Down-regulation of long non-coding RNA ANRIL inhibits the proliferation,migration and invasion of cervical cancer cells

Abstract

OBJECTIVES:

Cervical cancer (CC) is a common malignant tumor in the female reproductive system that is characterized by a high metastatic potential. LncRNA ANRIL has been found to be a cancer oncogene in multiple tumors. In our study, we altered the expression of ANRIL in CC cells and evaluated its ability on influencing proliferation, migration and invasion of CC cells and associated mechanism.

METHODS:

Differentially expressed lncRNAs in CC were identified by microarray and TCGA analyses. CC tissues and adjacent tissues were collected in order to extract CC cells. The expression of ANRIL was determined by RT-qPCR. The CC cells were transfected with siRNA or si-NC against ANRIL to find out whether ANRIL can influence the expression of Cyclin D1, CDK4, CDK6, E-cadherin, vimentin and N-cadherin, as well as affect cell proliferation, cell apoptosis, cell migration and cell invasion of CC cells.

RESULTS:

Based on TCGA and microarray analyses, ANRIL was predicted to be highly expressed in CC and CC with migration. Then further verification was obtained by means of RT-qPCR that ANRIL was highly expressed in CC tissues. In addition, high expression of ANRIL was related to increased E-cadherin expression, high migration of CC as well as decreased cell apoptosis rate. On the other hand, inhibition of ANRIL expression led to decreased expressions of Cyclin D1, CDK4, CDK6, N-cadherin and Vimentin, along with attenuated cell proliferation, migration and invasion of CC cells.

CONCLUSION:

The key findings of our study demonstrated that the inhibition of lncRNA ANRIL reduces the proliferation, migration and invasion capabilities of CC cells. Down-regulation of ANRIL may serve as a potential therapeutic target in the treatment of CC.

Keywords

Long non-coding RNA ANRIL cervical cancer proliferation migration invasion

1. Introduction

Cervical cancer (CC) is the second leading cancer occurring in women. Its incidence is high in developing countries with approximately 500,000 patients diagnosed and 280,000 deaths each year. It is mainly linked to a human papillomavirus (HPV) infection whereby the fusion of its DNA with the host genome has been linked to the occurrence of CC [1, 2]. There are many causes of CC, this includes: genetic susceptibility, viral infections such as HPV, smoking, oral contraceptives and environmental factors [3, 4, 5, 6]. Up until now, the mechanism of how HPV infections can contribute to the progression of CC is not fully understood. Metastases of CC outside or the progression to a late stage with poor responses to treatments generally result in unfavorable prognosis of patients with CC [7]. Despite treatment approaches such as surgery, chemotherapy and radiotherapy in treating patients with CC, the 5-year survival rate of patients with advanced CC is still very low [8].

Long non-coding RNAs (lncRNAs) are generally defined as genomic transcriptions longer than 200 nucleotides (nt) in length that are not translated into protein. Their lack of function in protein coding is due to a lack of an open significant reading frame length [9]. A previous study demonstrated that lncRNAs played a crucial role in a variety of cellular processes by interacting with some key component proteins during gene regulation. The changes in tissue-specific and cell-specific expression as well as primary or secondary structures were thought to influence cell proliferation, metastasis and invasion [10]. In addition, there has been growing evidence which revealed that dysregulated expressions of lncRNAs were implicated in various types of cancers including gastric cancer, breast cancer, lung cancer and CC [11, 12, 13, 14]. LncRNA ANRIL has been found to encode a kind of 3834-nt RNA which contains 19 exons located in the antisense direction of the INK4B-ARF-INK4A gene cluster that is usually upregulated in nasopharyngeal carcinoma [15]. Previous evidence has also proved that lncRNA ANRIL expression was increased in GC which was correlated with advanced TNM stage and tumor size. In addition, further experiments have been done to reveal that inhibition of ANRIL expression significantly suppressed cancer cell proliferation [16]. Thus, it can be seen that a lot of data support lncRNA ANRIL’s key role in cancer progression. However, the expression of levels of lncRNA ANRIL in CC and the underlying mechanism have yet to be discovered. Therefore, this study aims to investigate the effects of lncRNA ANRIL expression levels on the proliferation, migration and invasion of CC cells.

2. Materials and methods

2.1 Microarray and statistical analysis

CC microarray profiles (GSE26511) and probe annotation from the Gene Expression Omnibus (GEO) database from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/geo) were detected using Affymetrix Human Genome U133 Plus 2.0 Array. The datasets were processed with background correction and normalization using an Affy package in R software [17]. Differentially expressed lncRNAs were screened out from the profiles using a lineal model-empirical Bayes statistics combined with a $t$ test using the Limma package. The expression of CC was then downloaded from the TCGA (http://cancergenome.nih.gov/) database. Statistical analysis was conducted using a R software. Differential analysis was carried out on transcriptome profiling data with package edgeR of R [18]. A false positive discovery (FDR) correction was applied on $p$ -value with package multitest. FDR $<$ 0.05 and | log2 (fold change) | $>$ 2 were set as the threshold to screen out differentially expressed genes (DEGs).

2.2 Ethics statement

The study was approved by the Ethics Committee of The First Affiliated Hospital of Henan university of Chinese Medicine. All participating patients have understood experimental procedures and signed the informed consents.

2.3 Study subject selection

From November 12, 2011 to February 15, 2016, 277 CC patients (aged between 18 to 75 years, median age of 46 years) diagnosed with cervical cancer in The First Affiliated Hospital of Henan university of Chinese Medicine were selected for this study. Patients with CC were divided into T ${}_{1}$ $+$ T ${}_{2}$ phase and T ${}_{3}$ $+$ T ${}_{4}$ phase based on the standard TNM staging criteria [19]. All participating patients have not received a local or systemic form of therapy prior to surgery. CC tissue and noncancerous specimens of patients were resected during surgery. Cells were then extracted from tissues for subsequent experiments. All tissue samples were frozen with liquid nitrogen after resection and stored at $-$ 80 ${{}^{\circ}}$ C for later use.

2.4 Cell extraction

Resected CC tissues were cut into small pieces and then detached with 1% trypsin (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China). After incubation for 30 minutes, serum was added to terminate the reaction. A suction pipette was used to resuspend CC tissues. A Cytoscreener with an aperture of 70 $\mu$ M was used to filter large undigested mass. After centrifugation, the precipitate was obtained and the cells were cultured. The culturing mixture included: cancer cells, fibroblast and other cells. A time difference enzyme digestion was used to separate and purify CC cells. The procedure was conducted by mixing the medium with culture dish. Cells were then were washed with phosphate buffer saline (PBS) twice, treated with trypsin and observed under a microscope for 60 seconds. Fibroblasts were removed from the bottom of culture dish while leaving the CC cells adherent to wall, followed by 2 mL medium neutralization and an addition of culture medium for further culture. The above procedure was repeated. Cell passaging protocol was similar to the previously described procedure in order to obtain purified CC cells. Finally, the morphology of cells was observed under a microscope [20].

2.5 Cell transfection and culture

CC cells were initially inoculated in 100 mL/L 1640 medium containing fetal bovine serum (FBS). Cells were then incubated at 37 ${{}^{\circ}}$ C with CO ${}_{2}$ and 50 mL/L medium. Some of the cells were obtained and inoculated in a 25 mm ${}^{2}$ culture dish. When cells reached 80% confluency, the synthetic ANRIL-siRNAs and negative control si-NC sequences (Suzhou GenePharma Co., Ltd., Suzhou, China) were transfected into CC cells by Lipofectamine 2000 (Takara Biotechnology Ltd., Dalian, China) according to the instructions provided by the liposome reagent kit. Next, 250 $\mu$ L serum-free Opti-MEM was used to dilute 100 pmol siRNAs and si-NC, to obtain a final concentration of 50 nM, which was then added to the cells. Cells were transfected at a concentration of 1 $\times$ 10 ${}^{5}$ and incubated at room temperature for 5 minutes. Next, 250 $\mu$ L serum-free Opti-MEM was used to dilute 5 $\mu$ L lipofectamine 2000, evenly mixed and incubated at room temperature for 5 minutes. The above two samples were treated with equal mixture amounts and incubated at room temperature for 20 minutes. Subsequently, 500 $\mu$ L transfection solution was then added to each well for a 48-hour transfection period followed by collection of cell solution for use in follow-up experiments. After transfection, the cells were assigned as the ANRIL-siRNA group and the ANRIL-NC group respectively. The sequence of ANRIL-siRNAs was AAGCGAGGUCAUUCUCAAUUUGCCUCCUAU [21].

2.6 RNA extraction and reverse-transcription quantitative polymerase chain reaction (RT-qPCR)

RNA extraction was performed on ice. RNA extraction from tissue was as follows: 15 random samples of CC and adjacent tissues were selected and cut into small pieces and grounded into fine powder in liquid nitrogen. In the next step, we used spoon pre-cooled by liquid nitrogen to add 50 to 100 mg of tissue powder to a 1 mL Trizol eppendorf (EP) tube. Cell RNA pretreatment was performed as follows: the medium in 6-well plates was aspirated and removed, then washed with PBS twice. Next, 1 mL of Trizol (Invitrogen Inc., Carlsbad, CA, USA) was then added into each well. Cells were scraped repeatedly using a pipette tip and transferred into 1.5 mL EP tubes.

Total RNA of cells or tissues was exacted using Trizol. When extracting, DNase I (TransGen Biotech Co., Ltd., Beijing, China) was added in order to remove genomic contamination. A reverse transcription kit (Takara Biotechnology Ltd., Dalian, China) was used to reverse transcribe RNA into cDNA, which was used as a template for RT-qPCR amplification. The reaction was performed on ordinary PCR amplification instrument (Bio-Rad Laboratories, Inc., CA, USA). The PCR instrument collected fluorescence signal by preheating at 95 ${{}^{\circ}}$ C for 5 minutes, 40 cycles of at 95 ${{}^{\circ}}$ C for 15 seconds, 56 ${{}^{\circ}}$ C for 30 seconds and 72 ${{}^{\circ}}$ C for 30 seconds. PCR products were detected by 1.5% agarose gel electrophoresis, using a voltage of 60 V for 60 minutes. SYBR GREEN dyes (TIANGEN Biotechnology Co., Ltd., Beijing, China) were used for RT-qPCR analysis in order to detect ANRIL expression. The results were normalized using the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primer sequences for the PCR of ANRIL and GAPDH are shown in Table 1.

Table 1
Primer sequences for reverse-transcription quantitative polymerase chain reaction

Gene	Primer sequence
ANRIL	F: 5’-TTGAGGCCTTTGCAGCTTTC-3’
	R: 5’-GGTTCTGCCACAGCTTTGATC-3’
GAPDH	F: 5’-CTCCTCCTGTTCGACAGTCAGC-3’
	R: 5’-CCCAATACGACCAAATCCGTT-3’

Notes: F, forward; R, reverse; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

2.7 Western blot analysis

The total protein from CC cells was lysed using RIPA cell lysate (BB-3209, Bestbio Biological, Shanghai, China), followed by electrophoretic separation with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After separation, the samples were transferred onto a polyvinylidene fluoride (PVDF) membrane using a voltage of 80 V. The membrane was sealed for 1 hour and incubated overnight at 4 ${{}^{\circ}}$ C along with the addition of the following primary rabbit polyclonal antibodies: Cyclin D1 (1:500, ab226977), CDK4 (1:2000, ab226474), CDK6 (1:500, ab151247), E-cadherin (1:500, ab15148), Vimentin (1:1000, ab137321) and N-cadherin (1:1000, ab76057). The antibodies used were all purchased from Abcam Inc. (Cambridge, MA, USA). The membrane was then incubated at 37 ${{}^{\circ}}$ C for 1 hour with goat anti-rabbit IgG secondary antibody (1:1000, A21020, Abbkine, USA), rinsed thrice with PBS at room temperature (5 min each time) and colorized. The relative levels of target proteins corresponded to the protein band intensity along with the gray value of the internal reference band (GAPDH). The experiment was repeated 3 times.

2.8 Cell Counting Kit-8 (CCK-8) assay

After transfection for 48 hours, cells were then seeded in a 96-well plate at a density of 2 $\times$ 10 ${}^{3}$ /100 $\mu$ L. The cells counted by a CCK-8 assay after culturing for 24 hours, 48 hours, 72 hours and 84 hours respectively. The serum free medium was replaced followed by the addition of 10 $\mu$ L CCK-8 into each well which was left to culture for another 2 hours with 5% CO ${}_{2}$ at 37 ${{}^{\circ}}$ C during detection. The optical density (OD) value was measured at 490 nm. Each culture was set up in a quintuplicate manner.

2.9 Flow cytometry

After transfection for 48 hours, CC cells were incubated, centrifuged at 800 r/min for 5 minutes (centrifugal radius was 15 cm) and washed twice with ice-cold PBS. According to the instructions provided by the Annexin-V-FITC cell apoptosis detection kit (K201-100, Biovision, Moutain View, CA, USA), cells were resuspended after the addition of 200 $\mu$ L binding buffer, and stained with 10 $\mu$ L PI and 5 $\mu$ L Annexin V-FITC. Cells were left to incubate at room temperature for 15 min in a dark room. The cell survival rate was measured at 488 nm using flow cytometry (Biosciences, San Jose, CA, USA). The experiment was repeated 3 times.

2.10 Scratch test

The cells in each group were seeded in 6-well plates and transfected when the cells reached 50% confluence. Forty-eight hours after transfection, culture solution was replaced and cells were cultured for another two days until cells reached adequate confluence. A vertical scratch was made in the cell culture surface using a 100 $\mu$ L pipette tip. The cells were rinsed with PBS thrice and the culture medium was changed. The time of scratch was made at 0 h. Subsequent images were acquired and the scratch distance was measured every 12 hours. Some cells treated with 24-h and 36-h transfection were selected.

2.11 Transwell assay

Serum free medium (300 $\mu$ L) was added into a Transwell chamber (Millipore, Bedford, Ma, USA) and removed 30 minutes after. Serum free medium and matrix gel (Sigma-Aldrich Chemical Company, Louis, Missouri, USA) were diluted in a 1:5 ratio. Next, 100 $\mu$ L dilute solution was added to each chamber and left to rest at 37 ${{}^{\circ}}$ C for 30 minutes to allow the glue to solidify. After transfection for 24 hours, the cells were centrifuged for one minute at 1000 g, removing the supernatant and collecting the cells thereafter. Cells were then resuspended in serum free medium. Subsequently, 3 $\times$ 10 ${}^{5}$ cells were then transferred into each chamber; 600 $\mu$ L medium containing 10% FBS was added into the basolateral chamber and left to culture at 37 ${{}^{\circ}}$ C with 5% CO ${}_{2}$ for 48 hours, discarding the culture solution after. Cells were rinsed with PBS twice and fixed with 90% ethanol for 30 minutes, which was removed later. After being rinsed with PBS twice and dyed for 30 minutes, the cells that did not migrate in the upper chamber were wiped off gently using a cotton swab and observed under an Olympus inverted microscope ( $\times$ 400) (Olympus Optical Co., Ltd., Tokyo, Japan). Five visual fields were randomly selected and the cells were counted and images were acquired.

2.12 Statistical analysis

All data was analyzed statistically using an SPSS 20.0 software (IBM Corp. Armonk, NY, USA). Results are expressed as a mean $\pm$ standard deviation. Differences between groups were compared by $t$ test. Values of $p<$ 0.05 were considered significant.

Figure 1.

Based on TCGA and microarray analysis, ANRIL is predicted to be highly expressed in CC and CC with metastasis. Panel A, LncRNA ANRIL is highly expressed in CC metastasis by using a GSE26511 chip data; Panel B, ANRIL is highly expressed in CC according to the TCGA database. The abscissa refers to the sample number, and the ordinate refers to names of DEGs. The upper right histogram refers to color shades. The color change from the top to the bottom corresponds to a change in expression from high to low. Each block represents the level of gene expression in one sample, and each column represents the expression of all genes in samples. The left dendrogram refers to the cluster analysis results of different genes in different samples. The transverse line at the top represents the types of samples, and the upper right square represents the sample color reference: the blue refers to the metastasis group and the red refers to the non-metastasis group.

3. Results

3.1 ANRIL is predicted to be highly expressed in CC

In recent years, lncRNAs have been shown to play important roles in tumor biological function in CC. In order to identify differentially expressed lncRNAs in CC, we performed a comprehensive lncRNA profiling analysis that was made available from the GEO database of the NCBI. Through CC microarray analysis (GSE26511), the expression of lncRNA ANRIL was found to be elevated in CC with cell migratory features (Fig. 1A); based on the TCGA database, ANRIL was highly expressed in CC (Fig. 1B).

Table 2
Relationship between clinicopathological characteristics and CC metastasis

Clinicopathological	Metastasis	Non-	$p$
characteristics		metastasis
Age (years)
$<$ 40	79	65	0.997
$\geqslant$ 40	73	60
TNM stage
T ${}_{1}$ $+$ T ${}_{2}$	58	74	0.001
T ${}_{3}$ $+$ T ${}_{4}$	94	51
Differentiation degree
High	43	52	0.01
Moderate	45	41
Low	64	32
Pathological classification
Squamous cell carcinoma	97	62	0.017
Adenocarcinoma	55	63
Initial sexual behavior time (years)
$\leqslant$ 20	62	32	0.029
21–25	42	44
$\geqslant$ 26	48	49
Myometrial invasion depth
$\geqslant$ 1/2	87	55	0.028
$\leqslant$ 1/2	65	70
Vessel invasion
Yes	84	53	0.033
No	68	72
ANRIL	5.48 $\pm$ 0.41	2.25 $\pm$ 0.19	$<$ 0.001

Note: CC, cervical cancer; TNM, tumor-node-metastasis.

3.2 Clinicopathological characteristics and ANRIL expression are correlated with cell metastasis in CC

Initially, relations of CC and age, TNM stage, differentiation degree, pathological classification, initial sexual behavior time, myometrial invasion depth, vessel invasion and ANRIL expression were assessed (Table 2). The results indicated that there was no significant difference in age between the metastatic and non-metastatic groups ( $p>$ 0.05). This indicated that age was not a significant factor for CC metastasis. However, TNM stage, differentiation degree, pathological classification, initial sexual behavior time, myometrial invasion depth, vessel invasion and ANRIL expression were all significantly different in the metastasis compared to the non-metastasis group ( $p<$ 0.05). This suggests that advanced TNM stage, lower differentiation degree, a myometrial invasion depth of $\geqslant$ 1/2, earlier initial sexual behavior time, vessel invasion, presence of squamous cell carcinoma and higher expression of ANRIL resulted in a higher degree of CC metastasis.

Figure 2.

RT-qPCR shows that there is high expression of ANRIL in CC tissues. ANRIL mRNA expression in T1 $+$ T2 and T3 $+$ T4 stages in CC and adjacent tissues detected by RT-qPCR; statistical values are expressed as a mean $\pm$ standard deviation analyzed by one-way ANOVA; 30 pairs of CC and adjacent tissues were used in each group; #, $p<$ 0.05 vs. adjacent tissues; the experiment was repeated 3 times; RT-qPCR, reverse-transcription quantitative polymerase chain reaction; CC, cervical cancer.

3.3 ANRIL is highly expressed in CC tissues

The expression of ANRIL in CC tissues and adjacent tissues at different TNM stages was measured by RT-qPCR. The results are shown in Fig. 2. The ANRIL expression in CC tissues was significantly higher in both T1 $+$ T2 stage and T3 $+$ T4 stage compared with adjacent tissues ( $p<$ 0.05). The results demonstrated that ANRIL is highly expressed in CC tissues compared with that in adjacent tissues.

Figure 3.

siRNA lowers ANRIL expression and the inhibition of ANRIL hinders CC cell proliferation. Panel A, after ANRIL silencing for 48 hours, ANRIL mRNA expression was detected by RT-qPCR; Panel B, cell proliferation in each time point at 48 hours after transfection was measured by CCK-8 assay; Panel C, protein bands of Cyclin D1, CDK4 and CDK6 at 48 hours after transfection; Panel D, protein levels of Cyclin D1, CDK4 and CDK6 48 hours after transfection; Statistical values are expressed as mean $\pm$ standard deviation and data was analyzed by one-way ANOVA; #, $p<$ 0.05 vs. the control and ANRIL-NC groups; the experiment was repeated 5 times.

3.4 Inhibition of ANRIL suppressed proliferation of CC cells

In the next step, we used RNA interference technology to conduct ANRIL silencing. After cellular transfection of ANRIL-siRNA and ANRIL-NC, ANRIL mRNA expression in each group was detected using RT-qPCR. As shown in Fig. 3A, ANRIL mRNA expression was significantly lower in the ANRIL-siRNA group compared with the control group ( $p<$ 0.05). This suggests that siRNA silencing can reduce ANRIL expression.

CCK8 assay was used to determine the effect of ANRIL on proliferation of CC cells. The results are shown in Fig. 3B. As time progressed, all three groups showed increased trend in proliferation of CC cells. At 24 hours, the ANRIL-siRNA group showed a lower OD value compared to the control and ANRIL-NC groups ( $p<$ 0.05). At 48 hours, 72 hours and 84 hours, the difference among the ANRIL-siRNA group and the control and ANRIL-NC groups increased significantly along with the increase of duration ( $p<$ 0.05) and the OD ${}_{450}$ was significantly low, which indicated the inhibition of ANRIL suppressed cell proliferation in CC cells. Additionally, we used Western blot analysis to detect expressions of Cyclin D1, CDK4 and CDK6 after silencing of ANRIL (Fig. 3C and D). In comparison with the control and ANRIL-NC groups, the expressions of Cyclin D1, CDK4 and CDK6 at 48 hours were significantly lower in the ANRIL-siRNA group ( $p<$ 0.05). Therefore, we can conclude that ANRIL silencing may decrease expressions of Cyclin D1, CDK4 and CDK6.

3.5 Inhibition of ANRIL increases cell apoptosis

We used flow cytometry to determine the effects of ANRIL silencing on CC cell apoptosis. Results showed that the cell apoptotic rate was higher in the ANRIL-siRNA group compared with that in the control and ANRIL-NC groups ( $p<$ 0.05) (Fig. 4). This further support that ANRIL silencing can accelerate cell apoptosis

Figure 4.

Flow cytometry analysis shows that the cell apoptotic rate increased as a response to the inhibition of ANRIL. Panel A, apoptosis of CC cells after transfection for 48 hours; Panel B, apoptotic rate of CC cells after transfection for 48 hours; Statistical values are expressed as mean $\pm$ standard deviation and compared with one-way ANOVA; #, $p<$ 0.05 vs. the control and ANRIL-NC groups; the experiment was repeated 5 times.

Figure 5.

Detection by Scratch test and western blot analysis demonstrates that cell migration of CC cells was suppressed after ANRIL inhibition. Panel A, Scratch test results in each group after transfection for 48 hours; Panel B, comparisons of scratch distance in each group after transfection for 48 hours; Panel C and D, protein levels of E-cadherin, vimentin and N-cadherin were detected by western blot analysis after transfection for 48 hours; statistical values are expressed as mean $\pm$ standard deviation and compared with one-way ANOVA; #, $p<$ 0.05 vs. the control and ANRIL-NC groups; the experiment was repeated 3 times.

Figure 6.

Inhibition of ANRIL attenuates cell invasion in CC cells, based on the Transwell assay. #, $p<$ 0.05 vs. the NC group; Panel A, cell invasion after transfection for 48 hours was detected by Transwell assay ( $\times$ 200); Panel B, the number of cell invasion after transfection for 48 hours; statistical values are expressed as mean $\pm$ standard deviation and compared with one-way ANOVA; #, $p<$ 0.05 vs. the ANRIL-NC group; the experiment was repeated 3 times; CC, cervical cancer.

3.6 Inhibition of ANRIL dampens migration of CC cells

To determine the effect of ANRIL on the migration of CC cells, a scratch test was performed. The results are shown in Fig. 5A and B. There was no significant difference in the cell scratch distance among the three groups ( $p>$ 0.05). At 24 hours, the cell scratch distance in the ANRIL-siRNA group was significantly larger compared with the ANRIL-NC and control groups ( $p<$ 0.05). At 36 hours, the cell scratch distance in the ANRIL-NC and control groups was close to 0, while compared with the ANRIL-NC and control groups, cell scratch distance in the ANRIL-siRNA group was significantly larger ( $p<$ 0.05). The results demonstrate that the inhibition of ANRIL suppressed the cell migration potential of CC cells. We also performed western blot analysis to detect the protein levels of E-cadherin, vimentin and N-cadherin. As shown in Fig. 5C, the E-cadherin protein level was significantly higher yet N-cadherin and Vimentin protein levels were lower in the ANRIL-siRNA group than in the control and ANRIL-NC groups ( $p<$ 0.05). It can be concluded that ANRIL silencing can lower N-cadherin and Vimentin yet elevate E-cadherin in CC.

3.7 Inhibition of ANRIL dampens invasion of CC cells

Finally, the Transwell assay was used to evaluate the extent of cell invasion of CC cells via inhibition of ANRIL. The results are shown in Fig. 6. Compared with the ANRIL-NC and control groups, the number of cells passing through the micropore membrane covered by Matrigel was significantly less in the ANRIL-siRNA group ( $p<$ 0.05). The results showed that the number of cells passing through micropore was higher (118.4 $\pm$ 12.6) in the ANRIL-NC group, compared to the control group (106.8 $\pm$ 10.2) and the ANRIL-siRNA group (83.5 $\pm$ 9.6). Compared with the ANRIL-NC and control groups, the number of cells passing through micropore was significantly less in the ANRIL-siRNA group ( $p<$ 0.05). These results strongly imply that the inhibition of ANRIL suppressed the invasion of CC cells.

4. Discussion

Over the past few years, there have been an increasing amount of studies that investigate the different types of LncRNAs. These include PVT1, MEG3, CCAT2 and many others which play indispensable roles in inhibiting CC. Due to their role in tumor suppressing, LncRNAs have been widely studied and if properly developed, they may be used as a therapeutic target and biomarkers for treating CC [22, 23, 24]. LncRNA ANRIL was reported to contribute to tumor progression in various cancers, however, its function and expression in CC still remain unclear [25]. Therefore, we initially aimed to further investigate the effects of lncRNA ANRIL on the proliferation, migration and invasion of CC cells in this study. Our results demonstrated that the inhibition of lncRNA ANRIL could effectively suppress the proliferation, migration and invasion of CC cells.

Our study found that a higher degree of CC metastasis was found to be associated with advanced TNM stage, poor differentiation, myometrial invasion depth at $\geqslant$ 1/2, earlier initial sexual behavior time, vessel invasion, squamous cell carcinoma and higher expression of ANRIL. Common disease genome wide association studies showed that the ANRIL gene acted as a genetic susceptibility locus shared that is associated with intracranial aneurysm, type 2 diabetes, coronary disease and cancer [26]. It was reported that the abnormal expression of other lncRNAs was used as a prognostic indicator for patients with cancer. Many lncRNAs have been involved in many tumor progressions, for instance, increased HOX transcript antisense RNA (HOTAIR) expression could promote metastasis of cancer cells [16]. Thus, we concluded that the enhanced expression of ANRIL may promote metastasis of CC cells.

Additionally, in our study, overexpression of lncRNA ANRIL was observed in CC cell lines and clinical specimens suggesting that ANRIL expression in CC tissues was significantly higher than those in adjacent tissues. A previous study revealed that higher expression of lncRNA ANRIL in cancer tissues was correlated with advanced TNM stage and low histologic grade [27]. Decreased expression of lncRNA LET inhibited CC, further supporting the notion that lncRNAs can function as a tumor suppressor [28]. Furthermore, higher expression of ANRIL in human cancer tissues was related to lower survival rates of the patients [29]. For these reasons, we inferred that the regulation of lncRNA ANRIL in CC cells and tissues could be a therapeutic target and a promising biomarker for the treatment of CC.

In order to study the effects of lncRNA ANRIL on CC progression, we observed the proliferation, migration and invasion capabilities of CC cells before and after inhibiting lncRNA ANRIL expression. Surprisingly, our study found that cells transfected with ANRIL-siRNA showed significantly reduced CC cell proliferation, migration and invasion compared with the cells transfected with negative controls and normal CC cells. A previous study demonstrated that the suppression of lncRNA ANRIL was carried out using siRNAs to target and inhibit lncRNA ANRIL [26]. According to a previous study, the knockdown of ANRIL inhibited proliferation, metastasis and invasion of colorectal cancer cells [29]. For these reasons, we speculate that a similar mechanism can be identified in CC in addition to colorectal whereby lncRNA ANRIL could act as a regulator. In addition, ANRIL knockdown led to an increase in E-cadherin expression, decrease N-cadherin, Vimentin, Cyclin D1, CDK4 and CDK6 expressions. E-cadherin is a tumor suppressor gene that plays a critical role in the malignant progression of epithelial tumors and inhibits epithelial to mesenchymal transition [30]. E-cadherin expression has been found to be down-regulated in CC whereby lncRNA-EBIC which is an oncogenic lncRNA, could promote tumor cell invasion in CC by inhibiting E-cadherin expression [31]. Vimentin is a type III intermediate filament that has been found to be implicated in various biological processes including maintaining cell shape and stabilizing cytoskeletal interactions. It has been designated as a methylation biomarker for early diagnosis of CC [32]. The p16 (INK4A) tumor suppressor is a critical KDM6B downstream transcriptional target and its expression is critical for CC cell survival. Oncogenic p16 activity depends on the regulation of CDK4/CDK6, suggesting that in CC cells with an inactivated retinoblastoma tumor suppressor, CDK4/CDK6 activity needs to be inhibited in order for cells to survive [33]. Furthermore, an exogenous epidermal growth factor (EGF) stimulation may enhance human papillomavirus (HPV)-related CC cell proliferation by activating Cyclin D1 that is independent of COX-2 levels, suggesting that the inhibitors of Cyclin D1 may be effective against CC cell proliferation [34].

Consequently, lncRNA ANRIL was highly express-ed in CC and participated in the regulation of migration, proliferation and invasion of CC cells. Our study provides evidence that the inhibition of lncRNA ANRIL could suppresses cell proliferation, migration and invasion of CC cells. The development of treatment strategies using ANRIL to down-regulation of lncRNAs can provide a promising and novel therapeutic target treating patients with CC. However, there are several important issues that have yet to be explored as well as the limitations of this study. Despite our findings, the specific mechanisms of ANRIL including its signal pathway and influencing factors still remain unclear. Therefore, further research needs to be carried out in order for us to proceed to discovering therapeutic strategies using lncRNAs.

Footnotes

Acknowledgments

We would like to acknowledge the reviewers for their helpful comments on this paper.

Conflict of interest

None.

References

Peralta-Zaragoza

Deas

Meneses-Acosta

et al., Relevance of miR-21 in regulation of tumor suppressor gene PTEN in human cervical cancer cells, BMC Cancer 16 (2016), 215.

Kong

Hao

Wang

et al., Regulation of p53 expression and apoptosis by vault RNA2-1-5p in cervical cancer cells, Oncotarget 6(29) (2015), 28371–28388.

Zhang

Lei

et al., C14ORF166 overexpression is associated with pelvic lymph node metastasis and poor prognosis in uterine cervical cancer, Tumour Biol 37(1) (2016), 369–379.

Luhn

Walker

Schiffman

et al., The role of co-factors in the progression from human papillomavirus infection to cervical cancer, Gynecol Oncol 128(2) (2013), 265–270.

Remschmidt

Kaufmann

A.M.

Hagemann

et al., Risk factors for cervical human papillomavirus infection and high-grade intraepithelial lesion in women aged 20 to 31 years in Germany, Int J Gynecol Cancer 23(3) (2013), 519–526.

Gadducci

Barsotti

Cosio

et al., Smoking habit, immune suppression, oral contraceptive use, and hormone replacement therapy use and cervical carcinogenesis: a review of the literature, Gynecol Endocrinol 27(8) (2011), 597–604.

Tsai

J.P.

Lee

C.H.

Ying

T.H.

et al., Licochalcone A induces autophagy through PI3K/Akt/mTOR inactivation and autophagy suppression enhances Licochalcone A-induced apoptosis of human cervical cancer cells, Oncotarget 6(30) (2015), 28851–28866.

Fan

Cui

et al., MiR-125a suppresses tumor growth, invasion and metastasis in cervical cancer by targeting STAT3, Oncotarget 6(28) (2015), 25266–25280.

Xiang

Guo

Jiang

et al., Silencing of Long Non-Coding RNA MALAT1 Promotes Apoptosis of Glioma Cells, J Korean Med Sci 31(5) (2016), 688–694.

10.

Maruyama

and Suzuki

, Long noncoding RNA involvement in cancer, BMB Rep 45(11) (2012), 604–611.

11.

Huang

Y.K.

and Yu

J.C.

, Circulating microRNAs and long non-coding RNAs in gastric cancer diagnosis: An update and review, World J Gastroenterol 21(34) (2015), 9863–9886.

12.

Paci

Colombo

and Farina

, Computational analysis identifies a sponge interaction network between long non-coding RNAs and messenger RNAs in human breast cancer, BMC Syst Biol 8 (2014), 83.

13.

Chen

Wang

Zhang

et al., Long non-coding RNAs in non-small cell lung cancer as biomarkers and therapeutic targets, J Cell Mol Med 18(12) (2014), 2425–2436.

14.

Shang

Zhu

Liu

et al., Characterization of long non-coding RNA expression profiles in lymph node metastasis of early-stage cervical cancer, Oncol Rep 35(6) (2016), 3185–3197.

15.

Zou

Z.W.

Medoro

et al., LncRNA ANRIL is up-regulated in nasopharyngeal carcinoma and promotes the cancer progression via increasing proliferation, reprograming cell glucose metabolism and inducing side-population stem-like cancer cells, Oncotarget 7(38) (2016), 61741–61754.

16.

Liu

X.H.

Liu

Z.L.

Sun

et al., The long non-coding RNA HOTAIR indicates a poor prognosis and promotes metastasis in non-small cell lung cancer, BMC Cancer 13 (2013), 464.

17.

Fujita

Sato

J.R.

Rodrigues Lde

et al., Evaluating different methods of microarray data normalization, BMC Bioinformatics 7 (2006), 469.

18.

Robinson

M.D.

McCarthy

D.J.

and Smyth

G.K.

, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data, Bioinformatics 26(1) (2010), 139–140.

19.

Trinh

T.A.

Park

S.C.

et al., Preventive Effect and Safety of a Follicle Stimulating Hormone Inhibitory Formulation Containing a Mixture of Coicis Semen and Artemisia capillaris for Precocious Puberty: A Preliminary Experimental Study Using Female Rats, Evid Based Complement Alternat Med 2017 (2017), 2906014.

20.

Yang

Rosen

D.G.

Liu

et al., CXCR2 promotes ovarian cancer growth through dysregulated cell cycle, diminished apoptosis, and enhanced angiogenesis, Clin Cancer Res 16(15) (2010), 3875–3886.

21.

Naemura

Murasaki

Inoue

et al., Long Noncoding RNA ANRIL Regulates Proliferation of Non-small Cell Lung Cancer and Cervical Cancer Cells, Anticancer Res 35(10) (2015), 5377–5382.

22.

Zhang

Leong

D.J.

et al., Curcumin slows osteoarthritis progression and relieves osteoarthritis-associated pain symptoms in a post-traumatic osteoarthritis mouse model, Arthritis Res Ther 18(1) (2016), 128.

23.

Zhang

Yao

Wang

et al., Long noncoding RNA MEG3 is downregulated in cervical cancer and affects cell proliferation and apoptosis by regulating miR-21, Cancer Biol Ther 17(1) (2016), 104–113.

24.

Jin

Zhang

et al., Roles of Long Non-Coding RNA CCAT2 in Cervical Cancer Cell Growth and Apoptosis, Med Sci Monit 22 (2016), 875–879.

25.

Zhang

Sun

Zhang

et al., Long non-coding RNA ANRIL indicates a poor prognosis of cervical cancer and promotes carcinogenesis via PI3K/Akt pathways, Biomed Pharmacother 85 (2017), 511–516.

26.

Lin

Z.T.

Chen

W.H.

et al., Increased expression of the long non-coding RNA ANRIL promotes lung cancer cell metastasis and correlates with poor prognosis, Diagn Pathol 10 (2015), 14.

27.

Hua

Wang

C.Y.

Yao

K.H.

et al., High expression of long non-coding RNA ANRIL is associated with poor prognosis in hepatocellular carcinoma, Int J Clin Exp Pathol 8(3) (2015), 3076–3082.

28.

Jiang

Wang

H.L.

and Yang

, Low expression of long non-coding RNA LET inhibits carcinogenesis of cervical cancer, Int J Clin Exp Pathol 8(1) (2015), 806–811.

29.

Sun

Zheng

Z.P.

et al., ANRIL is associated with the survival rate of patients with colorectal cancer, and affects cell migration and invasion in vitro , Mol Med Rep 14(2) (2016), 1714–1720.

30.

Larue

and Bellacosa

, Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3’ kinase/AKT pathways, Oncogene 24(50) (2005), 7443–7454.

31.

Sun

N.X.

Zhao

et al., Long noncoding RNA-EBIC promotes tumor cell invasion by binding to EZH2 and repressing E-cadherin in cervical cancer, PLoS One 9(7) (2014), e100340.

32.

Jung

Kim

et al., The role of vimentin as a methylation biomarker for early diagnosis of cervical cancer, Mol Cells 31(5) (2011), 405–411.

33.

McLaughlin-Drubin

M.E.

Park

and Munger

, Tumor suppressor p16INK4A is necessary for survival of cervical carcinoma cell lines, Proc Natl Acad Sci U S A 110(40) (2013), 16175–16180.

34.

Narayanan

Kim

H.N.

Narayanan

N.K.

et al., Epidermal growth factor-stimulated human cervical cancer cell growth is associated with EGFR and cyclin D1 activation, independent of COX-2 expression levels, Int J Oncol 40(1) (2012), 13–20.

Down-regulation of long non-coding RNA ANRIL inhibits the proliferation,migration and invasion of cervical cancer cells

Abstract

OBJECTIVES:

METHODS:

RESULTS:

CONCLUSION:

Keywords

1. Introduction

2. Materials and methods

2.1 Microarray and statistical analysis

2.2 Ethics statement

2.3 Study subject selection

2.4 Cell extraction

2.5 Cell transfection and culture

2.6 RNA extraction and reverse-transcription quantitative polymerase chain reaction (RT-qPCR)

Table 1 Primer sequences for reverse-transcription quantitative polymerase chain reaction

2.8 Cell Counting Kit-8 (CCK-8) assay

2.9 Flow cytometry

2.10 Scratch test

2.11 Transwell assay

2.12 Statistical analysis

3.1 ANRIL is predicted to be highly expressed in CC

Table 2 Relationship between clinicopathological characteristics and CC metastasis

3.5 Inhibition of ANRIL increases cell apoptosis

3.7 Inhibition of ANRIL dampens invasion of CC cells

4. Discussion

Footnotes

Acknowledgments

Conflict of interest

References

Table 1
Primer sequences for reverse-transcription quantitative polymerase chain reaction

Table 2
Relationship between clinicopathological characteristics and CC metastasis