DEPDC1 upregulation promotes cell proliferation and predicts poor prognosis in patients with gastric cancer

Abstract

BACKGROUND:

Previous studies revealed that DEP domain containing 1 (DEPDC1) is involved in the carcinogenesis and progression of several types of human cancer. However the role of DEPDC1 in gastric cancer has not been studied.

OBJECTIVE:

The objective of this study was to study the expression and pathophysiological function of DEPDC1 in gastric cancer.

METHODS:

DEPDC1 expression in gastric adenocarcinoma cells was examined with Western blot and qRT-PCR. Clinical pathological features of patients were determined by immunohistochemistry. The effect of DEPDC1 expression on cell proliferation was studied by in vitro cell proliferation assay; and cell cycle influence was assessed by flow cytometry. Survival curves were plotted using Kaplan-Meier.

RESULTS:

DEPDC1 was overexpressed in gastric adenocarcinoma tissues compared with the paired adjacent normal gastric tissues, in accordance with mRNA level downloaded from GEPIA database. DEPDC1 expression level was significantly associated with cancer metastasis and differentiation. DEPDC1 upregulation caused cell cycle accelerating from G1 to S phase, and it was correlated with poorer overall survival.

CONCLUSION:

Therefore, DEPDC1 upregulation in gastric adenocarcinoma is associated with tumor development and poor clinical outcomes of the patients, implying DEPDC1 might be a potential therapeutic target against gastric cancer.

Keywords

DEPDC1 gastric cancer proliferation TCGA

1. Introduction

Gastric cancer is one of the most common and leading causes of cancer death worldwide [1]. It is a complex and aggressive disease in which the five-year survival rates in the advanced stages of the disease are only 5–30% [2]. The incidence of gastric cancer in East Asia is even higher than the other parts of the world. The disease is difficult to manage, especially when diagnosed at advanced stages, which is reflected in high rates of local recurrence after surgical resection [3]. Gastric carcinogenesis is a multi-step process [4]. Understanding the mechanisms associated with local invasion and distant metastasis is critical in early diagnosis and managing prognosis of the disease.

DEP domain containing 1 (DEPDC1) as a highly conserved protein, was first found to be aberrantly upregulated in bladder cancer not many years ago [5, 6]. The protein which originally plays an important role in bladder cancer cell growth, has now been confirmed presenting in other types of cancers, including multiple myeloma [7], breast cancer [8], hepatocellular carcinoma [9], lung cancer [10], colorectal cancer [11], nasopharyngeal carcinoma [12] and glioblastoma [13]. Knockdown of DEPDC1 inhibits growth of human bladder cancer and myeloma cell lines, and its upregulation is associated with shortened patients’ survival [5, 7]. The DEPDC1-294 epitope peptide vaccine has also been used in bladder cancer [14]. DEPDC1 is located on chromosome 1p31.2 spanning an approximately 23 kb genomic region. The main function of protein-containing DEP domains include cell membrane anchoring, signal transduction, cell polarity establishment, and regulation of small GTP enzyme activity [13].

Despite DEPDC1 contains a highly conserved DEP domain, its pathophysiologic roles in growth of human cancer cells have not been investigated. The objective of this study was to investigate the pathophysiological roles of DEPDC1 in gastric cancer. Our previous work have indicated that DEPDC1 is highly expressed in gastric cancer cells compare to its normal adjacent tissues, and cell proliferation assay showed cells interfered with DEPDC1 siRNA had decreased rate of cell proliferation. We therefore carried out cell functional tests to verify the function of DEPDC1 in gastric carcinogenesis, by interfering or overexpressing DEPDC1 in gastric cancer cell lines. In this study, the expression and function of DEPDC1 in gastric cancer cells will be thoroughly studied, which hopefully provide novel theoretical basis for the prognosis and treatment of gastric cancer.

2. Materials and methods

2.1 Cell culture and sample collection

Gastric adenocarcinoma cell lines AGS and MGC803 were obtained from China Centre for Type Culture Collection (Shanghai, China). These two wild-type cancer cell lines were routinely cultured in Gibco DMEM (ThermoFisher Scientific, MA, USA) and RPMI-1640 (Life Technologies Corporation, USA) supplemented with 10% foetal calf serum (FCS; PAA Laboratories, Somerset, UK), penicillin and streptomycin (Sigma-Aldrich Inc, Poole, Dorset, UK), in an incubator at 37.0C, 5% CO ${}_{2}$ and 95% humidity until use. 20 pairs of gastric adenocarcinoma tissues and their corresponding adjacent tissue samples were analyzed. Pathologically confirmed specimens were collected during surgery or biopsy from patients administered to Yantai Yuhuangding hospital (Shandong, China) and kept in liquid nitrogen within 30 min after the tissue was assembled and then transferred for storage at $-$ 80 ${}^{\circ}$ C until RNA extraction. Para-cancerous tissues were collected 2cm away from the margin where tissue were negative for pathology examination. All patients were clearly informed, and consent was concluded and signed under inspection of the Ethics Committee of Yantai Yuhuangding Hospital, in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki).

2.2 Plasmids and transfection

DEPDC1-flag and control vector plasmids were purchased from GeneChem (Shanghai, China). The siRNAs against DEPDC1 and control siRNA were synthesized by Shanghai GeneChem (Shanghai, China). 1 $\mu$ g of plasmids was transfected into MGC803 using the XtremeGENE HP DNA Transfection Reagent (Roche Diagnostics GmbH, Mannheim, Germany) according to manufacturer’s instructions. AGS cells were transfected with DEPDC1-siRNA or corresponding control vector, respectively, for RNA interference experiments.

2.3 RNA extraction and RT-PCR

Total RNA was extracted from AGS and MGC803 cells with Trizol (Tianwei, Beijing, China) following the manufacturer’s protocols. cDNAs were synthesized using the TransScript First-Strand cDNA Synthesis SuperMix (Transgen Biotech, Beijing, China). PCR amplifications were performed using Ex Taq hot start version (Takara Bio Inc., Otsu, Japan) following the manufacturer’s instructions. Primers were designed using Primer Premier 5 (San Francisco, CA, USA). Primers were as follow: DEPDC1 forward GAAGCAGTGGATTGGCTTTATG, reverse TCTGGATACCTTCGTGGTAGA; $\beta$ -actin forward CTGGACTTCGAGCAAGAGATG, reverse GAGTTGAAGGTAGTTCGTGGA. The PCR products were separated on 2% agarose gel (NuSieve; FMC, Rockland, ME, USA) and visualized by Syber Green. RT-PCR was conducted with the GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, USA). The reaction consisted of 10 $\mu$ l of the Platinum SYBR Green qPCR SuperMix (Invitrogen, Waltham, MA, USA), 7 $\mu$ l of RNase/DNase free water, 2 $\mu$ l of cDNA and 0.5 $\mu$ l of each primer mix in a final volume of 20 $\mu$ l. The reaction was performed under condition of 2 min at 95 ${}^{\circ}$ C, followed by 15s at 95 ${}^{\circ}$ C and 50s at 65 ${}^{\circ}$ C for 40 cycles. All samples were normalized based on the copy numbers of $\beta$ -actin. All experiments were performed in duplicate. Data were converted into threshold cycle (Ct) values. Relative expression was calculated according to the 2 ${}^{\rm-\Delta\Delta CT}$ method.

2.4 Western blot analysis

The cells were washed three times with cold PBS, harvested using cell lysis buffer (RIPA) and cell scrapes, and quantified with BCA methods. Equal amounts of protein extracts (50 $\mu$ g) were loaded onto 10% SDS-PAGE gels and ran at 90 mV for 90 min, followed by transfer to nitrocellulose membranes at 100 mV for 60 min at room temperature. The membranes were blocked in 5% non-fat milk for 1 h and subsequently incubated with the primary anti-DEPDC1 antibody (1:1000; Abcam, Cambridge, MA, USA) and GAPDH antibody (1:2000; Santa Inc, Dallas, TX, USA)) overnight. After washing three times with 0.1% Tween 20-Trisbuffered saline (PBS-T) for 30 min, the membranes were incubated with anti-rabbit or anti-mouse secondary antibodies (1:5000; Santa Cruz Biotechnology) for 1 h. After washing with PBS-T for 30 min, the immune complexes were detected using the SuperSignal™ West Femto Maximum Sensitivity Substrate ECL kit (ThermoFisher Scientific, MA, USA).

2.5 Immunohistochemical staining of DEPDC1 in gastric specimens

Specimens were collected from patients who opted for surgical resection of gastric tumor at Yantai Yuhuangding hospital (Yantai, China) from April 2015 to December 2016. 50 pairs gastric adenocarcinoma and adjacent normal tissues were sectioned at a thickness of 3 $\mu$ m, and prepared for dewaxing and rehydration, and incubated in wet box with 3% H ${}_{2}$ O ${}_{2}$ for 10 min. The slides were then immunostained with primary antibodies anti-DEPDC1 (Abcam, Cambridge, MA, USA) at a dilution of 1:100 in a humidified box at 4C overnight, after blocking with 3% BSA. The slides were washed three times, and incubated with secondary antibody anti-rabbit (1:400, OriGene Technologies, Inc., Beijing, China) at room temperature for 30 min. Then the slides were stained with 3,3’-diaminobenzidine and counterstained with haematoxylin according to manufacturer’s instruction. After dehydration, coverslips were mounted, and immunohistochemical images were taken using Leica Camera (Leica Microsystem, Buffalo Grove, IL, United States).

2.6 Cell proliferation screening

Cells were inoculated in the 96-well and cultured (37 ${}^{\circ}$ C, 5% CO ${}_{2}$ ) till 20%–30% cell fusion was achieved. According to MOI value, viruses were added, and culture medium was changed at 12 h and continuously incubated until the expression of GFP was observed in lentiviruses and have reached the fluorescent rate of 70%–90%. Cells in logarithmic phase were digested with trypsin and resuspended for cell counting; cell inoculation density was 2000 cell/well with the culturing system of 100 $\mu$ l per well, each sample was planked three time (37 ${}^{\circ}$ C, 5% CO ${}_{2}$ ). Celigo examination was carried out every day for the next 5 days. The numbers of fluorescent cells were recorded and cell proliferation curves were plotted. Fold change was calculated by comparing the proliferation rate of NC group to DEPDC1 group. Cell proliferation was significantly inhibited if fold change was greater than two.

2.7 Flow cytometry assay

Cell cycle distribution was determined by flow cytometry after staining cells with propidium iodide (PI). In brief, floating and adherent cells were collected by trypsin digestion and low speed centrifugation, washed twice with ice-cold phosphate-buffered saline (PBS), and fixed with 70% ethanol. The cells were then treated with 50 lg/ml of RNase A and 50 lg/ml of propidium iodide for 30 min at room temperature before analyzed using a MoFlo XDP flow cytometer (Beckman Coulter, CA, USA). For apoptosis analysis, cells were stained with Annexin V-FITC and PI using the Annexin V-FITC Apoptosis Detection Kit (Sigma, Saint Louis, USA), and then subjected to FACS analysis.

Figure 1.

The Expression of DEPDC1 is upregulated in gastric adenocarcinoma. (A) The transcript level of DEPDC1 compared between gastric adenocarcinoma ( $n=$ 408) and normal ( $n=$ 211) gastric tissues was calculated using the GEPIA. (B) mRNA expression of DEPDC1 compared between gastric adenocarcinoma and normal gastric tissues. (C) Relative DEPDC1 mRNA expression in 40 cases of gastric adenocarcinoma tissues and adjacent normal gastric tissues analyzed by quantitative real-time PCR. Data shown as mean 2 ${}^{\rm-\Delta\Delta CT}$ ; DEPDC1 mRNA expression in gastric cancer tissues was significantly higher than noncancerous tissues ( $-$ 9.96 $\pm$ 0.2254 vs $-$ 14.50 $\pm$ 0.2104; $p=$ 0.0002 $<$ 0.001). (D) Densitometry analysis of representative western blot showing the expression of DEPDC1 in tumor and paired normal surrounding tissues of 3 gastric cancer patients. STAD, stomach adenocarcinoma. ${}^{*}p<$ 0.015, ${}^{**}p<$ 0.01.

2.8 Bioinformatic analysis

The mRNA expression profiles of gastric adenocarcinoma were downloaded from GEPIA (Gene Expression Profiling Interactive Analysis), which is a newly developed interactive web server for analyzing the RNA sequencing expression data of 9,736 tumors and 8,587 normal samples from the Cancer Genome Atlas (TCGA) and the Genotype-Tissue Expression (GTEx) projects, using a standard processing pipeline (http://gepia.cancer-pku.cn/) [14]. Survival analysis of patients with gastric adenocarcinoma was downloaded from the cBioPortal for Cancer Genomics datasets (http://cbioportal.org). The cBioPortal is an open-access resource for interactive exploration of multidimensional cancer genomics data sets, currently providing access to data from more than 85,000 tumor samples from 280 cancer studies [15, 16].

Figure 2.

DEPDC1 was significantly upregulated in immunohistochemical staining of gastric cancer tissues. (A) Representitive images of DEPDC1 expression in gastric cancer tissues and paracancerous tissues. Expression of DEPDC1 protein in surgically resected gastric cancer tissues (of two distinct patients) by immunohistochemical staining using anti-DEPDC1 polyclonal antibody demonstrates expression of DEPDC1 protein ( $\times$ 200 magnifications). (B) The protein level of DEPDC1 immunohistochemical staining of 25 pairs of gastric cancer tissues and paracancerous samples.

2.9 Statistical analysis

Data are presented as the mean $\pm$ standard deviation. The results of unpaired and paired samples were analyzed by independent and paired sample t-test, respectively. Kaplan-Meier (KM) curve was plotted to assess the association between the expression level of DEPDC1 and survival of patients with gastric adenocarcinoma. All statistical analyses were performed with the GraphPad prism 5 (Graphpad Software, Inc., La Jolla, CA). Statistical significance was considered significant when $p<$ 0.05. * $p<$ 0.05, ** $p<$ 0.01.

3. Results

3.1 Relationship between the mRNA levels of DEPDC1 and the clinicopathological parameters of patients with gastric adenocarcinoma

The expression of DEPDC1 mRNA level compared between gastric adenocarcinoma and normal gastric tissues was calculated using the GEPIA dataset (Gene Expression Profiling Interactive Analysis) (http://gepia. cancer-pku.cn/). The results indicated that an increased transcript level of DEPDC1 was found in gastric adenocarcinoma compared with normal gastric samples (Figs 1A and B).

To detect the expression of DEPDC1 in gastric adenocarcinoma patients, mRNA level in 40 pairs of gastric adenocarcinoma tissues and adjacent normal gastric tissues were analyzed by quantitative real-time PCR. Results show DEPDC1 mRNA was significantly up-regulated in 31 cases (77.5%) compared with adjacent normal gastric tissues ( $p=$ 0.0002 $<$ 0.001) (Fig. 1C). Western blot also showed elevated DEPDC1 level in cancerous tissues compared to its paired noncancerous tissues (Fig. 1D). These findings indicated that DEPDC1 might associate with the tumorigenesis of gastric adenocarcinoma.

3.2 Upregulated DEPDC1 is associated with advanced tumor differentiation and lymph node metastasis

To further validate the protein levels of DEPDC1 in gastric cancer, we examined the DEPDC1 expression level in gastric cancer tissues which were collected from Yantai Yuhuangding Hospital using immunohistochemistry. Immunostaining for DEPDC1 was performed in 50 pairs of paraffin-embedded tissue specimens from patients with gastric cancer in order to determine DEPDC1 expression patterns in gastric cancer tumors in comparison with adjacent normal gastric cells. Strong positive staining for DEPDC1 was frequently observed in tumor specimens, while negative to moderately positive staining was observed in tumor-adjacent paracancerous cells (Fig. 2). Of the 50 pairs of specimens enrolled for this analysis, 74% (37 out of 50) of gastric cancer tissues were positive for DEPDC1 staining and for those taken from the tumor adjacent Section 30% (15 out of 50) were positive (Fig. 2 and Table 1). The expression of DEPDC1 was significantly increased in gastric cancer tissue ( $p<$ 0.001, Table 2). Also, high level of DEPDC1 expression significantly correlated with tumor differentiation ( $x^{2}=$ 7.385, $p=$ 0.025) and lymph node metastasis ( $x^{2}=$ 3.944, $p=$ 0.047). However, this rate was not significantly influenced by factors like gender, age, tumor size, or TNM stage ( $p>$ 0.05, Table 2). These results imply that DEPDC1 is likely to be associated with regulating the progression of gastric cancer.

Table 1
Quantitative immunohistochemistry analysis of DEPDC1 expression in 50 gastric cancer tissues and its adjacent tissue

Group	DEPDC1 positive	DEPDC1 negative	$X^{2}$	$P$ value
Gastric cancer	37 (74%)	13
Adjacent tissue	15 (30%)	35	19.39	$<$ 0.001

Table 2

Clinical pathological feature of gastric cancer subjects and expression status of DEPDC1

Variables	Sample size	DEPDC1 positive rate $n$ (%)	${X}^{2}$	$p$
Age (years old)
$<$ 60	18	14 (77.8%)
$\geqslant$ 60	32	23 (71.9%)	0.015	0.904
Gender
Male	26	20 (76.9%)
Female	24	17 (70.8%)	0.241	0.624
Tumor size (cm)
$<$ 5	36	27 (75.0%)
$\geqslant$ 5	14	10 (71.4%)	0.000	1.000
TNM stage
I–II	27	21 (77.8%)
III–IV	23	16 (69.6%)	0.435	0.509
Tumor differentiation
High	7	3 (42.9%)
Middle	21	14 (66.7%)
Low	12	8 (66.7%)	7.385	0.025
Lymph node metastasis
Yes	29	25 (86.2%)
No	21	12 (57.1%)	3.944	0.047

3.3 Effect of DEPDC1 knockdown and overexpression on cell proliferation

To ensure the efficiency of gene interference and overexpression, three RNA interference targets against DEPDC1 were designed and all three groups of plasmid were mixed equally for lentiviral packaging in AGS cells. The fluorescent signal of target cells expression after transfection were scanned and counted, and proliferation curves were plotted. The results showed that the proliferation of cells in the control group (shCtrl) was normal, and the proliferation multiplied by 9.2 times on the fifth day compared with the first day (Fig. 3A); the fold change of shCtrl was regarded as 1. The proliferation of PC group (positive control group of proliferation inhibition) was significantly slowed down, and the proliferation only multipled by 0.63 times on the fifth day compared with the first day, and the fold change of shPC was 14.52. Compared with the shCtrl, DEPDC1 knockdown inhibited AGS cell proliferation by 2.02 times, which was demonstrated by the weakened fluorescent labeling on day 5 (Fig. 3A). The proliferation of MGC803 cells of the DEPDC1-exp group was multiplied by 21.6 times on the fifth day compared with the first day. DEPDC1 knockdown in AGS cells exhibited decreased cell proliferation compared with the control cells, while increased proliferation was seen in MGC803 cells where DEPDC1 was overexpressed ( $p<$ 0.01, Fig. 3B and C).

Figure 3.

Growth-inhibitory effects of DEPDC1 siRNAs on cell proliferation. (A) Signals of fluorescent protein were weakened after transfection by day 5 demonstrating proliferating role of DEPDC1 in AGS. (B) DEPDC1 knockdown inhibited AGS cell proliferation. (C) DEPDC1 overexpression increased MGC803 cell proliferation ( ${}^{**}p<$ 0.01).

3.4 DEPDC1 overexpression promotes cell cycle progression in MGC803 and AGS cells

To investigate the potential role of DEPDC1 in cell cycle progression, we next studied the cell cycle distribution at 24 h after DEPDC1 overexpression using flow cytometry. As shown in Fig. 4C, DEPDC1 significantly increased the portion of S phase in DEPDC1-overexpressing MGC803 cell lines. For MGC803 cell line, proportion of cells fixed at G0/G1 phase and S phase were 44.15% $\pm$ 3.26 and 50.38% $\pm$ 2.78 respectively, whereas in the same cell line, when DEPDC1 was overexpressed, cells fixed at G0/G1 phase and S phase were 36.04% $\pm$ 3.67 and 55.35% $\pm$ 2.90 respectively ( $p=$ 0.0037) (Fig. 4A). In contrast, the silencing of DEPDC1 resulted in cell cycle arrest in AGS cells (Fig. 4B). The average cell proportion of the si-control group were 45.06% $\pm$ 2.00 during G0/G1 phase and 52.76% $\pm$ 2.33 during S phase, whereas in si-DEPDC1 group, the number were 50.97% $\pm$ 2.28 and 43.42% $\pm$ 4.87 respectively. The effect on G2 phase was not significant.

Figure 4.

DEPDC1 overexpression promotes cell cycle progression in gastric adenocarcinoma cell line. Flow cytometric analysis of DEPDC1 overexpressed MGC803 cells (A) and DEPDC1 interfered AGS cells (B). ${}^{**}p<$ 0.01. (C) High DEPDC1 expression level was significantly associated with shorter OS of gastric adenocarcinoma patients ( $p<$ 0.05). (D) A relatively shorter DFS was plotted with high DEPDC1 expression level though there was no significant difference ( $p>$ 0.05).

3.5 High levels of DEPDC1 expression is associated with poor clinical outcome of gastric cancer patients

To further evaluate the association of DEPDC1 mRNA expression level with the survival time of patients with gastric adenocarcinoma, survival analysis was performed using data obtained from TCGA data set. Survival plot showed that high DEPDC1 mRNA level was significantly associated with poorer overall survival (OS, $p=$ 0.0413) (Fig. 4C), while it was not closely related to progression-free survival (PFS, $p=$ 0.0729) (Fig. 4D).

4. Discussion

Studies have revealed that DEPDC1 was aberrantly elevated in diverse human cancers, and most of them have proven it acted as a putative oncogene and potential therapeutic target in a variety of cancers [7, 8, 9, 10, 11, 12]. However, less is known about the biological functions and clinical significance of DEPDC1 in gastric cancer. In the present study, high expression of DEPDC1 was found in gastric cancer tissues. We report that DEPDC1 is overexpressed in majority of gastric cancer samples relative to non-tumor tissues. siRNA mediated DEPDC1 depletion leads to decrease in gastric cell line viability, and its overexpression is associated with cell cycle propulsion in two gastric cancer cell lines. The expression of DEPDC1 was significantly associated with tumor metastasis and differentiation, and high DEPDC1 level was obviously correlated with poor clinical outcome. These results indicated that DEPDC1 upregulation was associated with oncogenesis and poor clinical outcomes of the patients with gastric cancer.

Currently, functional analysis on the implication of DEPDC1 in cancer development has been conducted in a number of cancers including bladder cancer, hepatocellular carcinoma, lung cancer, colorectal cancer, nasopharyngeal carcinoma, glioblastoma and prostate cancer etc. [5, 9, 10, 11, 12, 13, 17]. In our study, knockdown of DEPDC1 expression by siRNA resulted in significant growth suppression in two gastric cancer cell lines. This is consistent with some other studies, for instance a study showed that DEPDC1 suppresses apoptosis to promote cell proliferation through the NF- $\kappa$ B signaling pathway in hepatocellular cancer cells [18]; another study showed that DEPDC1 suppression increased A20 expression, and induced a decrease intranuclear pNF $\kappa$ B and apoptosis in glioma cells [19]. We showed that DEPDC1 participates in cell cycle promotion in gastric cancer cells (Fig. 4A and B), and this is similar to previous study that carried out in breast cancer [7], but it was not proven in glioma cells [19].

GEPIA is an interactive web server for analyzing the RNA sequencing expression data of 9,736 tumors and 8,587 normal samples from the TCGA and the GTEx projects [14]. By analyzing the transcriptional profiles of DEPDC1 in GEPIA, results showed that DEPDC1 mRNA and protein expression levels were dramatically enhanced in gastric adenocarcinoma tissues (Fig. 1A and B). As confirmed in the lab, DEPDC1 was highly expressed in gastric cancer group compared with non-cancer group. Our results showed elevated DEPDC1 expression was significantly associated with shorter survival time of gastric cancer patients (Fig. 4C and D) according to data downloaded from TCGA database. The TCGA database carries massive cancer-causing genomic information to create a comprehensive atlas of cancer genomic profiles, and help investigators improve diagnostic methods, treatment standards, prevention precautions [20].

DEPDC1 overexpression drives G1 to S phase cell cycle transition in the MGC803 gastric cancer cells lines (Fig. 4A), while knockdown of DEPDC1 showed the opposite effect (Fig. 4B). The hyper-proliferation effect caused by DEPDC1 dysregulation is one of the most representitive phenotypes in gastric cancer. Previously reported data form our lab also demonstrated that DEPDC1 overexpression improved the growth, migration, invasion ability, and drove G1 to S phase cell cycle transition in breast cancer cells, and the deletion of DEPDC1 suppressed these malignant phenotypes [21]. Silencing of DEPDC1 resulted in significant reduction of proliferation, migration, invasion, and delay in cell cycle progression in nasopharyngeal carcinoma [12]. Moreover, DEPDC1 also promotes cell proliferation and tumor growth via activation of E2F signaling in prostate cancer [22]. Future study will focus on locating the protein within the complex cellular networks, so the role of DEPDC1 in cancer initiation and progression can be revealed.

In summary, the present study showed that DEPDC1 was up-regulated in gastric cancer tissues and associated with tumor development and poorer clinical outcomes of patients with gastric cancer. These results demonstrate a critical role for DEPDC1 in regulating the growth of gastric cancer cells, and provide novel thought to improve current understanding of the pathogenesis of gastric cancer.

Footnotes

Funding

This work was supported by China International Medical Foundation (Z20140615325), and Yantai Science and Technology Program (2018SFGY098).

References

Ferlay

Soerjomataram

Dikshit

Eser

Mathers

Rebelo

Parkin

D.M.

Forman

and Bray

, Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012, Int J Cancer 136 (2015), E359–386.

Correa

, Gastric cancer: Overview, Gastroenterol Clin North Am 42 (2013), 211–217.

Yakirevich

and Resnick

M.B.

, Pathology of gastric cancer and its precursor lesions, Gastroenterol Clin North Am 42 (2013), 261–284.

Correa

, A human model of gastric carcinogenesis, Cancer Res 48 (1988), 3554–3560.

Kanehira

Harada

Takata

Shuin

Miki

Fujioka

Nakamura

and Katagiri

, Involvement of upregulation of DEPDC1 (DEP domain contianing 1) in bladder carcinogenesis, Oncogene 26 (2007), 6448–6455.

Kanehira

Harada

Takata

Shuin

Miki

Fujioka

Nakamura

and Katagiri

, Cell-permeable peptide DEPDC1-ZNF224 interferes with transcriptional repression and oncogenicity in bladder cancer cells, Cancer Research 70 (2010), 5829–5839.

Kassambara

Schoenhals

Moreaux

Veyrun

J.L.

Rme

Goldschmidt

Hose

and Klein

, Inhibition of DEPDC1A, a bad prognostic marker in multiple myeloma, delays growth and induces mature plasma cell markers in malignant plasma cells, PLoS One 8 (2013), e62752.

Kretschmer

Sterner-Kock

Siedentopf

Schoenegg

Schlag

P.M.

and Kemmner

, Identification of early molecular markers for breast cancer, Mol Cancer 10 (2011), 15.

Yuan

S.G.

Liao

W.J.

, j Yang

.J.

Huang

G.J.

and Huang

Z.Q.

, DEP domain containing 1 is a novel diagnostic marker and prognostic predictor for hepatocellular carcinoma, Asian Pac J Cancer Prev 15 (2014), 10917–10922.

10.

Okayama

Kohno

Ishii

Shimada

Shiraishi

Iwakawa

Furuta

Tsuta

Shibata

Yamamoto

Watanabe

Sakamoto

Kumamoto

Takenoshita

Gotoh

Mizuno

Sarai

Kawano

Yamaguchi

Miyano

and Yokota

, Identification of genes upregulated in ALK-positive and EGFR/KRAS/ALKnegative lung adenocarcinomas, Cancer Res 72 (2012), 100–111.

11.

Miyata

Kumagai

Nagaoka

Kitaura

Kaneda

Kanazawa

Suzuki

Hamada

and Suzuki

, Clinicaopathological significance and prognostic value of Wilms’ tumor gene expression in the colorectal cancer, Cancer Biomarkers 15 (2015), 789–797.

12.

Feng

Zhang

Zhu

, Zhang

Wang

Zhu

and Bu

, DEPDC1 is required for cell cycle progression and motility in nasopharyngeal carcinoma, Oncotarget 8 (2017), 63605–63619.

13.

Stangeland

Mughal

A.A.

and Greig

, Combined expressional analysis, bioinformatics and targeted proteomics identify new potential therapeutic targets in glibolastoma stem cells, Oncotarget 6 (2015), 26192–26215.

14.

Tang

Kang

Gao

and Zhang

, GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses, Nucleic Acids Res 45 (2017), W98–W102.

15.

Cerami

Gao

Dogrusoz

Gross

Sumer

S.O.

Aksoy

B.A.

Jacobsen

Byrne

Heuer

Larsson

Antipin

Reva

Goldberg

Sander

and Schultz

, The cBio cancer genomics portal: An open platform for exploring multidimensional cancer genomics data, Cancer Discov 2 (2012), 401–404.

16.

Gao

Aksoy

Dogrusoz

Dresdner

Gross

Sumer

Sun

Jacobsen

Sinha

Larsson

Cerami

Sander

and Schultz

, Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal, Sci Signal 6 (2013), 11.

17.

Ramalho-Carvalho

Martins

J.B.

and Cekaite

, Epigenetic disruption of miR-130a promotes prostate cancer by targeting SEC23B and DEPDC1, Cancer Letter 385 (2017), 150–159.

18.

Wang

Jin

and Huang

, DEP domain containing 1 suppresses apoptosis via inhibition of A20 expression, which activates the nuclear factor κB signaling pathway in HepG2 cells, Oncology Letters 16 (2018), 949–995.

19.

Kikuchi

Sampetrean

Saya

Yoshida

and Todal

, Functional analysis of the DEPDC1 oncoantigen in malignant glioma and brain tumor initiating cells, J Neurooncol 133 (2017), 297–307.

20.

Tomczak

Czerwinska

and Wiznerowicz

, The cancer genome atlas (TCGA): An immeasurable source of knowledge, Contemp Oncol 19 (2015), A68–77.

21.

Zhao

Sui

Gong

Zhou

Chen

Gong

and Hao

, High expression of DEPDC1 promotes malignant phenotypes of breast cancer cells and predicts poor prognosis in patients with breast cancer, Frontiers in Oncology 9 (2019), 1–11.

22.

Huang

Chen

Cai

Z.P.

Chen

F.C.

Shen

H.Y.

Zhao

W.H.

Yang

S.J.

Chen

X.B.

Tang

G.X.

and Lin

, DEPDC1 promotes cell proliferation and tumor growth via activation of E2F signaling in prostate cancer, Biochemical and Biophysical Research Communications 490 (2017), 707–712.

DEPDC1 upregulation promotes cell proliferation and predicts poor prognosis in patients with gastric cancer

Abstract

BACKGROUND:

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSION:

Keywords

1. Introduction

2. Materials and methods

2.1 Cell culture and sample collection

2.2 Plasmids and transfection

2.3 RNA extraction and RT-PCR

2.4 Western blot analysis

2.5 Immunohistochemical staining of DEPDC1 in gastric specimens

2.6 Cell proliferation screening

2.7 Flow cytometry assay

3. Results

3.1 Relationship between the mRNA levels of DEPDC1 and the clinicopathological parameters of patients with gastric adenocarcinoma

3.2 Upregulated DEPDC1 is associated with advanced tumor differentiation and lymph node metastasis

Table 1 Quantitative immunohistochemistry analysis of DEPDC1 expression in 50 gastric cancer tissues and its adjacent tissue

4. Discussion

Footnotes

Funding

References

Table 1
Quantitative immunohistochemistry analysis of DEPDC1 expression in 50 gastric cancer tissues and its adjacent tissue