0.8% and 2%) were used as described above.
Sequencing.
To perform direct sequencing, the PCR products were purified using a MinElute PCR purification kit (Qiagen, Valencia, CA). Sequencing was carried out using an ABI3700 automated sequencer (Applied Biosystems, Foster City, CA). Analyses of sequence data were carried out using Sequencher software (Gene Codes, Ann Arbor, MI).
Northern Blotting.
The cDNA probe (approximately 0.46 kb and including exons 17–20) for Northern blotting was prepared using RT-PCR. Purification of the cDNA was carried out using Quiaquick Gel Extraction Kit (Qiagen) and labeled with 32P-2′-deoxycytidine 5′-triphosphate (32P-dCTP) using a Prime-It Labeling kit (STRATAGENE; Roche Molecular Biochemicals, Mannheim, Germany) in accordance with the manufacturer’s instructions. Northern blot membrane was purchased from OriGene Technologies (Rockville, MD).
Results
Identification of the Ttc7 fsn-Jic .
Genomic PCR was performed using 20 primer sets designed to detect 20 exons of the Ttc7 gene. As shown in Figure 1, exons 9 and 10 were not detected in the Ttc7 fsn-Jic mutation.
RT-PCR also was carried out to confirm the deletion. As shown in Figure 2, two mutation bands were indicated by gel electrophoresis. One is a 786-bp band deleting 222 bp, which is equivalent to 74 amino acids, including exons 9 and 10, and the other is a 681-bp band deleting 327 bp, which is equivalent to 109 amino acids, including exons 9–11. Genomic DNA sequencing was performed to clarify the reason why two different deletions were present. As a result, a 10-base deletion from −32 to −41 of the 5′ sequence near exon 11 was observed, as shown in Figure 3.
Expression Studies of Ttc7 mRNA.
We studied expression of the Ttc7 gene in 12 tissues of the normal mouse. As shown in Figure 4, Ttc7 mRNA was strongly expressed in kidney and liver; was moderately expressed in the skin, spleen, stomach, intestine, thymus, and lung; was weakly expressed in the brain, heart, and testis; and was absent in muscle.
Comparison of Genomic DNA and mRNA of Ttc7 fsn-Jic , Ttc7 fsn-hea , and Ttc7 fsn-J .
Possible structures of genomic DNA and mRNA of the Ttc7+, Ttc7 fsn-Jic , Ttc7 fsn-hea , and Ttc7 fsn-J mutations are shown in Figure 5. As a result of comparing these structures, it was supposed that the deletion of exons 9 and 10 in the Ttc7 fsn-Jic mutation leads to a lack of tetratricopeptide repeat-2B (TPR-2; Fig. 5f), and that the deletion of exons 1–14 in the Ttc7 fsn-hea mutation leads to a lack of TPR-2A, TPR-2J, TPR-2B, TPR-1C, and TPR-2D (Fig. 5g).
Discussion
Molecular analyses performed in the present study revealed that the Ttc7 fsn-Jic mutation is caused by a genomic in-frame deletion of exons 9 and 10. Comparing Ttc7 fsn-J mice and Ttc7 fsn-hea mice showing a large deletion of exons 1–14, there are few differences in their disease phenotypes, except a slightly different life span. This result leads to the conclusion that exon 9 and/or 10 of the Ttc7 gene may play an important role in biologic function of the TTC7 protein.
Two different amplicons were equally produced in the Ttc7 fsn-Jic homozygotes by RT-PCR, as shown in Figure 2. It may be supposed that a 10-base deletion in intron 11 causes two different splicing events leading to two transcripts, deleting exons 9 and 10 and exons 9–11. We used a website (http://www.fruitfly.org/seq_tools/splice.html) to search specific sequences for splicing mutation. However, a query result showed this 10-base sequence does not predict any splicing mutations.
Using Northern blotting we demonstrated that Ttc7 transcripts are ubiquitously expressed in the normal mice in this study. Our results agreed with that of Helms et al. (9). Abnormalities observed in blood, skin, and other organs of the flaky skin mice lead to a hypothesis that Ttc7 mutations could cause the widespread flaky skin disease phenotypes, including hematopoietic and autoimmune disorders. Therefore, the TTC7 protein may play a fundamental role in the development or regulation of the immune system. This is in agreement with the multi-immunologic abnormalities in flaky skin mice. We conclude that various flaky skin diseases are brought about not by immunologic dysfunction but by the mutated TTC7 protein expressed ubiquitously in almost all tissues and organs.
TPR is a structural motif present in a wide range of proteins (24–26). It mediates protein-protein interactions and the assembly of multiprotein complexes (27). The Ttc7 gene codes 10 TPR domains that consist of 34 to 37 amino acids (8, 9). Five TPRs (2A, 2J, 2B, 1C, and 2D) are deleted in Ttc7 fsn-hea (8), and one TPR (2B) is deleted in Ttc7 fsn-Jic , as shown in this study. In Ttc7 fsn-J , TPR-2D is disrupted due to insertion of the ETn transposon into intron 14 (8, 9). Helms et al. noted that the disruption of TPR-2D may affect its interaction with an as yet unidentified protein partner (9). They also found that a subset of Ttc7 transcripts in Ttc7 fsn-J mice are wild type, indicating that the splicing of the ETn exon is leaky. This leaky splicing may bring about the longer life span of the Ttc7 fsn-J mouse. These findings may suggest that a deletion of TPR-2B leads to a nearly complete loss of TTC7 function, which causes not only pleiotropic pathologic changes but also early postnatal death in both Ttc7 fsn-hea and Ttc7 fsn-Jic mutants.
In an association study of single nucleotide polymorphisms within TTC7A, the human ortholog of mouse Ttc7, Helms et al. (9) concluded that the TTC7A locus did not have a major role in psoriasis susceptibility in human psoriasis. However, even if TTC7 is not the gene responsible for human psoriasis, the mechanisms underlying psoriasis-like inflammatory skin lesions and the biologic roles of each TPR domain in the functions of the TTC7 protein should still be studied further.
Primer Sets Used for Genomic PCR (5′-3′) a
Exon deletion in the Ttc7 fsn-Jic mutation. Using genomic PCR, exons 1–20 were detected in the normal mice (+), but exons 9 and 10 were not detected in the mutant mice (Ttc7 fsn-Jic ). M indicates the φX174 phage DNA digested with HaeIII enzyme.
Two types of deletion mutation in the Ttc7 fsn-Jic mutation. Primers TCACCTCTACGAAGGGGACAA (forward) and AGAGT-CAGGTGGATACCGTT (reverse) that were designed based on sequence data in the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nih.gov/) were used to amplify 1008 bp, including exons 7–17. RT-PCR using this primer pair amplified two different PCR products, 681 bp and 786 bp, from the Ttc7 fsn-Jic mutation. Ttc7+ and Ttc7 fsn-J were clearly identified by the different sizes of their PCR products (1008 bp and 1191 bp, respectively). M indicates the φX174 phage DNA digested with HaeIII enzyme.
A 10-base deletion exists in intron 10 near exon 11 of Ttc7 fsn-Jic . The PCR product used for sequencing was amplified using the primers designed in intron 10 and intron 11. Rectangles shown the 10 bases from −41 to −32 at the 5′ end near exon 11.
Ttc7 mRNA expression using Northern blotting. The cDNA probe for Northern blotting was prepared using RT-PCR with the primers 5′-GAAGAAACAGAACGGTATCCAC-3′ (forward) and 5′-TCCACAGCATCCCGCAGCACCT-3′ (reverse), which were designed based on sequence data in the NCBI database (http://www.ncbi.nih.gov/). A high-density band in a small size was observed in testis. This band also was observed by Helms et al. (9).
Comparison of the genomic DNA and mRNA of Ttc7+, Ttc7 fsn-Jic , Ttc7 fsn-hea , and Ttc7 fsn-J . (a) and (e) are the possible structures of genomic DNA and mRNA of Ttc7+, (b) and (f) are those of Ttc7 fsn-Jic , (c) and (g) are those of Ttc7 fsn-hea , and (d) and (h) are those of Ttc7 fsn-J . Dotted lines indicate the deleted genomic regions observed in Ttc7 fsn-Jic and Ttc7 fsn-hea . Two Ttc7 fsn-Jic transcripts (f) were detected using RT-PCR, as shown in Figure 2. However, existence of the Ttc7 fsn-hea transcript has not been found (8). The Ttc7 genomic DNA is approximately 100 kb in length, consisting of 20 exons. The Ttc7 mRNA is approximately 4.6 kb in length, including the 2577-bp coding region (858 amino acids). Among the letters A through I enclosed in circles, C and I are the TPR-1 repeats; B, E, F, G, and H are the TPR-2 repeats; and A and D are TPR-2 repeats determined from sequence context. This figure was drawn based on the report of Helms et al. (9).
Footnotes
This work was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan.