Regulation of Mammary Gland Sensitivity to Thyroid Hormones During the Transition from Pregnancy to Lactation

Abstract

Thyroid hormones are galactopoietic and help to establish the mammary gland’s metabolic priority during lactation. Expression patterns for genes that can alter tissue sensitivity to thyroid hormones and thyroid hormone activity were evaluated in the mammary gland and liver of cows at 53, 35, 20, and 7 days before expected parturition, and 14 and 90 days into the subsequent lactation. Transcript abundance for the three isoforms of iodothyronine deiodinase, type I (DIO1), type II (DIO2) and type III (DIO3), thyroid hormone receptors alpha1 (TRα1), alpha2 (TRα2) and beta1 (TRβ1), and retinoic acid receptors alpha (RXRα) and gamma (RXRγ), which act as coregulators of thyroid hormone receptor action, were evaluated by quantitative RT-PCR. The DIO3 is a 5-deiodinase that produces inactive iodothyronine metabolites, whereas DIO1 and DIO2 generate the active thyroid hormone, triiodothyronine, from the relatively inactive precursor, thyroxine. Low copy numbers of DIO3 transcripts were present in mammary gland and liver. DIO2 was the predominant isoform expressed in mammary gland and DIO1 was the predominant isoform expressed in liver. Quantity of DIO1 mRNA in liver tissues did not differ with physiological state, but tended to be lowest during lactation. Quantity of DIO2 mRNA in mammary gland increased during lactation (P < 0.05), with copy numbers at 90 days of lactation 6-fold greater than at 35 and 20 days prepartum. When ratios of DIO2/DIO3 mRNA were evaluated, the increase was more pronounced (>100-fold). Quantity of TRβ1 mRNA in mammary gland increased with onset of lactation, whereas TRα1 and TRα2 transcripts did not vary with physiological state. Conversely, quantity of RXRα mRNA decreased during late gestation to low levels during early lactation. Data suggest that increased expression of mammary TRβ1 and DIO2, and decreased RXRα, provide a mechanism to increase thyroid hormone activity within the mammary gland during lactation.

Introduction

Thyroid hormones are important regulators of mammalian development, cellular differentiation and metabolism (1). In vivo studies as early as 1934 demonstrated that thyroid hormone administration can increase milk production in dairy cows and in vitro studies have shown that 3,3′,5-triiodothyronine (T3) potentiates the activity of other lactogenic and galactopoietic hormones (2, 3). Tissue sensitivity to thyroid hormones can be altered by iodothyronine deiodination and changes in expression of nuclear receptors for thyroid hormones.

The primary hormone secreted by the thyroid, thyroxine (T4), has little intrinsic biological activity due to low affinity for nuclear thyroid hormone receptors (4). Mono-deiodination of the outer ring (5′-deiodination) of T4 yields a thyroid hormone with much greater biological activity, T3; whereas deiodination of the inner ring (5-deiodination) converts T4 and T3 to the biologically inert compounds, 3,3′,5′-triiodothyronine (reverse T3, rT3) and 3,3′-diiodo-thyronine (3,3′-T2), respectively. Therefore, biological activity of thyroid hormones may be enhanced by 5′-deiodination or diminished by 5-deiodination. Three deiodinases regulate local and systemic activity of thyroid hormones. The 5′-deiodination is catalyzed by type-I (DIO1) and type-II (DIO2) deiodinases present in many tissues. DIO1 is expressed predominantly in thyroid, liver and kidney, and DIO2 in pituitary, brain, brown adipose tissue and placenta (5, 6). Depending upon species, DIO1 or DIO2 may be expressed in mammary gland, with DIO2 being the isoform expressed in bovine mammary tissue (7–9). The inner ring deiodinase (5-deiodinase), DIO3, is present in placenta, uterus and fetus and appears to protect developing embryonic and neonatal tissues from excessive T3 levels (5), where its presence is critical for the maturation and function of the thyroid axis (10). High levels of DIO3 mRNA expression have also been reported for bovine mammary gland (11).

During the transition from pregnancy to lactation, adjustments in metabolism of thyroid hormones appear important in establishing metabolic priority for lactation. It was demonstrated in rats (7, 9, 12) and cows (13) that 5′-deiodinase activity in liver decreased during the transition from pregnancy to lactation, while 5′-deiodinase activity in mammary tissue increased. Moreover, the magnitude of these changes in rats was proportional to lactation intensity, which was manipulated by adjusting litter size (7, 9). Thus, changes in the extent of T4 to T3 conversion by liver and mammary gland appear to be related to establishment of lactation. Additionally, thyroid ablation and hormone replacement in mice showed that thyroid hormones are necessary for a galactopoietic response to prolactin and somatotropin, and demonstrated that these galactopoeitic hormones increased 5′-deiodinase activity (DIO2) specifically in mammary gland (14).

Thyroid hormone receptors (TRs) are members of the superfamily of nuclear receptors (15, 16). In the absence of ligand, these receptors bind to thyroid response elements (TREs) and repress expression of target genes by virtue of interaction with co-repressors (17). There are two TR genes, THRA and THRB, each of which produces two mature transcripts. TRα1 and TRα2 (c-erbAα-2) transcripts and proteins are derived as alternative splice variants of THRA. Although TRα2 binds to TREs, it is unable to bind ligand and therefore represses transcription. TRβ1 and TRβ2 are transcript/protein variants of THRB generated by use of alternative promoters. The TRs bind to TREs as homodimers, or as heterodimers with 9-cis retinoic acid receptors (RXRs). TR/RXR heterodimers likely play an important role in mediating response to thyroid hormones; for although TRs bind to TREs as either homo or heterodimers in absence of bound ligand, the ligand-bound TRs bind to TREs primarily as heterodimers with RXR (16).

Neither expression of DIO3 nor thyroid hormone receptors has been evaluated in liver and mammary gland during the transition from pregnancy to lactation. To more fully evaluate changes in expression of genes in liver and mammary gland that are likely associated with altering tissue sensitivity to thyroid hormones during lactogenesis and establishment of lactation, we evaluated expression of the iodothyronine-deiodinases, nuclear thyroid hormone receptors and retinoic acid receptors in liver and mammary gland of cows during the period of transition from pregnancy to lactation.

Material and Methods

Experimental Design.

Tissue samples were obtained from the mammary gland and liver of 24 euthanized multiparous Holstein cows. Tissues were obtained from 4 nonpregnant, lactating cows on day 14 and 90 of lactation and from 3 pregnant cows at 7, 25, 40, and 53 days after cessation of milking. Because milking was terminated 60 days before expected parturition, these sampling times equated to approximately 53, 35, 20, and 7 days before expected parturition. Tissues were snap frozen in liquid nitrogen for subsequent RNA isolation and real-time quantitative RT-PCR. Mammary tissues were also fixed in 10% neutral buffered formalin and processed for paraffin embedding, sectioning and immunohistochemical analyses as described subsequently. Use of animals for these investigations was approved by the Beltsville Agricultural Research Center’s Animal Care and Use Committee.

RNA Preparation and Real-Time Quantitative RT-PCR.

Total RNA was isolated using RNeasy isolation kits with on-column DNase digestion (Qiagen Inc., Valencia, CA). The RNA quality was evaluated using the Agilent 2100 Bioanalyzer with RNA 6000 Nano LabChip kits (Agilent Technologies, Palo Alto, CA) and concentration was determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Rockland, DE). Reverse transcription was performed using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) with 1 μg of RNA per 40-μl reaction volume. A parallel reaction was performed in the absence of reverse transcriptase enzyme to serve as a negative control. Incubation conditions were those suggested by the manufacturer: 25°C for 5 min, 42°C for 30 min, 85°C for 5 min.

Transcript abundance was determined by absolute real-time quantitative RT-PCR using the Bio-Rad iCycler with a MyiQ Real-time PCR Detection System, and using iQ SYBR Green Supermix (Bio-Rad Laboratories). Table 1 summarizes primer sequences and annealing temperatures used for quantitative real-time PCR and the amplicon size of each gene target. Identity of amplification products was confirmed by direct sequencing of gel-purified PCR-amplification products (QIAquick Gel Extraction Kit, Qiagen Inc., Valencia, CA) using a CEQ8000 automated DNA sequencer and DTCS Quickstart Chemistry (Beckman Coulter, Fullerton, CA). Amplicon concentrations were determined using the Agilent 2100 BioAnalyzer and DNA 500 kits (Agilent Technologies). Cycling conditions used for real-time PCR were 95°C for 3 min followed by 45 cycles of 94°C for 15 s, annealing temperature for 30 s, and 72°C for 30 s with fluorescence measurement during the extension step. Melting curve analysis was also performed after PCR amplification using the MyiQ Real-time PCR Detection System. External calibration curves were generated for each gene using known quantities of purified double-stranded cDNA containing the amplification region of interest and included with each assay. Standards ranged from 1 × 10² to 1 × 10⁶ molecules. Standards and samples were analyzed in duplicate for each assay. In addition to sample controls (reverse transcription reaction without reverse transcriptase), a negative control reaction (blank) containing water as template was included for each standard curve. Quantities of transcripts were expressed as the number of molecules per unit of total RNA used in the reverse transcription reaction.

Immunohistochemistry.

Tissues were fixed in 10% neutral buffered formalin overnight at 4°C and transferred to 70% ethanol. Samples were dehydrated and embedded in paraffin according to standard techniques and sectioned at 5 μm onto Superfrost^™ plus slides (Erie Scientific Co., Portsmouth, NH). Slides were dewaxed in xylene and hydrated in a graded series of ethanol to phosphate buffered saline (PBS, pH 7.4). Tissue sections were quenched with 3% H₂O₂ in PBS for 10 min and then washed in PBS (3 × 2 min). Microwave antigen retrieval was then used. Slides were heated in a microwave at high power (650 W) in 400 ml of 10 mM citrate buffer (pH 6.0) for 5 min, remained undisturbed for 5 min, and then were microwaved for an additional 5 min. Slides remained in the buffer for a 30-min cooling period. They were then washed in PBS (3 × 2 min) and blocked with 5% non-immune goat serum in PBS (30 min) prior to overnight incubation at 4°C with the following rabbit polyclonal antibodies (Affinity BioReagents, Golden, CO) used at 1:200 dilution in 5% normal goat serum in phosphate buffered saline: anti-TR (PA1–214), anti-TRβ1 (PA1–213), anti-TRα1 (PA1–211), and anti-TRα2 (PA1–212). Negative controls were similarly incubated using a non-immune rabbit IgG at appropriate concentration. After incubation, tissue sections were washed in PBS (3 × 2 min) and processed for immunohistochemical detections using Zymed’s Picture Plus^™ polymer detection kit (Zymed Laboratories, San Francisco, CA). Sections were incubated for 30 min at room temperature with the secondary antibody horseradish peroxidase polymer conjugate. After washing in PBS (3 × 2 min), sections were incubated with diaminobenzidine, washed, counter stained with hematoxylin and then mounted with Permaslip (Alban Scientific Inc., St. Louis, MO).

Statistical Analyses.

Data were analyzed using a one-way analysis of variance. Bonferroni’s multiple comparison test was used for pair-wise comparisons (Prism, version 4; GraphPad Software, Inc., San Diego, CA).

Results and Discussion

The quantity of transcripts for DIO1, DIO2, and DIO3 during the period of transition from pregnancy to lactation are depicted in Figure 1 . Dairy cows are typically pregnant during most of lactation and milking is terminated 60 days prior to expected parturition. Therefore physiology of the mammary gland during the prepartum period (as depicted) is influenced by the cessation of milking, which promotes involution, and the mammogenic and lactogenic effects of late pregnancy, promoting a process that we have referred to as regenerative involution (18, 19).

As previously reported for protein level, DIO1 is the predominant 5′-deiodinase transcript isoform expressed in bovine liver and DIO2 is the predominant isoform in bovine mammary gland (8, 20). DIO1 transcript abundance in liver changed during the prepartum period (Fig. 1A; P =0.027), with low levels throughout most of the period, but with a brief rise in abundance the final week of pregnancy. In mammary gland, abundance of DIO2 transcripts increased from low levels during pregnancy through early lactation (day 14) to peak lactation (day 90, Fig. 1B ; P < 0.0001). These later changes are consistent with changes in mammary DIO2 enzyme in cow (13). Levels of DIO1 mRNA in mammary tissue and DIO2 mRNA in liver were near the limit of detection and did not change during this transition period (P > 0.10). DIO3 mRNA was present in both liver and mammary gland, with higher concentrations evident in mammary tissues (Fig. 1C). In mammary gland, DIO3 transcript abundance decreased as gestation advanced, with a nadir during early lactation (P =0.019). To visualize relative changes in thyroid hormone activation and inactivation pathways, the ratios of DIO1/DIO3 and DIO2/DIO3 were calculated for liver and mammary tissues, respectively (Fig. 1D ). When viewed in this manner, changes in DIO1/DIO3 mRNA levels in liver (P = 0.038) suggest increased thyroid hormone activation during late gestation, followed by a decline during established lactation. Because liver 5′-deiodination of T4 is the primary source of T3 in circulation, this conclusion is consistent with the higher increased systemic concentrations of thyroid hormones during late gestation and the decline during lactation (12, 13, 21). Opposite to changes in liver, alterations in DIO2/DIO3 mRNA levels (P =0.0005) suggest an increase in local conversion of T4 to T3 within the mammary gland during lactation. This local generation would help to maintain a euthyroid condition in mammary gland in face of the functional hypothyroid state that is characteristic of lactation (12, 22).

The observed changes in expression of deiodinase transcripts are consistent with previously reported transcriptional regulation of these genes. The DIO1 gene contains SP1 promoters and two thyroid response elements (TRE) in the 5′ flanking region, imparting T3 and retinoic acid responsiveness to the gene (23). DIO1 is particularly sensitive to thyroid status, with T3 enhancing transcription. Thus, decreased activity of the thyroid hypothalamic-pituitary axis during lactation promotes a systemic decrease in DIO1 expression with advancing gestation/lactogenesis and the onset of lactation (12). DIO2 responds to thyroid status in opposite direction to the effect on DIO1. Although a negative TRE has not been identified in the DIO2 promoter region, transcription of DIO2 is decreased by T3 (5, 6). Thyroid ablation and hormone replacement demonstrated that growth hormone and prolactin specifically increased DIO2 expression in the mammary glands of mice (14), regulation that is consistent with increased expression of DIO2 during lactation. Recent studies indicate that bile acids may provide a linkage between food consumption and metabolic control via DIO2. Postprandial increases in serum bile acids have been shown to bind to TGR5, a membrane G-protein, eliciting an increase in intracellular cAMP and induction of DIO2 transcription in muscle and fat (24, 25). Whether bile acids increase mammary DIO2 expression and thereby adjust mammary metabolism to the increase in feed intake that accompanies lactation in cattle remains to be determined, but are consistent with the changes observed. Several factors are known to affect DIO3 expression, but the DIO3 binding sites and mechanisms of regulation are largely undefined. Consistent with the decline in DIO3 transcript abundance observed during the relatively hypothyroid state of lactation, thyroid hormones increase abundance of DIO3 transcripts (26), whereas glucocorticoids and growth hormone reduce expression of DIO3 in several in vitro systems (27, 28). Fibroblast and epidermal growth factors (27, 29) and transforming growth factor beta (30) induce DIO3 expression in a number of cell lines. Potential regulation by these factors would be consistent with the greater expression of DIO3 during late pregnancy when extensive epithelial growth, differentiation and angiogenesis occur within the mammary gland. Thus, changes in expression of the three deiodinases during the transition from pregnancy to lactation are consistent with known regulation in various species and cell types.

The quantity of transcripts for the thyroid hormone receptors, TRα1, TRα2 and TRβ1, and for retinoid receptors, RXRα and RXRγ, in bovine mammary gland are summarized in Figure 2. The TR present in greatest abundance was TRα1; however, its expression was unaltered during the transition period (Fig. 2A ; P > 0.10). TRβ1 mRNA was present in lower abundance, but the quantity increased from pregnancy to established lactation (P = 0.0001). Expression of these TRs is consistent with general expression patterns for these receptors in other tissues and species. Both TRα1 and TRβ1 mRNAs and proteins are expressed in almost all tissues, whereas TRβ2 is expressed almost exclusively in anterior pituitary and hypothalamus (31–33). Thus, expression of TRβ2 was not evaluated in the current study. Interestingly, TRα2 mRNA was present in significant quantity in bovine mammary gland. Because it does not bind thyroid hormones but does bind to TREs, it can serve as a potential repressor of thyroid hormone-responsive genes. However, because the quantity of TRα2 mRNA was not impacted by the transition from pregnancy to lactation (P > 0.10) it does not appear to serve as a regulator of thyroid hormone-responsive genes in mammary gland during this period. These results are similar to the expression patterns of TRs in rat mammary gland. Using semi-quantitative RT-PCR, TRβ1 was shown to be expressed in rat mammary gland mainly during lactation, whereas TRα1 appeared to be expressed primarily during pubescent, pregnant and weaning periods (34). Data suggest that TRβ1 mediates metabolic adjustments within the lactating mammary gland that are promoted by thyroid hormones.

Expression of RXRα and RXRγ in mammary tissue is depicted in Figure 2B. RXRγ mRNA was present at low and invariant concentrations (P > 0.10). Alternatively, RXRα mRNA was expressed at high concentrations 53 days prior to expected parturition (7 days after cessation of milking) and declined throughout the prepartum period and into the succeeding lactation (P =0.0006). RXRs form heterodimers with TRs, which then serve as TRE transcription factors. A limited number of naturally occurring TRE have been identified that do not require the RXR proteins for function (31, 35). Our results suggest that RXRα may play a role in local regulation of thyroid hormone-responsive genes in the bovine mammary gland, particularly during late pregnancy. But its decline during late pregnancy and lactation, appears at odds with increased mammary sensitivity to thyroid hormones. Heterodimers of TR/RXR often mediate transcription of thyroid hormone-responsive genes, but may also block transcription of other genes via RXR (16). There is extensive cross-talk between nuclear receptors and the nature of these and other interactions that impact the transition from pregnancy to lactation remain to be fully elucidated.

Expression and localization of TR proteins were evaluated by immunohistochemistry (data not shown). Use of an antibody that recognizes both TRα1 and TRβ1, showed that these TR proteins are expressed in mammary tissues from pregnant and lactating cows, and that the TRs are localized in nuclei of both mammary epithelium and stroma. Tissues stained using antibodies specific for single isoforms of TR showed the same patterns of staining (TRα1, TRα2 and TRβ1). The extensive expression indicates that a variety of cell types are receptive to thyroid hormone regulation.

In conclusion, we have shown that the transition from pregnancy to lactation in dairy cows is accompanied by changes in abundance of transcripts for activating and deactivating iodothyronine deiodinases, consistent with decreased T4 to T3 conversion in liver and enhanced T4 to T3 conversion in mammary gland. Transcripts for TRα1, TRα2 and TRβ1 were expressed in mammary gland, as were transcripts for the related receptor, RXRα. Increased abundance of TRβ1 transcripts and decreased abundance of RXRα transcripts during the transition from pregnancy to lactation may alter signaling and increase the sensitivity of lactating mammary tissue to thyroid hormones. Such changes are consistent with establishing metabolic priority for the lactating mammary gland and enhancing direct and indirect galactopoietic effects of thyroid hormones.

Table 1.
Summary of Gene Targets Evaluated by Real-Time Quantitative RT-PCR

Gene Amplicon size (bp) Sense primer (5′→3′) Antisense primer (5′→3′) Annealing temp. (°C) PCR eff. (%) Corr. coeff. (r)

TRα1 133 AGGCTGTGCTGCTAATGTC CAGAAGTGCGGAATGTTGTG 54.7 110.3 0.996

TRα2 105 ATATTCCAAGATGAGCCTCTG GGGAGAGTGGTTTAAATAGGG 54.7 105.8 0.999

TRβ1 115 CCGCAACTCAGCCCATTC AAGTTCTGTCTTGTCCATCCTC 54.7 106.2 0.996

RXRα 130 CCTACGCCTTCTTCTTCC CTGCTCTGGGTCTCAATG 61.0 99.3 0.999

RXRγ 144 AAGACTGCCTCATTGACAAG CACACTCTGCCTCACTTTC 61.0 98.9 0.998

DIO1 106 TGGGGTAGACACAATGACGAA GGCCAGATTTACCCTTGTAGGA 52.0 95.6 1.000

DIO2 134 CCACCTTCTGGACTTTGCCA GGAAGTCAGCCACGGATGAG 54.0 96.3 1.000

DIO3 120 TCACTCCCTGAGGCTCTG CCCAGTAAATGCTTACGGATG 61.0 97.3 0.999

Figure 1.
Expression of transcripts for iodothyronine deiodinases type I (D1), type II (D2) and type III (D3) in mammary gland (MG) and liver, during the periparturient transition from pregnancy to lactation. Values are expressed as number of molecules per unit of total RNA in the reverse transcription reaction. D1 and D2 (Panels A and B) are 5′-deiodinases that enhance thyroid hormone activity by converting T4 to T3. D3 (Panel C) is a 5-deiodinase that diminishes thyroid hormone activity by metabolizing T4 and T3 to the inactive iodothyronines, rT3 and T2. Ratios of activating to inactivating deiodinases in mammary tissue (D2/D3) and liver (D1/D3) are depicted in panel D. Number of cows = 3 to 5 per time point. Within tissue, means without common superscripts differ (P < 0.05).

Figure 2.
Expression of transcripts for thyroid hormone receptor isoforms, TRα1, TRα2, and TRβ1 (Panel A), and retinoid receptor isoforms, RXRα and RXRγ (Panel B), in mammary gland during the periparturient transition from pregnancy to lactation. Values are expressed as number of molecules per unit of total RNA in the reverse transcription reaction. Number of cows = 3 to 5 per time point. Means without common superscripts differ (P < 0.05).

Gene	Amplicon size (bp)	Sense primer (5′→3′)	Antisense primer (5′→3′)	Annealing temp. (°C)	PCR eff. (%)	Corr. coeff. (r)
TRα1	133	AGGCTGTGCTGCTAATGTC	CAGAAGTGCGGAATGTTGTG	54.7	110.3	0.996
TRα2	105	ATATTCCAAGATGAGCCTCTG	GGGAGAGTGGTTTAAATAGGG	54.7	105.8	0.999
TRβ1	115	CCGCAACTCAGCCCATTC	AAGTTCTGTCTTGTCCATCCTC	54.7	106.2	0.996
RXRα	130	CCTACGCCTTCTTCTTCC	CTGCTCTGGGTCTCAATG	61.0	99.3	0.999
RXRγ	144	AAGACTGCCTCATTGACAAG	CACACTCTGCCTCACTTTC	61.0	98.9	0.998
DIO1	106	TGGGGTAGACACAATGACGAA	GGCCAGATTTACCCTTGTAGGA	52.0	95.6	1.000
DIO2	134	CCACCTTCTGGACTTTGCCA	GGAAGTCAGCCACGGATGAG	54.0	96.3	1.000
DIO3	120	TCACTCCCTGAGGCTCTG	CCCAGTAAATGCTTACGGATG	61.0	97.3	0.999

Footnotes

This work was funded by the United States Department of Agriculture, Agricultural Research Service, CRIS 1265-31000-086-00.

Mention of a trade name or proprietary product does not constitute a guarantee or warranty by the USDA and does not imply approval to the exclusion of others not mentioned.

References

Ingbar SH, Braverman LE, Eds. The Thyroid. New York: J.B. Lippincott Company, 1986.

Bhattacharjee M, Vonderhaar BK. Thyroid hormones enhance the synthesis and secretion of alpha lactalbumin by mouse mammary tissue in vitro. Endocrinology 115:1070–1077, 1984.

Houdebine L, Delouis C, Devinoy E. Post-transcriptional stimulation of casein synthesis by thyroid hormone. Biochimie 60:809–812, 1978.

Oppenheimer JH. Thyroid hormone action at the cellular level. Science 203:971–979, 1979.

St. Germain DL. Iodothyronine deiodinases. Trends Endocrinol Metab 5:36–42, 1994.

Gereben B, Zeold A, Dentice M, Salvatore D, Bianco AC. Activation and inactivation of thyroid hormone by deiodinases: local action with general consequences. Cell Mol Life Sci 65:570–590, 2008.

Jack LJW, Kahl S, St. Germain DL, Capuco AV. Tissue distribution and regulation of 5′-deiodinase processes in lactating rats. J Endocrinol 142:205–215, 1994.

Kahl S, Jack LJW, Capuco AV. Characterization of thyroxine-5′-deiodinase in mammary tissues of the cow, sow and rat. Livest Prod Sci 35:177–178, 1993.

Aceves C, Valverde C. Type I, 5′-monodeiodinase activity in the lactating mammary gland. Endocrinology 124:2818–2820, 1989.

10.

Hernandez A, Martinez ME, Fiering S, Galton VA, St. Germain D. Type 3 deiodinase is critical for the maturation and function of the thyroid axis. J Clin Invest 116:476–484, 2006.

11.

Connor EE, Laiakis EC, Fernandes VM, Williams JL, Capuco AV. Molecular cloning, expression and radiation hybrid mapping of the bovine deiodinase type II (DIO2) and deiodinase type III (DIO3) genes. Anim Genet 36:240–243, 2005.

12.

Kahl S, Capuco AV, Bitman J. Serum concentrations of thyroid hormones and extrathyroidal thyroxine-5′-monodeiodinase activity during lactation in the rat. Proc Soc Exp Biol Med 184:144–150, 1987.

13.

Pezzi C, Accorsi PA, Vigo D, Govoni N, Gaiani R. 5′-deiodinase activity and circulating thyronines in lactating cows. J Dairy Sci 86: 152–158, 2003.

14.

Capuco AV, Kahl S, Jack LJW, Bishop JO, Wallace H. Prolactin and growth hormone stimulation of lactation in mice requires thyroid hormones. Proc Soc Exp Biol Med 221:345–351, 1999.

15.

DeGroot LJ, Nakai A, Sakurai A, Macchia E. The molecular basis of thyroid hormone action. J Endocrinol Invest 12:843–861, 1989.

16.

Yen PM. Physiological and molecular basis of thyroid hormone action. Physiol Rev 81:1097–1142, 2001.

17.

Oetting A, Yen PM. New insights into thyroid hormone action. Best Pract Res Clin Endocrinol Metab 21:193–208, 2007.

18.

Capuco AV, Ellis SE, Hale SA, Long E, Erdman RA, Zhao X, Paape MJ. Lactation persistency: insights from mammary cell proliferation studies. J Anim Sci 81 (Suppl 3):18–31, 2003.

19.

Capuco AV, Akers RM. Mammary involution in dairy animals. J Mammary Gland Biol Neoplasia 4:137–144, 1999.

20.

Capuco AV, Keys JE, Smith JJ. Somatotrophin increases thyroxine-5′-monodeidonase activity in lactating mammary tissue of the cow. J Endocrinol 121:205–211, 1989.

21.

Fukuda H, Ohshima K, Mori M, Kobayashi I, Greer MA. Sequential changes in the pituitary-thyroid axis during pregnancy and lactation in the rat. Endocrinology 107:1711–1716, 1980.

22.

Aceves C, Ruiz A, Romero C, Valverde C. Homeorhesis during early lactation. Euthyroid sick-like syndrome in lactating cows. Acta Endocrinol (Copenh) 110:505–209, 1985.

23.

Zhang CY, Kim S, Harney JW, Larsen PR. Further characterization of thyroid hormone response elements in the human type 1 iodothyronine deiodinase gene. Endocrinology 139:1156–1163, 1998.

24.

Watanabe M, Houten SM, Mataki C, Christoffolete MA, Kim BW, Sato H, Messaddeq N, Harney JW, Ezaki O, Kodama T, Schoonjans K, Bianco AC, Auwerx J. Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation. Nature 439:484–489, 2006.

25.

Thomas C, Auwerx J, Schoonjans K. Bile acids and the membrane bile acid receptor TGR5-connecting nutrition and metabolism. Thyroid 18: 167–174, 2008.

26.

Kuiper GG, Kester MH, Peeters RP, Visser TJ. Biochemical mechanisms of thyroid hormone deiodination. Thyroid 15:787–798, 2005.

27.

Hernandez A, St. Germain DL. Dexamethasone inhibits growth factor-induced type 3 deiodinase activity and mRNA expression in a cultured cell line derived from rat neonatal brown fat vascularstromal cells. Endocrinology 143:2652–2658, 2002.

28.

Van der Geyten S, Buys N, Sanders JP, Decuypere E, Visser TJ, Kuhn ER, Darras VM. Acute pretranslational regulation of type III iodothyronine deiodinase by growth hormone and dexamethasone in chicken embryos. Mol Cell Endocrinol 147:49–56, 1999.

29.

Pallud S, Ramauge M, Gavaret JM, Lennon AM, Munsch N, St. Germain DL, Pierre M, Courtin F. Regulation of type 3 iodothyronine deiodinase expression in cultured rat astrocytes: role of the Erk cascade. Endocrinology 140:2917–2923, 1999.

30.

Huang SA, Mulcahey MA, Crescenzi A, Chung M, Kim BW, Barnes C, Kuijt W, Turano H, Harney J, Larsen PR. Transforming growth factor-beta promotes inactivation of extracellular thyroid hormones via transcriptional stimulation of type 3 iodothyronine deiodinase. Mol Endocrinol 19:3126–3131, 2005.

31.

Yen PM, Ando S, Feng X, Liu Y, Maruvada P, Xia X. Thyroid hormone action at the cellular, genomic and target gene levels. Mol Cell Endocrinol 246:121–127, 2006.

32.

Yen PM, Sunday ME, Darling DS, Chin WW. Isoform-specific thyroid hormone receptor antibodies detect multiple thyroid hormone receptors in rat and human pituitaries. Endocrinology 130:1539–1546, 1992.

33.

Hodin RA, Lazar MA, Wintman BI, Darling DS, Koenig RJ, Larsen PR, Moore DD, Chin WW. Identification of a thyroid hormone receptor that is pituitary-specific. Science 244:76–79, 1989.

34.

Anguiano B, Rojas-Huidobro R, Delgado G, Aceves C. Has the mammary gland a protective mechanism against overexposure to triiodothyronine during the peripartum period? The prolactin pulse down-regulates mammary type I deiodinase responsiveness to nor-epinephrine. J Endocrinol 183:267–277, 2004.

35.

Toyoda N, Zavacki AM, Maia AL, Harney JW, Larsen PR. A novel retinoid X receptor-independent thyroid hormone response element is present in the human type 1 deiodinase gene. Mol Cell Biol 15:5100–5112, 1995.