miR-21-5p promotes lung adenocarcinoma cell proliferation,migration and invasion via targeting WWC2

Abstract

OBJECTIVE:

Studies have suggested that miR-21-5p and WWC2 are key players in most cancer types, yet the underlying mechanisms in lung adenocarcinoma (LUAD) remain elusive. This study made in-depth research on the two factors-dependent mechanisms underlying LUAD occurrence and development.

METHODS:

Bioinformatics methods were employed to identify the miRNA and its target gene of interest. In all, 20 pairs of LUAD tumor tissue samples and matched adjacent normal samples along with 5 LUAD cell lines were collected for evaluating the aberrant expression of miR-21-5p and WWC2. Dual-luciferase reporter assay was performed to validate the targeted relationship between miR-21-5p and WWC2. A series of in vitro experiments including colony formation assay, EdU, wound healing assay and Transwell were conducted for assessment of the LUAD cell biological behaviors. In addition, Western blot was carried out to determine the protein expression of epithelial-mesenchymal transition (EMT)-related proteins.

RESULTS:

miR-21-5p was found to be considerably increased in LUAD tissue and cells relative to that in the adjacent tissue and the human bronchial epithelial cells, whereas WWC2 was significantly decreased. Dual-luciferase reporter assay revealed that miR-21-5p targeted WWC2 and down-regulated its expression. Besides, silencing miR-21-5p or overexpressing WWC2 played an inhibitory role in PC-9 cancer cell proliferation, migration and invasion, but such effect was suppressed when miR-21-5p was overexpressed. Furthermore, Western blot uncovered that WWC2 overexpression impeded the EMT process in LUAD cells.

CONCLUSION:

miR-21-5p facilitates LUAD cell proliferation, migration and invasion through targeting WWC2, which provides a novel therapeutic target for LUAD treatment.

Keywords

Lung adenocarcinoma WWC2 miR-21-5p proliferation migration invasion

1. Introduction

Lung cancer is one of the most common cancer types and the major cause leading to cancer-related deaths worldwide [1]. In China, an estimate of 300 thousand patients are newly diagnosed with lung cancer per year, and approximately 250 thousand died because of such disease [2]. Histologically, lung cancer can be classified as small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLS) [3]. NSCLC, the predominant disease among all lung cancer cases, can be sorted into three specific subtypes including adenocarcinoma, squamous cell carcinoma and large cell carcinoma, among which lung adenocarcinoma (LUAD) is predicted to take 40% of all lung cancer cases with the highest incidence [4, 5, 6]. Despite the great advance in early diagnosis and treatment, the unobvious symptoms and signs in the early stage result in a constant poor prognosis of LUAD patients, with a 5-year survival rate less than 20% [7, 8]. Therefore, it’s of great significance to clarify the molecular mechanisms underlying LUAD progression, so as to improve the accuracy of LUAD diagnosis and establish effective therapeutic approaches.

MicroRNAs (miRNAs) are endogenous and small non-coding RNAs that are capable of inhibiting mRNA translation and inducing post-transcriptional degradation via interacting with the 3’-UTR within the target mRNA [9, 10], ultimately playing an important role in various biological behaviors, such as cell migration, differentiation, apoptosis and metastasis [11]. miRNAs have been investigated to be aberrantly expressed in lung cancer [12, 13] and many other cancer types [14, 15, 16]. Wei et al. [17] reported the inhibitory role of miR-623 in LUAD tumor progression and Daugaard et al. [18] discovered the relationship between miR-34 dysregulation and LUAD distant metastasis. Recently, with the potential functions of miRNAs being more recognized by most researches, the research on the downstream targets against miRNAs has been gradually focused. For instance, in LUAD, miR-297 can target GPC5 to exert its role as an oncogene [19], and miR-374a can inhibit cell proliferation and invasion via targeting TGFA [20]. Moreover, miR-608 functions on LUAD cell apoptosis through mediating AKT2 [21].

In the present study, we discovered that WW and C2 domain containing 2 protein (WWC2) was differentially expressed in LUAD, and the 3’-UTR within WWC2 was predicted to have the potential binding sites with miR-21-5p. It has been reported that WWC2 and miR-21-5p are both considered as independent crucial participants in cancer [22, 23, 24], yet their collaboration in LUAD remains elusive. This study sought to make an attempt to elucidate the expression levels of miR-21-5p and WWC2 as well as investigate their functional mechanisms in LUAD, thus to support their potential as novel therapeutic targets in the treatment of LUAD.

2. Materials and methods

2.1 Sample collection

In total, a panel of 20 LUAD cancer tissue samples and paired adjacent normal samples ( $>$ 2 cm in margin) from October 2018 to October 2019 were accessed from Ningbo Medical Center LiHuiLi Hospital. All subjects had not been treated with any radiotherapy or chemotherapy, and the tissue samples were frozen in liquid nitrogen before use. The corresponding clinicopathological features including age, gender, tumor size and TNM staging were listed in Table 1. The study was approved by the Ethics Committee of Ningbo Medical Center LiHuiLi Hospital, and all subjects had signed the informed consent.

Table 1
The clinicopathological features of LUAD patients

Item	Case (n)	Account (%)
Gender
Male	13	65
Female	7	35
Age (years)
$\geqslant$ 60	9	45
$<$ 60	11	55
Tumor size (cm)
$\geqslant$ 5	8	40
$<$ 5	12	60
Degree of differentiation
Well differentiated	5	25
Moderately differentiated	7	35
Poorly differentiated	8	40
Lymph node metastasis
Metastasis	13	65
No metastasis	7	35
Distant metastasis
Metastasis	11	55
No metastasis	9	45
TNM stage
I $+$ II	7	35
III $+$ IV	13	65

2.2 Cell culture

Human lung cancer cell lines A549 (BNCC100215), Calu-1 (BNCC340251), JOSK-1 (BNCC100501), Calu-3 (BNCC338514) and PC-9 (BNCC340767), and bronchial epithelial cell line BEAS-2B (BNCC338205) were all accessed from BNCC. All cell lines were cultivated in Dulbecco’s Modified Eagle Medium (DMEM; Sigma, USA) supplemented with 10% fetal bovine serum (FBS; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) and 100 U/ml of streptomycin/ penicillin (Gibco; Thermo Fisher Scientific, Inc.), then nurtured in 5% CO ${}_{2}$ at 37 ${{}^{\circ}}$ C.

Table 2
Primer sequences in qRT-PCR

Target gene	Primer (5’-3’)
miR-21-5p	F: ACACTCCAGCTGGGTAGCTTATCAGACTGA
	R: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGATTATGA
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT
WWC2	F: AGGCTGGCAGTTTGTGATGA
	R: CCTCTCTGTGGAGCACATG
GAPDH	F: GGAGCGAGATCCCTCCAAAAT
	R: GGCTGTTGTCATACTTCTCATGG

2.3 Cell transfection

Mimic NC, miR-21-5p mimic, inhibitor NC and miR-21-5p inhibitor (Sangon, Shanghai, China) were transiently transfected into PC-9 cells using the Lipofectamine2000 (Thermo Fisher Scientific, Inc.), respectively, according to the standard process. All cells were maintained in corresponding mediums in 5% CO ${}_{2}$ at 37 ${{}^{\circ}}$ C. Oe-WWC2 and oe-NC, were established using the lentivirus expression vector pLVX-IRES-neo (Clontech, USA), and then dripped into the cancer cells along with the virus particle for infection. All cells were grown in complete mediums for a minimum of 24 h before transfection, and washed with phosphate buffer saline (PBS, pH7.4).

2.4 RNA Extraction and Real-Time quantitative PCR (qRT-PCR)

Total RNA was isolated using the RNA Extraction Kit (Beyotime Biotechnology, People’s Republic of China). cDNA of miRNA was synthesized with the TransScript ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ miRNA First-Strand cDNA Synthesis SuperMix Kit (AT351-01, TransGen Biotech, Beijing, China), whereas that of mRNA was obtained by applying the TransScript ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (AT311-02, TransGen Biotech, Beijing, China). After preparation, qRT-PCR was conducted using the SYBR Premix Ex Taq (TaKaRa, Otsu, Shiga, Japan), with U6 and GAPDH applied as endogenous regulators of miRNA and mRNA. Primers used in the reaction were purchased from Sangon (Shanghai, China) as detailed in Table 2. The results were analyzed in 2 ${}^{-\Delta\Delta\text{Ct}}$ and normalized to the controls.

2.5 Western blot

Total proteins were extracted using the RIPA lysis buffer (R0010, Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) along with the protocol. The protein concentration was assayed by BCA protein assay kit (20201ES76, Yeasen Company, Shanghai, China), and quantitation was accordingly performed based on different concentrations. Thereafter, the protein samples were treated by polyacrylamide gel electrophoresis (PAGE) and then transferred onto the polyvinylidene fluoride (PVDF) membranes. 5% bovine serum albumin (BSA) was utilized to block the membranes at room temperature within 1 h. Primary rabbit polyclonal antibodies composed of WWC2 (ab126356, 1:200, abcam, Cambridge, UK), E-cadherin (ab15148, 1:500, abcam, Cambridge, UK), N-cadherin (ab76057, 1:1000, abcam, Cambridge, UK), Vimenin (ab137321, 1:500, abcam, Cambridge, UK) and GAPDH (ab9485, 1:2500, abcam, Cambridge, UK) were added into the membranes for incubation overnight at 4 ${{}^{\circ}}$ C, followed by horseradish peroxidase (HRP)-labeled secondary antibody goat anti-rabbit IgG H&L (ab6721, 1:2000, abcam, Cambridge, UK) at room temperature for 1 h. PBST (phosphate buffered saline buffer $+$ 0.1% Tween $-$ 20) was used to wash the membranes three times after each reaction. Images of the protein bands were observed and captured under an optical luminometer (GE, USA).

2.6 Dual-luciferase reporter assay

Dual-luciferase reporter assay was performed for the validation of the targeted relationship between miR-21-5p and WWC2. Luciferase vector pmiRGLO (Promega, WI, USA) fused with the mutant (MUT) or wild type (WT) WWC2 3’-UTR segment was constructed called as luciferase reporter plasmid WT-WWC2 or MUT-WWC2. Then the plasmids were co-transfected with miR-21-5p mimic or mimic NC into PC-9 cells, respectively, using the Renilla luciferase vector pRL-TK (TaKaRa, Dalian, China) as the internal reference. The transfected cells were cultured in DMEM containing 10% FBS, and the luciferase activity was determined after 48 h with the dual-luciferase assay kit (Promega, Madison, WI, USA).

2.7 Colony formation assay

Transfected cells were seeded into 6-well plates at a density of 2 $\times$ 10 ${}^{3}$ cells/well with the mediums replaced every three days. The colonies obtained were firstly washed with 1 $\times$ PBS twice, then fixed in 4% methanol for 15 min, subsequently stained in 0.25% crystal violet within 25 min. Sterile water was used to softly rinse the colonies and images were photographed for calculation.

Figure 1.

miR-21-5p is up-regulated in LUAD tissue and cells. Differential analysis was performed and 164 DEmiRNAs were identified as shown in a (A) Volcano Plot, with red representing up-regulated genes and green representing down-regulated genes. (B) The expression of miR-21-5p was detected in the TCGA-LUAD dataset (red refers to normal and blue refers to tumor), and (C) survival analysis was conducted. Meanwhile, the expression of miR-21-5p was examined in the (D) clinical LUAD tissue samples ( $n=$ 20) and paired adjacent normal tissue samples ( $n=$ 20), as well as (E) in the human bronchial epithelial cell line BEAS-2B and five LUAD cell lines A549, Calu-1, JOSK-1, Calu-3 and PC-9 ( ${}^{*}p<$ 0.05).

Figure 2.

WWC2 is poorly expressed in LUAD. (A) DEmRNAs of LUAD were screened from the TCGA-LUAD dataset. TargetScan, miRDB and miRTarBase three databases were employed for target gene prediction, and (B) Venn Diagram was plotted to find the potential target mRNAs of miR-21-5p. As supported by the data from TCGA-LUAD dataset, (C) WWC2 was poorly expressed (red represents normal and blue represents tumor). Besides, (D) correlation analysis suggested that there was a reverse association between miR-21-5p and WWC2. As well, the expression of WWC2 was determined in the (E) clinical LUAD tissue samples ( $n=$ 20) and paired adjacent normal tissue samples ( $n=$ 20), as well as (F) in the human bronchial epithelial cell line BEAS-2B and five LUAD cell lines A549, Calu-1, JOSK-1, Calu-3 and PC-9. (G) Western blot was performed to examine the protein level of WWC2 in five cases, with N referring to matched adjacent normal tissue and T referring to the tumor tissue ( ${}^{*}p<$ 0.05).

Figure 3.

WWC2 is a direct target of miR-21-5p. miR-21-5p mimic, miR-21-5p inhibitor and their negative controls were transfected into PC-9 cells. (A) qRT-PCR was conducted to test transfection efficiency. (B) TargetScan website was applied and it was found that miR-21-5p targeted bound to the 3’-UTR within WWC2, which was further verified by (C) dual-luciferase reporter assay. (D) Western blot was performed to assay the WWC2 protein level in miR-21-5p mimic transfected cells ( ${}^{*}p<$ 0.05).

Figure 4.

miR-21-5p silencing suppresses LUAD cell proliferation, migration and invasion. miR-21-5p inhibitor and its negative control were transfected into PC-9 cells. Then the cells were harvested for the determination of cell biological behaviors via (A) colony formation assay, (B) EdU, (C) wound healing assay and (D) Transwell invasion assay ( ${}^{*}p<$ 0.05).

Figure 5.

miR-21-5p mediates LUAD cell proliferation, migration and invasion via targeting WWC2. mimic-NC $+$ oe-NC, mimic NC $+$ oe-WWC2 and miR-21-5p mimic $+$ oe-WWC2 were used to transfect PC-9 cells. Thereafter, the cells were collected for (A) colony formation assay, (B) EdU, (C) wound healing assay and (D) Transwell. (E) qRT-PCR was carried out for the assessment of the transfection efficiency in each group, and (F) Western blot was conducted to assay the proteins levels of WWC2 and EMT-related proteins E-cadherin, N-cadherin and Vimentin ( ${}^{*}p<$ 0.05).

2.8 5-Ethynyl-2’-Deoxyuridine (EdU)

Twenty-four-well plates were employed for assessment of cell growth (1 $\times$ 10 ${}^{4}$ cells/mL). EdU analysis was conducted using the Cell-Light ${}^{\text{TM}}$ EDU Apollo 488 Assay Kit (Ruibio, China). Hoechst 33342 was utilized for staining and the fluorescence microscope was applied for nucleic acid identification as well as calculation of EdU positive cells. The cell viability was assessed by a ratio of EdU positive cells (red) to Hoechst stained cells (blue).

2.9 Wound healing assay

Transfected cells were planted into 6-well plates (2.5 $\times$ 10 ${}^{5}$ cells/mL). Then the cell monolayers were wounded with a sterile pipette tip (10 $\mu$ L) to draw a gap. 1 $\times$ PBS was utilized to wash the cells, and the cells remained were continuously cultured in FBS-free mediums for 24 h. Representative fields were photographed and the migrated cells were counted.

2.10 Transwell

Twenty-four-well Transwell inserts (8 $\mu$ m in aperture, BD Biosciences) pre-coated with Matrigel matrix (Corning, NY) were used for invasion assessment. Around 2 $\times$ 10 ${}^{4}$ cells suspended by serum-free mediums were planted into the upper chambers, and DMEM containing 10% FBS was added into the lower chambers. All cells were maintained at 37 ${{}^{\circ}}$ C. After 24 h, non-invaded cells were softly wiped off using a cotton swab, whereas cells in the lower chambers were crystal violet (0.1%) treated and counted.

2.11 Statistical analysis

Measurement data were presented as mean $\pm$ standard deviation. Difference between two groups was analyzed in $t$ test, while comparisons among more than two groups were assessed by one-way analysis of variance (ANOVA) using SPSS 21.0 software. $P<$ 0.05 was considered statistically significant.

3. Results

3.1 miR-21-5p is up-regulated in LUAD tissue and cells

Isoform Expression Quantification data of miRNAs associated with LUAD were downloaded from TCGA database, comprising of 45 normal samples and 516 tumor samples. Differential analysis was performed using the R package “edgeR”, with the threshold set as $|$ logFC $|$ $>$ 1.5 and adj. $p$ value $<$ 0.05. As shown in Fig. 1A, a total of 164 differentially expressed miRNAs (DEmiRNAs) were obtained, among which miR-21-5p was observed to be considerably elevated in tumor tissue relative to that in normal tissue (Fig. 1B), with a statistically significant false discovery rate (FDR). Meanwhile, survival analysis revealed that high miR-21-5p expression was greatly associated with poor prognosis of LUAD patients (Fig. 1C). In addition, qRT-PCR and Western blot were conducted for further verification of the miR-21-5p alteration in clinical LUAD tissue samples (20 pairs of LUAD tissue samples and paired adjacent normal tissue samples) and cells. As suggested in Fig. 1D and E, miR-21-5p exhibited remarkably elevated expression in tumor tissue as well as in cancer cells (A549, Calu-1, JOSK-1, Calu-3 and PC-9) relative to that in the normal counterparts. PC-9 cell line showing the most obvious expression variance was selected for subsequent analysis.

3.2 WWC2 is predicted as a target of miR-21-5p and poorly expressed in LUAD tissue and cells

To further investigate the downstream regulatory mechanism of miR-21-5p in LUAD, TargetScan, miRDB and miRTarBase three databases were employed for target gene prediction. The DEmRNAs were firstly screened from the TCGA-LUAD dataset (Fig. 2A), and the down-regulated parts were used to make an intersection with the predicted mRNAs as plotted in a Venn diagram (Fig. 2B). Therein, OLR1 and WWC2 had the potential serving as targets of miR-21-5p. Notably, WWC2 was found to be significantly decreased in LUAD tissue (Fig. 2C) and reversely correlated with miR-21-5p (Fig. 2D), which made it as a research object in this study. Thereafter, to make our findings more receivable, qRT-PCR was performed on the clinical tissue samples and cells, finding that WWC2 mRNA was significantly reduced in cancer tissue and cells compared with that in paired adjacent normal tissue and bronchial epithelial cell line BEAS-2B (Fig. 2E and F). Similarly, the WWC2 protein level in clinical cancer tissue samples was much lower relative to that in the corresponding adjacent normal tissue as indicted by Western blot (Fig. 2G).

3.3 WWC2 is a direct target of miR-21-5p

To further confirm whether WWC2 was under the regulation of miR-21-5p directly, miR-21-5p mimic, miR-21-5p inhibitor and their negative controls were transfected into PC-9 cells. qRT-PCR was performed to detect the transfection efficiency and it was found that miR-21-5p was successfully increased in the miR-21-5p mimic transfected cells (Fig. 3A). As abovementioned, WWC2 was a potential target gene of miR-21-5p. Thus, to confirm our prediction, TargetScan website was applied and it turned out that a complementary region was present between miR-21-5p and WWC2 3’-UTR (Fig. 3B). In addition, dual-luciferase reporter assay indicated that cells transfected with miR-21-5p mimic and WT-WWC2 had remarkably decreased luciferase activity, whereas there was no effect in the cells with MUT-WWC2 (Fig. 3C). Furthermore, Western blot demonstrated that high miR-21-5p could play an inhibitory role in WWC2 in PC-9 cells (Fig. 3D). Collectively, the results elucidated that miR-21-5p was capable of targeted down-regulating WWC2.

3.4 miR-21-5p silencing suppresses LUAD cell proliferation, migration and invasion

In this part, we aimed to clarify the role of miR-21-5p in cell biological behaviors in LUAD. As indicated in Fig. 3A, miR-21-5p was greatly decreased in the miR-21-5p inhibitor transfected cells. Subsequently, a series of in vitro experiments were conducted. Colony formation assay and EdU suggested greatly weakened viability and proliferation ability in the miR-21-5p inhibitor transfected cells (Fig. 4A and B). As well, the migration and invasion abilities of cells with miR-21-5p inhibitor were both significantly inhibited as plotted in Fig. 4C and D. Taken together, we believed that down-regulating miR-21-5p was responsible for the suppression of cell proliferation, migration and invasion in LUAD.

3.5 miR-21-5p mediates cell proliferation, migration and invasion in LUAD via targeting WWC2

To gain more insight into the regulatory mechanism of miR-21-5p and WWC2 in LUAD, mimic NC $+$ oe-NC, mimic NC $+$ oe-WWC2 and miR-21-5p mimic $+$ oe-WWC2 were used to transfect PC-9 cells, respectively. Firstly, qRT-PCR was performed to test the transfection efficiency of miR-21-5p in each group and Western blot was conducted for WWC2 determination, showing that miR-21-5p overexpression was accompanied by decreased WWC2 protein level (Fig. 5E and F). Colony formation assay and EdU (Fig. 5A and B) showed that overexpressing WWC2 remarkably inhibited cell proliferation relative to the NC, as revealed by the less cell colonies and low EdU positive rate. Meanwhile, rescue experiments showed that such inhibitory effect could be attenuated when miR-21-5p was simultaneously overexpressed. Besides, similar trends could be observed in migration and invasion assays as demonstrated in Fig. 5C and D. Furthermore, WWC2 was reported to function on the EMT process and cell metastasis in colorectal cancer [25]. Hence, we made an evaluation on EMT-related proteins in LUAD cells. As it could be seen in Fig. 5F, overexpressing WWC2 elevated E-cadherin protein level but reduced N-cadherin and Vimentin levels, which was abolished by miR-21-5p overexpression. Overall, we verified that WWC2 inhibitory functioned on LUAD cell proliferation, migration, invasion and EMT process, which could be reversed by miR-21-5p to some extent, demonstrating that miR-21-5p regulated LUAD cell behaviors probably via targeting WWC2.

4. Discussion

Increasing evidence has proved that miRNAs function in cancers acting as an oncogene or a tumor suppressor. This study discovered that miR-21-5p was significantly altered in LUAD through bioinformatics analysis. Meanwhile, we found that WWC2 was a direct target of miR-21-5p. The targeted regulatory relationship between miR-21-5p and WWC2 was greatly focused in the present study, which helps for the exploration of novel strategies on LUAD diagnosis and treatment.

In the present study, we collected clinical LUAD tissue samples and chose five cancer cell lines to determine the expression of miR-21-5p, finding that miR-21-5p was significantly up-regulated. This result was consistent with the bioinformatics data and the research reported by Zhong et al. [26] that miR-21-5p acts as an oncogene in cancer. Previous studies indicated that miR-21-5p can be used as a biomarker functioning in most cancer types, such as cervical cancer [27], gastric cancer [24, 28] and breast cancer [29]. Also, the role of miR-21-5p in lung cancer has been investigated in many studies. For example, Yan et al. [23] reported that miR-21-5p can target TGFBI to induce cell proliferation in NSCLC, and can boost tumor progression via regulating SMAD7 as revealed by Li et al. [30] Our study discovered that miR-21-5p silence was responsible for the inhibition of cell proliferation, migration and invasion in LUAD.

As miR-21-5p and WWC2 were both recognized to be associated with cancer progression, hence, we speculated that WWC2 might be involved in some regulatory functions of miR-21-5p. WWC family contains WWC1, WWC2 and WWC3 [31]. Studies have suggested that such kind of proteins can negatively regulate Hippo signaling pathway, thereby mediating cell proliferation and tissue growth in mammals [32, 33]. Besides, WWC2 has been reported to play an inhibitory role in cell invasion and metastasis in lung cancer via regulating Wnt and Hippo signaling pathways by interacting with Dishevelled proteins and large tumor suppressor 1 [34]. Moreover, WWC2 has been studied as a tumor suppressor gene in hepatocellular carcinoma [35] and colorectal cancer [25]. In our study, the expression of WWC2 was validated to be much lower in LUAD tissue and cancer cells by comparison with that in adjacent normal tissue and human normal bronchial epithelial cell line BEAS-2B, with the aid of bioinformatics analysis. Besides, dual-luciferase reporter assay was conducted and it was confirmed that miR-21-5p was capable of decreasing the expression of WWC2 by means of binding to WWC2 3’UTR directly. Meanwhile, further rescue experiments demonstrated that overexpressing WWC2 significantly suppressed LUAD cell proliferation, migration and invasion, while these abilities were recovered to some extent upon miR-21-5p overexpression.

There was a study indicating that LINC00460 interacts with the transcription factor ERG to suppress the transcription of WWC2, thereby increasing the expression of downstream target genes N-cadherin, Snail, TWSIT1 and decreasing the expression of E-cadherin, consequently leading to promotion of the epithelial-mesenchymal transition (EMT) process in colorectal cancer cells and metastasis [36]. Besides, Zhang et al. confirmed that WWC2 overexpression induces the activation of LATS1/2 to inhibit the invasion and metastasis of hepatocellular carcinoma cells. It has been reported that the activation of LATS1/2 contributes to the phosphorylation of YAP (Yes-associated protein), a major effector of the Hippo pathway [37], and in turn suppresses its transcriptional activity [35]. In the meantime, YAP has been validated to be a favorable factor for EMT upon its high expression [38, 39]. Overall, the expression of WWC2 is significantly correlated with the activation of the Hippo pathway and the EMT process in caner cells. In the present study, we confirmed that WWC2 characterized by up-regulated expression remarkably inhibited the proliferation, migration and invasion of LUAD cells, and we believed that such phenomenon might be attributed to the effect of WWC2 on the activation of the Hippo pathway and some downstream transcription factors that are associated with metastasis. Nevertheless, the specific mechanism of WWC2 affecting the EMT process in LUAD cells remains to be further explored.

5. Conclusion

In sum, this study certified that WWC2 is poorly expressed in LUAD cells and can be regulated by miR-21-5p. Meanwhile, we found that silencing miR-21-5p or overexpressing WWC2 facilitates LUAD cell proliferation, migration and invasion. All these findings suggest the possible of WWC2 serving as a promising therapeutic target for LUAD. Besides, in-depth research on how WWC2 functions on LUAD cell-related functions via regulating signaling pathways like Hippo will be carried out, so as to provide evidence for future LUAD treatment.

Footnotes

Conflict of interest

The authors declare no conflicts of interest.

References

Baumgartner

et al., The WW domain protein kibra acts upstream of hippo in drosophila, Dev Cell 18 (2010), 309–316.

Bayoumi

A.S.

et al., Crosstalk between long noncoding RNAs and MicroRNAs in health and disease, Int J Mol Sci 17 (2016), 356.

Chen

et al., Clinical significance of let-7a-5p and miR-21-5p in patients with breast cancer, Ann Clin Lab Sci 49 (2019), 302–308.

Chen

et al., Cancer statistics in China, 2015, CA Cancer J Clin 66 (2016), 115–132.

Daugaard

et al., The association between miR-34 dysregulation and distant metastases formation in lung adenocarcinoma, Exp Mol Pathol 102 (2017), 484–491.

Ferlay

et al., Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012, Int J Cancer 136 (2015), E359–386.

H.L.

et al., Altered miRNA expression is associated with differentiation, invasion, and metastasis of esophageal squamous cell carcinoma (ESCC) in patients from Huaian, China, Cell Biochem Biophys 67 (2013), 657–668.

Han

et al., WWC3 regulates the wnt and Hippo pathways via dishevelled proteins and large tumour suppressor 1, to suppress lung cancer invasion and metastasis, J Pathol 242 (2017), 435–447.

Hermann

et al., WW and C2 domain-containing proteins regulate hepatic cell differentiation and tumorigenesis through the hippo signaling pathway, Hepatology 67 (2018), 1546–1559.

10.

Kao

H.W.

et al., Urine miR-21-5p as a potential non-invasive biomarker for gastric cancer, Oncotarget 8 (2017), 56389–56397.

11.

Kremerskothen

et al., Characterization of KIBRA, a novel WW domain-containing protein, Biochem Biophys Res Commun 300 (2003), 862–867.

12.

and Wu

, MiR-21-5p promotes the progression of non-small-cell lung cancer by regulating the expression of SMAD7, Onco Targets Ther 11 (2018), 8445–8454.

13.

Liu

et al., Prognostic significance of low miR-144 expression in gastric cancer, Cancer Biomark 20 (2017), 547–552.

14.

Liu

et al., Long noncoding RNA XIST regulates miR-137-EZH2 axis to promote tumor metastasis in colorectal cancer, Oncol Res 27 (2018), 99–106.

15.

McGuire

, World Cancer Report 2014. Geneva, Switzerland: World Health Organization, International Agency for Research on Cancer, WHO Press, 2015, Adv Nutr 7 (2016), 418–419.

16.

J.S.

et al., The hippo signaling pathway in stem cell biology and cancer, EMBO Rep 15 (2014), 642–656.

17.

Moran

, Importance of molecular features of non-small cell lung cancer for choice of treatment, Am J Pathol 178 (2011), 1940–1948.

18.

Othman

and Nagoor

N.H.

, miR-608 regulates apoptosis in human lung adenocarcinoma via regulation of AKT2, Int J Oncol 51 (2017), 1757–1764.

19.

Park

S.K.

et al., MiR 21-5p as a predictor of recurrence in young gastric cancer patients, J Gastroenterol Hepatol 31 (2016), 1429–1435.

20.

Plaisance-Bonstaff

and Renne

, Viral miRNAs, Methods Mol Biol 721 (2011), 43–66.

21.

Raitoharju

et al., Blood microRNA profile associates with the levels of serum lipids and metabolites associated with glucose metabolism and insulin resistance and pinpoints pathways underlying metabolic syndrome: the cardiovascular risk in Young Finns Study, Mol Cell Endocrinol 391 (2014), 41–49.

22.

Sun

et al., miR-297 acts as an oncogene by targeting GPC5 in lung adenocarcinoma, Cell Prolif 49 (2016), 636–643.

23.

Travis

W.D.

et al., International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society: international multidisciplinary classification of lung adenocarcinoma: executive summary, Proc Am Thorac Soc 8 (2011), 381–385.

24.

van Meerbeeck

J.P.

et al., Small-cell lung cancer, Lancet 378 (2011), 1741–1755.

25.

Wang

et al., Yes-associated protein (YAP) expression is involved in epithelial-mesenchymal transition in hepatocellular carcinoma, Clin Transl Oncol 18 (2016), 172-177.

26.

Wei

et al., Hsa-miR-623 suppresses tumor progression in human lung adenocarcinoma, Cell Death Dis 7 (2016), e2388.

27.

Wennmann

D.O.

et al., Evolutionary and molecular facts link the WWC protein family to Hippo signaling, Mol Biol Evol 31 (2014), 1710–1723.

28.

Wood

S.L.

et al., Molecular histology of lung cancer: from targets to treatments, Cancer Treat Rev 41 (2015), 361–375.

29.

et al., MiR-374a suppresses lung adenocarcinoma cell proliferation and invasion by targeting TGFA gene expression, Carcinogenesis 37 (2016), 567–575.

30.

Yan

et al., miR-21-5p induces cell proliferation by targeting TGFBI in non-small cell lung cancer cells, Exp Ther Med 16 (2018), 4655–4663.

31.

et al., MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway, Oncogene 34 (2015), 413–423.

32.

Yuan

et al., Down-regulation of LINC00460 represses metastasis of colorectal cancer via WWC2, Dig Dis Sci 65 (2020), 442–456.

33.

Yuan

et al., Down-regulation of LINC00460 represses metastasis of colorectal cancer via WWC2, Dig Dis Sci (2019).

34.

Yuan

et al., YAP overexpression promotes the epithelial-mesenchymal transition and chemoresistance in pancreatic cancer cells, Mol Med Rep 13 (2016), 237–242.

35.

Zappa

and Mousa

S.A.

, Non-small cell lung cancer: current treatment and future advances, Transl Lung Cancer Res 5 (2016), 288–300.

36.

Zhang

et al., WWC2 is an independent prognostic factor and prevents invasion via Hippo signalling in hepatocellular carcinoma, J Cell Mol Med 21 (2017), 3718–3729.

37.

Zhong

et al., miR-21-5p promotes lung adenocarcinoma progression partially through targeting SET/TAF-Ialpha, Life Sci 231 (2019), 116539.

38.

Zhu

D.Y.

et al., MiR-454 promotes the progression of human non-small cell lung cancer and directly targets PTEN, Biomed Pharmacother 81 (2016), 79–85.

39.

Zhu

et al., MiR-21-5p, miR-34a, and human telomerase RNA component as surrogate markers for cervical cancer progression, Pathol Res Pract 214 (2018), 374–379.

miR-21-5p promotes lung adenocarcinoma cell proliferation,migration and invasion via targeting WWC2

Abstract

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSION:

Keywords

1. Introduction

2. Materials and methods

2.1 Sample collection

Table 1 The clinicopathological features of LUAD patients

Table 2 Primer sequences in qRT-PCR

2.4 RNA Extraction and Real-Time quantitative PCR (qRT-PCR)

2.5 Western blot

2.6 Dual-luciferase reporter assay

2.7 Colony formation assay

2.9 Wound healing assay

2.10 Transwell

2.11 Statistical analysis

3. Results

3.1 miR-21-5p is up-regulated in LUAD tissue and cells

3.2 WWC2 is predicted as a target of miR-21-5p and poorly expressed in LUAD tissue and cells

3.3 WWC2 is a direct target of miR-21-5p

3.4 miR-21-5p silencing suppresses LUAD cell proliferation, migration and invasion

3.5 miR-21-5p mediates cell proliferation, migration and invasion in LUAD via targeting WWC2

4. Discussion

5. Conclusion

Footnotes

Conflict of interest

References

Table 1
The clinicopathological features of LUAD patients

Table 2
Primer sequences in qRT-PCR