SATB-1 and Her2 as predictive molecular and immunohistochemical markers for urothelial cell carcinoma of the bladder

Abstract

Studying bladder cancer molecular biology revealed the presence of genetic alterations. So, detection of molecular biomarkers that help in monitoring the disease, evaluating the prognosis of the patients, and their response to therapy is needed. In this study, we investigated the expression and the prognostic significance of SATB-1 and ERBB2 mRNA and protein by quantitative RT-PCR and immunohistochemical analysis in urothelial bladder cancer cases and the surrounding normal bladder tissue. The correlations between the expression of both markers and the clinicopathological parameters were performed with further analysis of the correlation between the expression of SATB-1 and ERBB2. Compared to control, the expression of SATB-1 and ERBB2 mRNA and protein in cancer tissues were significantly up-regulated ( $p<$ 0.05). Also, a positive correlation between both markers was found ( $r=$ 0.53, $p<$ 0.001). Moreover, elevated levels of both markers were significantly associated with the stage, lymph node involvement at both mRNA and protein levels ( $p<$ 0.001). In conclusion, there is a clinical significance of SATB-1 and ERBB2 as potential biomarkers for predicting bladder cancer patients of aggressive behavior and poor prognosis.

Keywords

RT-PCR immunohistochemistry bladder cancer SATB-1 ERBB2

1. Introduction

Urinary bladder carcinoma (BC) is the third most common tumor in men and the eleventh most common tumor in women [1]. In Egypt, it constitutes 30% of all cancer cases with an incidence rate of 13.5/100,000 individuals according to the National Cancer Institute [2]. Urothelial cell carcinoma represents more than 90% of bladder cancer [3].

Bladder cancer patients suffer from the poor unpredictable clinical outcome as more than 50% show relapse within the first year despite of being diagnosed at an early stage. Also, cases with muscle invasion have a bad prognosis with a 15–68% 5-year survival rate. This indicates the importance of knowing the oncogenic pathway and the factors affecting bladder cancer behavior [4].

The management of BC depends on the patients’ clinicopathological parameters as TNM staging and grading of the tumor, as predictors of good/poor prognosis. However, many variations occur within the same grade/stage as a result of bladder cancer cell heterogeneity. So, the detection of new biomarkers can help early detection of the disease, prediction of high-risk patients, and help proper management [5].

Special AT-rich sequence binding protein-1 (SATB-1) is a nuclear matrix attachment region (MAR) DNA-binding protein. It acts as a transcription factor and affects chromatin organization. Therefore, it can regulate the expression of several genes associated with the occurrence of cancer, and the ERBB2 gene is one of them. Altered SATB-1 expression was associated with the occurrence, invasion, and metastasis of many malignant tumors [6, 7].

Liu et al. found that SATB-1 expression correlated with poorly differentiated breast cancer and indicated an unfavorable prognosis and lower survival rate than those with negative expression. SATB-1 might inhibit hormone receptor expression in cooperating with Her2 and promotes tumor progression or estrogen therapy resistance in breast cancer [8]. Han et al. showed that SATB-1 promotes tumor growth and metastasis in breast cancer. Moreover, MAPK signaling was activated and PI3K/mTOR signaling was suppressed by SATB-1 in breast cancer cells [9].

ERBB2 gene encodes a member of the epidermal growth factor receptor family of receptor tyrosine kinases. The product of the human ERBB2 gene (Her2) is a 185-kilodalton glycoprotein with protein-tyrosine kinase activity, which is a human version of the rat neu proto-oncogene. However, it is still an orphan receptor to which no specific ligand has been identified. Her2 activates the Phosphatidylinositol-3 kinase-AKT-NF- $\kappa$ B pathway to stimulate the mitogenic cyclin D1/Cdk4- Rb-E2F pathway. Thus, it can stimulate intracellular pathways that permit proliferation and invasiveness of tumor cells in many cancers [10].

Her2 is considered as one of the best-known therapeutic targets in oncology. Patients with ERBB2-amplified or -overexpressing breast cancer benefit from ERBB2-targeted therapy, including anti-ERBB2 antibodies (such as trastuzumab and pertuzumab) and small-molecule tyrosine kinase inhibitors (such as lapatinib and neratinib) [11]. The 2007 ASCO guidelines mandate that Her2 should be evaluated in every invasive breast cancer, either at the time of diagnosis or recurrence to guide therapy [12]. Her2-positive breast cancer patients respond to monoclonal antibody therapy with trastuzumab or tyrosine kinase inhibitors at least at early stages. However, the prognosis of such patients is poor since $>$ 60% of them experience relapse during the first year due to Her2 modifications, defects in the antibody dependent cellular cytotoxicity or in cell arrest and apoptosis or alterations in Her2 signaling components [10].

Her2-positive breast cancers are more invasive than estrogen receptor positive ones. However, in Her2-positive and triple-negative breast cancer, the pathological complete response is high (60% or more), and correlated with long-term outcome [13].

The human ERBB2 gene is amplified in $\sim$ 20 % of human breast cancers, but the protein is overexpressed in $\sim$ 30% of the cases indicating that multiple different mechanisms contribute to Her2 overexpression in tumors [10]ERBB2 gene amplification is responsible for Her2 overexpression in 90% of breast carcinomas [12]. Possible explanations for protein overexpression in the absence of gene amplification include decreased destruction of the Her2 protein or upregulated transcription. The latter explanation is the most likely one. Up-regulated transcription is possibly reflective of its nature as a growth factor. Enhanced transcription in the absence of gene amplification is a recognized mechanism of carcinogenesis involving growth factors, in which a growth factor may lead to the upregulation of its expression.

Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Some studies reported an apparent lack of a marked association between Her2 protein expression and gene amplification in bladder cancer, as well [14]. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells [15].

This study was done to detect SATB-1 and ERBB2 (mRNA and protein) expression in bladder urothelial cell carcinoma, and to evaluate the relations between their expression and clinicopathological variables and prognosis. The correlations between the expression of SATB-1 and ERBB2 were analyzed.

1.1 Patients and methods

This work was carried out in the Medical Biochemistry and Molecular Biology Department with the participation of the Pathology and Public health and Community Departments, Faculty of Medicine, Zagazig University, and the Urology Department, Al-Ahrar Teaching Hospital, Zagazig, Egypt. It included 50 samples from patients with primary bladder urothelial cell carcinoma obtained by transurethral resection of bladder tumor (TURBT) or radical cystectomy from January 2020 to June 2020. Informed consent was obtained from participants. Adjacent normal urothelial specimens were enrolled in the study as control. The clinical data of the patients were obtained from their medical records of Al-Ahrar Teaching Hospital, Zagazig, Egypt. Grading of tumors was evaluated according to the World Health Organization’s (WHO) classification of tumors of the Urinary System and Male Genital Organs [16]. Pathological staging was evaluated according to the TNM system of tumors. All the cases were not subjected to any preoperative chemotherapy or radiotherapy. The study complied with the guidelines of the local ethics committee.

1.2 Immunohistochemistry (IHC)

Streptavidin-biotin-peroxidase complex (ABC) technique was used, 5 um sections of the formalin-fixed, paraffin-embedded tissues were cut, deparaffinized in xylene, rehydrated through a graded series of ethanol and washed in running water. Endogenous peroxidase activity was blocked by incubation with 0.3% H ${}_{2}$ O ${}_{2}$ in methanol for 30 min. Sections were then washed in PBS (pH $=$ 7.4) and Tris-buffer solution (pH $=$ 7.6). Thereafter, the slides were microwaved for 20 min for antigen retrieval and incubated overnight at 4 ${}^{\circ}$ C with optimal dilutions of anti SATB-1 (rabbit monoclonal antibody, 1:100 dilution; Code ab92307, Abcam, USA) and anti Her2 (mouse monoclonal antibody, Cat. MA1-34495 ready to use, Lab Vision, USA). Incubation with a secondary antibody and product visualization were performed with diaminobenzidine substrate (DAB; Abcam Inc., Cambridge, MA, USA) as the chromogen. Finally, the slides were counterstained with Mayer’s hematoxylin and washed with distilled water and PBS. Negative controls were made by replacing the primary antibody by PBS. An external positive control was a section of positive endometrial carcinoma for STAB-1 and positive Her2/Neu section of invasive ductal breast carcinoma.

1.3 Pathological analysis of immunohistochemistry

For SATB-1, nuclear staining was defined as immunoreactions. According to the intensity and the percentage of stained cells, the score was calculated. The predominant intensity was evaluated as follows: no nuclear staining (0), weak nuclear staining (1), moderate nuclear staining (2), and strong staining (3). The percentage of stained cells was evaluated as follows: less than 5% (0); 5 to 25 % (1); 25 to 50% (2); more than 50% (3). The final score was calculated by adding the two above scores. Scores of 0–2 were defined as low expression scores, and 3–6 were defined as high scores [17].

For Her2 immunostaining, scoring was based on the American Society of Clinical Oncology/College of American Pathologist guidelines 0: no staining, 1+: incomplete staining of the cell membrane, 2+: complete but weak or moderate membranous staining in $>$ 10% of the cells, and 3+: strong membranous staining in more than 10% of the cells [10]. Scores (0, 1+) are negative, 2+ is equivocal and 3+ is considered positive. Cytoplasmic staining was not included in the scoring as it was considered as non-specific.

1.4 RNA extraction and quantitative RT-PCR

Bladder tissues were homogenized and total cellular RNA was extracted from tissue homogenate using IQeasy plus CTB RNA extraction kit (iNtRON Biotechnology, Seongnam, Korea) following the manufacturer’s instructions. Reverse transcription of one ug of RNA was performed by the means of Power cDNA synthesis Kit (iNtRON Biotechnology, Seongnam, Korea) according to the manufacturer’s protocol. qRT-PCR was performed by adding 5 uL of the cDNA, 100 pmol/uL of each primer (0.5 uL each) (Biolegio, Netherlands), 10 uL of EvaGreen PCR Master mix (Jena Bioscience GmbH, Jena, Germany) and 4 uL PCR-grade water. Real-time PCR was performed using Mx3005P (Stratagene, La Jolla, CA, USA) as follows: 2 min of initial denaturation and polymerase activation at 95 ${}^{\circ}$ C, then 40 cycles of 95 ${}^{\circ}$ C for 15 sec; annealing at 55 ${}^{\circ}$ C for 45 sec and elongation at 65 ${}^{\circ}$ C for 45 sec.

The relative gene expressions for SATB-1 and ERBB2 were calculated by the 2 ${}^{-\Delta\Delta\text{Ct}}$ method. GADPH was used as an internal control. The amplitudes of change of the expression (fold change) observed in tumors in relation to the control adjacent tissues were analyzed. The sequence of the primers is listed in Table 1 [6, 18].

Table 1
Primer sequence of the studied genes

Gene	Forward	Reverse
GADPH	CTGAGTACGTCGTGGAGTC	ACTGAACCTGACCGTACACAGAGATGATGACCCTTTTG
STAB-1	GTGGAAGCCTTGGGAATCC	CTGACAGCTCTTCTTCTAGTT
ERBB2	AGC CGC GAG CAC CCA AG T	TTG GTG GGC AGG TAG GTG AGT T

Figure 1.

Urothelial cell carcinoma: A: low-grade papillary urothelial cell carcinoma, B: high-grade papillary urothelial cell carcinoma; C: high-grade urothelial cell carcinoma with muscle invasion (H&E, A: x100, B&Cx400).

1.5 Statistical analysis

Quantitative data were expressed as the mean $\pm$ standard deviation (SD). Qualitative data were expressed as number (No.) and percent (%). Independent Student $t$ -test was used to compare two groups of normally distributed data. Mann-Whitney U test was used for non-normally distributed data. One way ANOVA test was used to compare more than two groups of normally distributed data while Kruskal Wallis H was used for non-normally distributed data. Percent of categorical variables were compared using the Chi-square test or Fisher’s exact test when appropriate. Spearman’s rank correlation coefficient was calculated to assess the relationship between gene expressions. $P<$ 0.05 was considered statistically significant. $P$ values $<$ 0.001 were considered highly significant. All data were analyzed using SPSS 20.0 for windows (SPSS Inc., Chicago, IL, USA).

2. Results

2.1 Patient’s characteristics

The patients’ mean age $\pm$ SD was 63.8 $\pm$ 7.6 years, ranged from 48–78 years. The patients were 39 males (78%) and 11 females (22%). Fifty four percent of the tumors (27/50) were $\geqslant$ 5 cm. On histopathological examination, all cases were urothelial cell carcinoma with 60% of them (30/50) were of high grade of differentiation. pT1 $+$ pT2 was found in 56% (28/50) of biopsies while pT3 $+$ pT4 in 44% (22/50). Positive lymph node metastasis was detected in 30% (15/50) of cases. According to TNM staging, stage II was the commonest stage representing 44% (22/50) of cases (Table 2, Fig. 1).

Table 2
Clinicopathologic variables of 50 cases of bladder cancer

	No (mean $\pm$ SD)	% (range)
Age	63.8 $\pm$ 7.6	48–78
Sex
Male	39	78.0
Female	11	22.0
Grade
Low	20	40.0
High	30	60.0
Size
$<$ 5	23	46.0
$\geqslant$ 5	27	54.0
Depth
T1	3	6.0
T2	25	50.0
T3	18	34.0
T4	4	8.0
Stage
I	3	6.0
II	25	44.0
III	10	20.0
IV	15	30.0
LN
Negative	35	70.0
Positive	15	30.0
STAB1 gene	(2.9 $\pm$ 1.1)	(1.40–5.10)
ERBB gene	(4.2 $\pm$ 0.5)	(3.5–5.2)
STAB1 IHC
Low	19	38
High	31	62
Her2 IHC
Negative	17	34.0
Equivocal	17	34.0
Positive	16	32.0

2.2 Immunohistochemical expression

SATB-1 was highly expressed in 62% (31/50) of cases with a negative expression in adjacent healthy mucosa. A significant association between high SATB-1 expression and the grade of tumor differentiation ( $p=$ 0.03), the depth of invasion of the primary tumor ( $p<$ 0.001), the presence of lymph node metastasis ( $p<$ 0.001) and TNM stage ( $p<$ 0.001) were found. However, other variables showed no significant association with high SATB-1 expression (Table 3).

Table 3
Relation between clinicopathological features and immunohistochemical staining for SATB-1 in 50 patients with bladder carcinoma

	Low STAB1 IHC	High STAB1 IHC	$p$
Age	61.6 $\pm$ 7.8	65.1 $\pm$ 7.2	0.46
	48–76	49–78
Sex
Male	12 (83.2)	27 (87.1)	0.05
Female	7 (36.8)	4 (12.9)
Grade
Low	4 (21.1)	16 (51.6)	0.03*
High	15 (78.9)	15 (48.40
Size
$<$ 5	6 (31.6)	17 (54.8)
$\geqslant$ 5	13 (68.4)	14 (45.2)	0.11
Depth
T1	3 (15.8)	0	$<$ 0.001*
T2	16 (84.2)	10 (32.2)
T3	0	17 (52.7)
T4	0	4 (12.9)
Stage
I	3 (15.8)	3 (9.7)	$<$ 0.001*
II	16 (84.2)	5 (16.1)
III	0	11 (35.5)
IV	0	12 (38.7)
LN
Negative	19 (100.0)	16 (51.6)	$<$ 0.001*
Positive		15 (48.4)
STAB1 gene	2.0 $\pm$ 0.17	3.5 $\pm$ 1.08	0.21
	1.8–2.7	1.1–5.1
ERBB gene	3.8 $\pm$ 0.19	4.49 $\pm$ 0.5	0.05
	3.5–4.1	3.6–5.1
Her2 IHC
Negative	10 (52.6)	7 (22.0)	0.02*
Equivocal	7 (36.8)	10 (32.3)
positive	2 (10.5)	14 (45.2)

Positive Her2 expression (score3+) was detected in 32% (16/50) of specimens with equivocal expression (score2+) in 34 % (17/50) of cases (Table 2). Adjacent healthy mucosa showed negative expression. A significant association between positive Her2 expression and the depth of invasion ( $p<$ 0.001), and TNM stage ( $p=$ 0.02) was noted. No significant association was detected between Her2 expression and the other variables (Table 4).

Table 4

Relation between clinicopathological features and immunohistochemical staining for Her-2 in 50 patients with bladder carcinoma

	Negative	Equivocal	Positive	$P$
Age	63.4 $\pm$ 9.2	63.2 $\pm$ 7.1	64.9 $\pm$ 6.2	0.77
	49–78	48–75	56–75
Sex
Male	12 (70.6)	13 (76.5)	14 (87.5)	0.49
Female	5 (9.4)	4 (23.5)	2 (12.5)
Size
$<$ 5	6 (35.3)	9 (52.9)	8 (50.0)	0.54
$\geqslant$ 5	11 (64.7)	8 (47.1)	8 (50.0)
Depth
T1	2 (11.8)	1 (5.9)	0	$<$ 0.001*
T2	12 (70.6)	5 (52.9)	4 (25.0)
T3	2 (11.8)	6 (35)	10 (62.5)
T4	1 (5.9)		2 (12.5)
Stage
I	2 (11.8)	1 (5.9)	0 (0)	0.02*
II	11 (64.7)	8 (47.9)	3 (18.8)
III	2 (11.8)	1 (5.9)	7 (43.8)
IV	2 (11.8)	7 (41.2)	6 (37.5)
LN
Negative	15 (88.2)	10 (58.8)	10 (62.5)	0.13
Positive	2 (11.8)	7 (41.2)	6 (37.5)
Stable gene	2.26 $\pm$ 0.6	3.08 $\pm$ 1.2	3.6 $\pm$ 1.0	$<$ 0.001*
	1.4–4	1.9–5.10	2–4.8
ERBB gene	3.9 $\pm$ 0.4	4.2 $\pm$ 0.5	4.6 $\pm$ 0.4	$<$ 0.001*
	3.5–4.8	3.5–5.10	3.9–4.8

2.3 Reverse transcription-polymerase chain reaction (RT-PCR) results

In bladder tissues, the mean values of mRNA fold expressions of SATB-1 and ERBB2 relative to the control adjacent tissues were (2.9 $\pm$ 1.1 and 4.2 $\pm$ 0.5) respectively. There was a significant up-regulation of both markers’ mRNA expression in BC specimens as compared to the control adjacent tissues ( $p<$ 0.001) (Table 2).

Upregulation of SATB-1 and ERBB2 mRNA expressions was significantly associated with the tumor stage, the depth of tumor and the lymph node involvement ( $p<$ 0.001 for each) (Tables 5 and 6).

Table 5
Relation between clinicopathological features and SATB-1 gene expression in 50 patients with bladder carcinoma

	Mean $\pm$ SD		Range	$p$
Age
$<$ 50	1.9	$\pm$ 0.07	1.9–2	$<$ 0.001*
$\geqslant$ 50	3.01	$\pm$ 1.14	1.4–5.1
Sex
Male	3.2	$\pm$ 1.18	1.4–5.1	$<$ 0.001*
Female	2.17	$\pm$ 0.34	1.9–3
Size
$<$ 5	3.09	$\pm$ 1.2	1.4–5.10	0.57
$\geqslant$ 5	2.81	$\pm$ 1.04	1.9–5
Depth
T1	2.1	$\pm$ 0.49	1.8–2.7	$<$ 0.001*
T2	2.36	$\pm$ 0.8	1.4–4.7
T3	3.7	$\pm$ 1	2–5.10
T4	4.3	$\pm$ 0.3	4–4.7
Stage
I	2.1	$\pm$ 0.4	1.8–2.70	$<$ 0.001*
II	2.1	$\pm$ 0.6	1.4–4.7
III	3.1	$\pm$ 0.7	2–4.6
IV	4.2	$\pm$ 0.8	2.5–5.1
LN
Negative	2.43	$\pm$ 0.7	1.4–4.7	$<$ 0.001*
Positive	4.2	$\pm$ 0.82	2.5–5.1

Table 6

Relation between clinicopathological features and ERBB2 gene expression in 50 patients with bladder carcinoma

	Mean $\pm$ SD		Range	$P$
Age
$<$ 50	3.6	$\pm$ 0.14	3.5–3.7	0.07
$\geqslant$ 50	4.25	$\pm$ 0.49	3.5–5.1
Sex
Male	4.31	$\pm$ 0.5	3.6–5.1	0.09
Female	3.9	$\pm$ 0.34	3.5–4.5
Size
$<$ 5	4.3	$\pm$ 0.5	1.4–5.1	0.06
$\geqslant$ 5	4.1	$\pm$ 0.47	1.9–5
Depth
T1	3.7	$\pm$ 0.3	3.5–4	$<$ 0.001*
T2	4.0	$\pm$ 0.4	3.5–5.1
T3	4.47	$\pm$ 0.4	3.6–5.1
T4	4.8	$\pm$ 0.06	4.8–4.9
Stage
I	3.7	$\pm$ 0.3	3.5–4	$<$ 0.001*
II	3.9	$\pm$ 0.3	3.5–5.1
III	4.2	$\pm$ 0.4	3–5
IV	4.7	$\pm$ 0.3	4.1–5.1
LN
Negative	3.9	$\pm$ 0.4	3.5–5	$<$ 0.001*
Positive	4.7	$\pm$ 0.25	4.1–5.1

2.4 The correlation between SATB-1 and Her2 expression in bladder urothelial cell carcinoma

There was a significant association between SATB-1 and Her2 immunohistochemical expression ( $r=$ 0.39, $p=$ 0.01). Also, a significant association between SATB-1 and ERBB2 mRNA expressions was noted ( $r=$ 0.53, $p<$ 0.001). SATB-1 gene expression was positively related to Her2 immunohistochemical expression ( $r=$ 0.48, $p<$ 0.001) (Table 7).

Table 7
The correlation between the variables

	R	$P$
Her2 IHC and SATB-1 IHC	0.39	0.01*
Her2 IHC and SATB-1gene	0.48	0.00*
SATB-1gene and ERBB2gene	0.53	0.00*
SATB-1 IHC and SATB-1 gene	0.65	0.00*
SATB-1 IHC and ERBB2 gene	0.66	0.00*
ERBB2 gene and SATB-1 gene	0.91	0.00*

Concerning the Receiver Operating Characteristic (ROC) curve analysis, SATB-1 gene expression showed high specificity and sensitivity as an early predictor of urothelial cancer (93.3% &85.5% respectively) at cutoff value of 4.1. ERBB2 gene expression has specificity (80%) and sensitivity (91.4%) at a cutoff level of 4.6. Interestingly, the combination of the two markers raised the specificity to 93.3% and the sensitivity to 94.3% (Table 8A and B, Fig. 4).

Table 8A

Validity of SATB-1 and ERBB2 gene expression as an early predictor for LN involvement in bladder carcinoma: ROC curve analysis

Area under the curve
Test result variable(s)	Area	Std. Error ${}^{\text{a}}$	Asymptotic Sig. ${}^{\text{b}}$	Asymptotic 95% Confidence Interval
				Lower bound	Upper bound
ERBB2	0.893	0.045	0.000	0.805	0.981
SATB-1	0.900	0.046	0.000	0.811	0.990

The test result variable(s): ERBB2, SATB-1gene has at least one tie between the positive actual state group and the negative actual state group. Statistics may be biased.

a. Under the nonparametric assumption. b. Null hypothesis: true area $=$ 0.5

Table 8B

Validity of SATB-1 and ERBB2 gene expression as an early predictor for LN involvement in bladder carcinoma: ROC curve analysis

	ERBB2gene	SATB-1 gene	Both
CUT OFF	$>$ 4.6	$>$ 4.1
Sensitivity	91.4	85.5	94.3
Specificity	80%	93.3	93.3
PPV	91.4	96.8	97.1
NPV	80%	73.8	93.3

ROC curve: Receiver Operating Characteristic curve; PPV: Positive Predictive Value; NPV: Negative Predictive Value: AUROC: Area Under Receiver Operating Characteristic curve; $p<$ 0.05 is significant.

Figure 2.

SATB-1 immunohistochemical expression in bladder urothelial cell carcinoma: A: negative expression in adjacent healthy mucosa; B: low nuclear expression in low-grade papillary urothelial cell carcinoma; C: high nuclear expression in high-grade papillary urothelial cell carcinoma; D: high nuclear expression in high grade urothelial carcinoma with muscle invasion (IHC, X400).

Figure 3.

Her2 immunohistochemical expression: A: faint incomplete membranous staining (score 1+) in low-grade urothelial carcinoma; B: moderate complete membranous staining (score2+) of high-grade urothelial carcinoma, C: strong complete membranous staining (score 3) of high-grade papillary urothelial carcinoma (X 400).

Figure 4.

Roc curve: Validity of SATB-1 and ERBB2 gene expression as an early predictor for LN involvement in bladder carcinom.

3. Discussion

Bladder cancer is the 7th most common cancer worldwide representing about 3.2% of all cancers. Studying bladder cancer molecular biology revealed the presence of genetic alterations. So, detection of molecular biomarkers that help in monitoring the disease, evaluating patient’s prognosis, and response to therapy is needed [19].

SATB-1 is involved in chromosome remodeling, histone acetylation, and methylation, and can regulate the transcriptional activity of multiple genomes. It acts as a genome organizer by affecting the expressions of multiple tumors associated genes. So, SATB-1 can permit the tumor occurrence and metastasis facilitating its progression [20].

Our study showed higher SATB-1 expression at protein and mRNA levels in BC compared to the adjacent healthy mucosa. Similar results were reported by a previous study in non-muscle- invasive and muscle-invasive urothelial BC [6]. This suggests the role of SATB1 in the carcinogenesis and the progression of urothelial BC. Therefore, we also investigated the correlation between clinicopathological features and SATB1 expression in urothelial BC to validate its prognostic significance.

Concerning the grade of tumor differentiation, high SATB-1 protein expression was significantly associated with the tumor grade ( $p=$ 0.03). Han et al. showed similar results [20]. Furthermore, our study showed a significant association between high SATB-1 mRNA and protein expression, and each of the depth of invasion of the primary tumor, lymph node metastasis and TNM stage ( $p<$ 0.001). Yuan et al. found a similar result in gastric cancer. They found that the expression level of the SATB-1 gene was related to the TNM stage and distant metastasis [7]. No significant difference was found between SATB-1 overexpression and the other features. The same results were obtained by Wan et al. [6].

Previous studies found a correlation between up-regulated SATB-1 expression and advanced stages of malignant tumors such as breast cancer and laryngeal squamous cell carcinoma [21, 22]. The underlying mechanism of the SATB-1 role in affecting the behavior of the malignant tumors could be attributed to its ability for binding to the regulatory regions of hundreds of genes that directly affect the promoter activity and the expression of genes associated with tumor invasion and metastasis [8]. Moreover, SATB-1 overexpression was found to promote epithelial-mesenchymal transition processes by affecting E-cadherin down-regulation and E-cadherin repressors (Snail, Slug, and vimentin) upregulation. Thus, it increases the invasive and the metastatic capability of these lesions [6]. So, SATB-1 can be considered as an independent prognostic factor as well as a potential therapeutic target in human malignancies including urothelial BC.

Her2 is a transmembrane single subunit glycoprotein that has an extracellular ligand-binding domain, a transmembrane domain, and an intracellular tyrosine kinase catalytic domain. On ligand activation, the receptors dimerize forming heterodimers. This is followed by transphosphorylation which activates several intracellular signaling pathways such as Ras/mitogen-activated protein kinase pathway, the phosphatidylinositol 3 kinase (PI3K)/Akt pathway, the Janus kinase/signal transducer and activator of transcription pathway, and the phospholipase C pathway, which ultimately affects cell proliferation, survival, motility, and adhesion [12].

The current study detected Her2 positive expression in 32% of cases and equivocal expression in 34% of cases. However, negative expression was noted in 34% of cases. Her-2 positive expression was noted in 35% of low-grade transitional cell carcinoma and 30% of high grade but without statistical significance. This matched the result of Kumar et al. [23]. On the contrary, other studies had observed a significant association between Her2 overexpression and high-grade tumors (24-26). Different results could be attributed to the difference in region and ethnics.

Concerning lymph node involvement, no statistically significant correlation with Her2 protein expression was detected in our study ( $p=$ 0.13). On the contrary, a correlation between Her2 overexpression and the presence of lymph node metastasis was noted in other studies [27, 28]. However, our study recorded a significant correlation with lymph node metastasis at the mRNA level ( $p<$ 0.001).

Our study showed a significant association between high SATB-1 mRNA and protein expression and each of the depth of invasion of the primary tumor and TNM stage ( $p<$ 0.05). These results were similar to those found by previous studies at the protein level [24, 25, 26, 28]. They concluded that Her2 could be a biomarker associated with poor prognosis of bladder transitional cell carcinoma and could help targeted therapy in those patients.

Like previous studies, no significant relation between Her2 protein expression and age, gender, or primary tumor size was detected [29, 30].

There was a statistically significant association between SATB-1 and Her2 expression at both mRNA and protein expression. Therefore, a positive regulation and interaction between SATB-1 and Her2 that affect the behavior of urothelial BC could be suggested. Similarly, direct up-regulation of the ERBB2 gene by SATB1 was reported in breast cancer [8, 9] and in gastric carcinoma [7].

In cancer, abnormal nuclear organization and alterations in the amount and the distribution of heterochromatin are hallmarks [31]. In eukaryotes, the genome is divided into chromatin domains by the attachment of chromatin to a supporting structure called the nuclear matrix. The interactions between chromatin and the nuclear matrix occur via AT-rich DNA sequences called matrix attachment regions (MARs). The MARs function in organizing chromatin loops, augmenting gene expression, and facilitating replication [32]. Not all MARs are bound to the nuclear matrix or participate in the organization of loop attachment regions. MAR binding is a dynamic event that is cell type and/or cell cycle-dependent and can allow the regulation of distant genes in a coordinated manner [33]. The expression of MAR-binding proteins is correlated with aggressive tumor phenotypes. Moreover, a modification in the interactions between nuclear matrix proteins and MARs is related to chromatin reorganization observed during carcinogenesis. SATB-1 is the best characterized MAR-binding protein, and its roles in the higher order of chromatin loop organization and global transcriptional regulation have been documented [34]. Interestingly, the level of interaction of SATB-1 with MAR sequences could be more important than its expression level [35].

SATB-1 acts as a “genome organizer” that functions as a platform to regulate tissue-specific gene expression. It regulates the expression of more than 10% of genes by binding to the upstream regulatory regions which directly influence the promoter activity and gene expression [21]. Increased transcription of Her2 protein can occur due to the activation of the Her2 promoter by transcriptional factors, including activating protein-2 (AP-2) and Yin Yang protein-1 (YY1) [36]. YY1 is a zinc-finger DNA binding phosphoprotein transcriptional factor that regulates initiation, activation, and repression of transcription for several genes connected with cell growth, development, and differentiation [37]. YY1 stimulates AP-2 transcriptional activity, as well. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter to activate or repress the promoter. Ten thousands target genes of the YY1 transcription factor were predicted using the transcription factor binding site motifs. SATB-1 is one of these genes [38].

In conclusion, there is a positive correlation between the expression of both SATB-1 and Her2 in urothelial cell carcinoma of the bladder at mRNA and protein levels. They also could predict patients with poor prognosis that could benefit from targeted therapy.

Footnotes

Abbreviations

RT-PCR:	Reverse transcription-polymerase chain reaction;
H&E:	Hematoxylin and eosin;
ANOVA:	Analysis of variance;
GADPH:	Glyceraldehyde 3-phosphate dehydrogenase;
ROC:	Receiver Operating Characteristic;
SATB-1:	Special AT-rich sequence binding protein-1;
MAR:	matrix attachment region.

References

Siegel

R.L.

Miller

K.D.

and Jemal

, Cancer statistics, CA: a Cancer Journal for Clinicians 66(1) (2016), 7–30.

Ibrahim

A.S.

et al., Cancer incidence in Egypt: results of the national population-based cancer registry program, Journal of Cancer Epidemiology (2014), 437971.

Goodison

Rosser

C.J.

and Urquidi

, Bladder cancer detection and monitoring: assessment of urine- and blood-based marker tests, Molecular Diagnosis & Therapy 17(2) (2013), 71–84.

Stepan

A.E.

et al., Immunoexpression of N-cadherin, Twist and Vimentin in Bladder Urothelial Carcinomas, Current Health Sciences Journal 41(3) (2015), 219–226.

Nedjadi

et al., Prognostic value of HER2 status in bladder transitional cell carcinoma revealed by both IHC and BDISH techniques, BMC Cancer 16(1) (2016), 653.

Wan

et al., SATB1 overexpression regulates the development and progression in bladder cancer through EMT, PloS One 10(2) (2015), e0117518.

Yuan

C.L.

et al., Expression of SATB1 and HER2 in gastric cancer and its clinical significance, European Review for Medical and Pharmacological Sciences 20(11) (2016), 2256–2264.

Liu

et al., Expression of SATB1 and HER2 in breast cancer and the correlations with clinicopathologic characteristics, Diagnostic Pathology 10(1) (2015), 50.

Han

H.J.

et al., SATB1 reprogrammes gene expression to promote breast tumour growth and metastasis, Nature 452(7184) (2008), 187–193.

10.

Fry

E.A.

Taneja

and Inoue

, Oncogenic and tumor-suppressive mouse models for breast cancer engaging HER2/neu, International Journal of Cancer 140(3) (2017), 495–503.

11.

Waks

A.G.

and Winer

E.P.

, Breast Cancer Treatment: A Review. JAMA 321(3) (2019), 288–300.

12.

Krishnamurti

and Silverman

J.F.

, HER2 in breast cancer: a review and update, Advances in Anatomic Pathology 21(2) (2014), 100–107.

13.

Harbeck

and Gnant

, Breast cancer, Lancet 389(10074) (2017), 1134–1150

14.

Humphrey

P.A.

et al., The 2016 WHO Classification of Tumours of the Urinary System and Male Genital Organs-Part B: Prostate and Bladder Tumours, European Urology 70(1) (2016), 106–119.

15.

Wolff

A.C.

et al., Recommendations for human epidermal growth factor receptor 2 testing in breast cancer: American Society of Clinical Oncology/College of American Pathologists clinical practice guideline update, Archives of Pathology & Laboratory Medicine 138(2) (2014), 241–256.

16.

Amsellem-Ouazana

et al., Gene expression profiling of ERBB receptors and ligands in human transitional cell carcinoma of the bladder, The Journal of Urology 175(3 Pt 1) (2006), 1127–1132.

17.

Jose

Shanthala

and Cariap

, Immunohistochemical study of Her2/neu marker status in urothelial tumors of bladder, MedPulse – International Medical Journal 4(2) (2017), 234–238.

18.

Amsellem-Ouazana

et al., Is quantitative real-time RT-PCR an adjunct to immunohistochemistry for the evaluation of ErbB2 status in transitional carcinoma of the bladder? European Urology 49(6) (2006), 1035–1042.

19.

Oeyen

et al., Bladder Cancer Diagnosis and Follow-Up: The Current Status and Possible Role of Extracellular Vesicles, International Journal of Molecular Sciences, 20(4) (2019), 821.

20.

Han

et al., Expression and biological roles of SATB1 in human bladder cancer, Tumour Biology: The Journal of the International Society for Oncodevelopmental Biology and Medicine 34(5) (2013), 2943–2949.

21.

Patani

et al., The mRNA expression of SATB1 and SATB2 in human breast cancer, Cancer cell international 9(1) (2009), 18.

22.

Zhao

X.D.

et al., Overexpression of SATB1 in laryngeal squamous cell carcinoma, ORL; Journal for Oto-Rhino-Laryngology and Its Related Specialties 72(1) (2010), 1–5.

23.

Kumar

et al., Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype? South Asian Journal of Cancer 4(3) (2015), 115–117.

24.

Simon

et al., HER2 and TOP2A coamplification in urinary bladder cancer, International Journal of Cancer 107(5) (2003), 764–772.

25.

Simonetti

et al., Role of polysomy 17 in transitional cell carcinoma of the bladder: immunohistochemical study of HER2/neu expression and fish analysis of c-erbB-2 gene and chromosome 17, International Journal of Surgical Pathology 17(3) (2009), 198–205.

26.

El Ochi

M.R.

et al., Expression of human epidermal growth factor receptor 2 in bladder urothelial carcinoma, BMC Clinical Pathology 17(1) (2017), 3.

27.

Chen

P.C.

et al., Her2 amplification distinguishes a subset of non-muscle-invasive bladder cancers with a high risk of progression, Journal of Clinical Pathology 66(2) (2013), 113–119.

28.

Lim

S.D.

et al., Clinical significance of substaging and HER2 expression in papillary nonmuscle invasive urothelial cancers of the urinary bladder, Journal of Korean Medical Science 30(8) (2015), 1068–1077.

29.

Nini

et al., Evaluation of HER2 expression in urothelial carcinoma cells as a biomarker for circulating tumor cells, Cytometry 98 (2020), 355–367.

30.

Shawky

A.E.

et al., Her-2/Neu overexpression in invasive bladder carcinoma among a Cohort of Egyptian Patients, World Journal of Nephrology and Urology 2(2) (2013), 70–75.

31.

Lever

and Sheer

, The role of nuclear organization in cancer, The Journal of Pathology 220(2) (2010), 114–125.

32.

Gluch

Vidakovic

and Bode

, Scaffold/matrix attachment regions (S/MARs): relevance for disease and therapy, Handbook of Experimental Pharmacology 186 (2008), 67–103.

33.

Razin

S.V.

, The nuclear matrix and chromosomal DNA loops: Is there any correlation between partitioning of the genome into loops and functional domains? Cellular & Molecular Biology Letters 6(1) (2001), 59–69.

34.

Galande

, The third dimension of gene regulation: organization of dynamic chromatin loopscape by SATB1, Current Opinion in Genetics & Development 17 (2007), 408–414.

35.

Barboro

et al., The role of nuclear matrix proteins binding to matrix attachment regions (MARs) in prostate cancer cell differentiation, PLoS ONE 7(7) (2012), e40617.

36.

Allouche

et al., The combined immunodetection of AP-2alpha and YY1 transcription factors is associated with ERBB2 gene overexpression in primary breast tumors, Breast Cancer Research 10(1) (2008), R9.

37.

Yakovleva

et al., YY1 binding to a subset of p53 DNA-target sites regulates p53-dependent transcription, Biochemical and Biophysical Research Communications 318(2) (2004), 615–624.

38.

Rouillard

A.D.

et al., The harmonizome: a collection of processed datasets gathered to serve and mine knowledge about genes and proteins, Database: The Journal of Biological Databases and Curation (2016).