Circulating microRNA-762 upregulation in colorectal cancer may be accompanied by Wnt-1/ β -catenin signaling

Abstract

Colorectal cancer (CRC) has become the third most common cause of cancer-related deaths. CRC occurs because of abnormal growth of cells that can invade other tissues and cause distant metastases. Researchers have suggested that aberrant microRNA (miRNA) expression is involved in the initiation and progression of cancers. However, the key miRNAs that regulate the growth and metastasis of CRC remain unclear. The circulating miRNAs from BALB/c mice with CRC CT26 cell implantation were assayed by microarray. Then, Mus musculus (house mouse) mmu-miR-762 mimic and inhibitor were transfected to CT26 cells for analysis of cell viability, invasion, and epithelial-mesenchymal transition (EMT), cell cycle, and regulatory molecule expression. Human subjects were included for comparison the circulating Homo sapiens (human) has-miR-762 levels in CRC patients and control donors, as well as the patients with and without distant metastasis. The result for miRNA levels in mice with CRC cell implantation indicated that plasma mmu-miR-762 was upregulated. Transfection of mmu-miR-762 mimic to CT26 cells increased cell viability, invasion, and EMT, whereas transfection of mmu-miR-762 inhibitor decreased the above abilities. Cells treated with high-concentration mmu-miR-762 inhibitor induced cell cycle arrest at G0/G1 phase. However, mmu-miR-762 did not cause apoptosis of cells. Western blot analysis showed that mmu-miR-762 mimic transfection upregulated the expression of Wnt-1 and $\beta$ -catenin, as well as increased the nuclear translocation of $\beta$ -catenin. Further analysis was performed to demonstrate the correlation of miR-762 with CRC, and blood samples were collected from CRC patients and control donors. The results showed that serum has-miR-762 levels in CRC patients were higher than in control donors. Among the CRC patients ( $n=$ 20), six patients with distant metastasis showed higher serum has-miR-762 levels than patients without distant metastasis. Conclusions, the present study suggests that circulating miR-762 might be a potential biomarker for upregulation of CRC cell growth and invasion, and may be accompanied by the Wnt/ $\beta$ -catenin signaling.

Keywords

Colorectal cancer distant metastasis epithelial-mesenchymal transition (EMT)microRNA Wnt/β-catenin

1. Introduction

Colorectal cancer (CRC) is epithelial in origin and localized to the large intestine and rectum. CRC has been ranked among the top five most common cancers worldwide. Because of the aging population, westernization of diet, excessive intake of fat, reduced intake of dietary fiber, and other factors, the incidence of CRC continues to increase and has become more prevalent in younger people [1]. The most common treatment for CRC is surgery to remove the tumor before metastasis occurs, which shows a very high cure rate. Moreover, combinations of chemotherapy drugs such as 5-fluorouracil, camptothecin, bevacizumab, and cetuximab are effective for CRC treatment [2]. However, metastasis is the cause of death in most CRC cases; depending on the tumor stage, liver and lung metastases occur in 20–70% and 10–20% of cases, respectively [3]. It has been reported that approximately 50% of patients with CRC develop tumor metastases which are associated with very poor prognosis and treatment efficiency [4].

MicroRNAs (miRNAs) are non-translated RNAs that regulate gene expression by degrading mRNA or inhibiting translation [5]. This endogenous mechanism is common to animals, plants, and viruses. miRNAs have been shown to be involved in many biological processes, such as embryonic development, inflammation, cell cycle regulation, cell differentiation, apoptosis, and tumor metastasis [6]. In recent years, studies have shown that the occurrence of cancer and tumor formation are closely related to miRNA regulation of transcriptional gene expression [7] and miRNAs can be used as indicators for diagnosing cancer [8]. For example, the miRNAs involved in the development of CRC and other cancers include miR-17-5p [9], miR-21 [10], miR-31 [11], miR-92 [12], miR-198 [13], and miR-203 [14]. These miRNAs can be used as biomarkers for cancer diagnosis diagnose or targeted therapy.

Therefore, identifying miRNAs that regulate the growth of CRC and clarifying the regulation of tumor formation and metastasis may reveal disease-specific biomarkers to detect the occurrence or prognosis of cancers. These results would also provide an important foundation for the research and development of advanced treatments in new target therapy strategies. In our previous miRNA array analysis in animal experiments, we detected some miRNAs that may be involved in the growth of CRCs. Among these, plasma Mus musculus (house mouse) mmu-miR-762 was found to be upregulated in CRC CT26 cell-transplanted BALB/c mice, suggesting that miR-762 is a potential biomarker for CRC growth regulation. CT26 cells are the CRC line which have been reported with the aggressive and high metastatic activity. Therefore, we assessed the effects of mmu-miR-762 on the viability, colony formation, invasion, cell cycle, and regulatory molecules of CRC CT26 cells by transfection with miRNA mimics and inhibitors. Finally, blood samples were collected from patients with CRC, and the effects of Homo sapiens (human) has-miR-762 in control subjects and cancer cases were compared. These results by analysis in CRC cell line, mouse model, and human subjects would provide insight into the role of miR-762 in regulating CRC. Through this study, it will be used as a reference for future application of miR-762 as a potential biomarker, and even for evaluating future development of new drugs to CRC treatment.

2. Materials and methods

2.1 Cells and cell culture

CT26 cells are undifferentiated CRC cell lines produced in N-nitroso-N-methylurethane-induced BALB/c mice and possess aggressive and high metastasis activities. The cells were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). CT26 cells were cultured in RPMI-1640 medium (Gibco, Grand Island, NY, USA) supplemented with 2 mM L-glutamine and 10% heat-inactivated fetal bovine serum (FBS; Gibco) at 37 ${}^{\circ}$ C, passaged every 2–3 days with TEG solution (0.25% trypsin, 0.1% EDTA, and 0.05% glucose in Hanks’ balanced salt solution), and maintained at exponential growth.

2.2 Animal experiments and mouse miRNA arrays

BALB/c male mice (6–8 weeks old), obtained from the National Laboratory Animal Center (Taipei, Taiwan), were maintained in a pathogen-free environment and allowed free access to food and water. All animal experiments were performed according to the guidelines for the care and use of research animals (DHHS publ. NIH 85-23, revised 1996) and the animal use protocol had been reviewed and approved by the institute animal care and use committee (IACUC) of National Yang-Ming University, Taipei, Taiwan (Approval no. 100609). In order to rule out the variation interference caused by hormonal changes in female animals during the experimental period, this study used male mice for analysis. The mice were randomly divided into two groups: normal control ( $n=$ 3) and CRC CT26 cell implantation ( $n=$ 3). As shown in Fig. 1A, CT26 cells were prepared as a single-cell suspension in sterile phosphate-buffered saline (PBS) and injected subcutaneously ( $s . c .$ ) with 2 $\times$ 10 [5] cells in the back of mice. Fourteen days after tumor implantation, the tumors had grown to a diameter of 3–5 mm, and then the mice were sacrificed by cervical dislocation euthanasia and blood samples were collected from each mouse. Plasma was analyzed by miRNA array (Phalanx Biotech Group, Inc., Hsinchu, Taiwan) according to the manufacturer’s protocol. Clustering was performed to visualize the correlations among replicates and under varying sample conditions. Up- and down-regulated genes are represented in red and green colors, respectively. Standard selection criteria to identify differentially expressed miRNAs were established as log2 $|$ fold-change $|\geqslant$ 0.8 and $P<$ 0.05.

2.3 Transfection of mmu-miR-762 mimic and inhibitor

CT26 cells were cultured in a petri dish for 4 h before transfection. miR-762 mimic and inhibitor (miR-Ribo ${}^{\text{TM}}$ miRNA, RiboBio Co., Guangzhou, China) were diluted with serum-free RPMI-1640 medium to final concentrations of 50 and 150 nM, mixed well, and incubated at room temperature (25 $\pm$ 2 ${}^{\circ}$ C) for 5 min. Next, the mmu-miR-762 mimic and inhibitor were mixed with Lipofectamine ${}^{\text{TM}}$ 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA), incubated for 20 min, and added to cultured CT26 cells. After 6 h, the medium was removed and fresh RPMI-1640 medium supplemented of 2 mM L-glutamine and 10% FBS was added for further culture for 24 h.

2.4 Cell viability assay

Cultured CT26 cells were collected and their viability was assayed by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma, St. Louis, MO, USA) colorimetric method. Briefly, treated cells were collected, washed with PBS, and reacted with MTT reagent (Sigma) for 2 h at 37 ${}^{\circ}$ C to allow conversion of tetrazolium salts to a colored formazan product. The optical density of each reaction was measured spectrophotometrically at 550 nm to calculate cell viability. Cell morphology was observed under an inverted microscope (Olympus, Tokyo, Japan) at a magnification of 200X.

2.5 Colony formation assay

Viable cells (10 ${}^{3}$ ) were plated into 35-mm culture dishes and allowed to grow in RPMI-1640 medium containing 20% heat-inactivated FBS and 0.3% agarose at 37 ${}^{\circ}$ C in a humidified 5% CO ${}_{2}$ incubator. After 12 days, the dishes were stained with 0.4% crystal violet and colony numbers (1 colony contained more than 50 cells) were counted.

Table 1
Characters of control donors and colorectal cancer (CRC) patients

Characters		Control ( $n=$ 20)		CRC ( $n=$ 20)
Gender		Female: 6	Male: 14	Female: 6	Male: 14
Age (year)	Mean $\pm$ SE	63.5 $\pm$ 2.0	67.0 $\pm$ 2.7	57.2 $\pm$ 4.4	64.4 $\pm$ 4.3
	Range	57–69	50–87	39–70	41–88
Diagnosis		Constipation:		Colon cancer:
		0	1	T2-T3/M0:
				3	6
		Colon polyp:		T3-T4/M1:
		0	6	0	5
		Hemorrhoid:		Rectal cancer:
		6	7	T2-T3/M0:
				3	2
				T3-T4/M1:
				0	1

Table 2

Primers used in this study

Primers	Sequences
Universal miRNA-Reverse primer	GTGCAGGGTCCGAGGT
has-miR-762-RT	GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGCTCGG
has-miR-762-F	ATTATGGGGCTGGGGCCGGG
bdi-miR159-5p-RT	GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGATTGG
bdi-miR159-5p-F	GCGGCGAGCTCCCTTCGAT

2.6 Cell invasion assay

Assays of cell invasion properties were performed using a modified Boyden chamber with polyethylene terephthalate filter inserts coated with a Matrigel matrix in 24-well plates containing 8-mm pores. Briefly, the cells were suspended in serum-free medium containing 0.5% bovine serum albumin. These cells were plated into the upper chamber followed by filling the lower chamber with the same medium with or without miR-762 mimic and inhibitor. Cells were incubated for 24 h, and then non-invading cells were gently removed. Cells on the upper side of the filter were carefully removed and cells invading the lower side were counted by microscopic examination (100X, Olympus). For quantification, 10% acetic acid (100 $\mu$ L/well) was used to dissolve stained cells, which were transferred to 96-well plates for spectrophotometric measurement at 560 nm. For epithelial-mesenchymal transition (EMT) assay, the expression of vimentin and E-cadherin was performed by western blot analysis.

2.7 Cell cycle and sub-G1 assay

The treated CT26 cells were collected, washed with PBS, fixed, and permeated with ice-cold 70% ethanol overnight, followed by incubation with 0.1% Triton X-100, 0.2 mg/mL RNaseA (Sigma) and staining with 20 $\mu$ g/mL propidium iodide (PI) for 30 min at 37 ${}^{\circ}$ C in the dark, and then analyzed by flow cytometry within 1 h. To determine the DNA histogram of cells, data acquisition and analysis were performed on a FACScan flow cytometer with CellQuest software (BD Biosciences, Franklin Lakes, NJ, USA).

2.8 Prediction and western blot assay of regulatory pathways

The targeted genes regulated by miR-762 were predicted by the MIRDB (http://mirdb.org/miRDB/policy. html) and TargetScan systems (http://www.targetscan. org/mmu_61/), while regulatory pathways were analyzed using DAVID Bioinformatics Resources software (NIAID/NIH, http://david.abcc.nciferf.gov/home.jsp). For western blot analysis of predicted molecule expression, the treated CT26 cells were cultured for 24 h, scraped cells from the culture dish, protein extraction by cell lysis, and subjected to gel electrophoresis on 10% (wt/vol) SDS-polyacrylamide gels. Protein samples were transferred onto polyvinylidene fluoride (PVDF) membranes. Primary antibodies (including vimentin, E-cadherin, Wnt-1, $\beta$ -catenin, and MMP-9) and secondary antibodies (horseradish peroxidase-conjugated goat anti-mouse or anti-rabbit IgG) were subsequently added to the PVDF membrane for blotting, followed by enhanced chemiluminescence (ECL; Visual protein, Taipei, Taiwan) and the membrane was examined by ECL spectrophotometry (Perkin Elmer, Geliance 600 Camera Imaging system, Waltham, MA, USA). GAPDH was used as an internal control.

2.9 Patients and data collection

The protocols for obtaining clinical samples and information were approved by the Institutional Review Board of National Taiwan University Hospital Yunlin Branch (No. 201611007RINB). Written informed consent to participate in this study was obtained from all of the individuals. This study collected blood samples from CRC patients ( $n=$ 20) and control donors ( $n=$ 20) (Table 1). CRC was diagnosed based on histological examination of surgical specimens and classified according to tumor-node-metastasis (TNM) staging (Union for International Cancer Control, UICC). Patients’ basic data were retrieved from electronic medical records and analyzed for age, gender, and tumor staging. All of the 20 CRC donors are adenocarcinoma (T2–T4, M0–M1), including colon ( $n=$ 14) and rectal ( $n=$ 6) cancers. Although CRCs typically start as a growth of tissue called a polyp, the present study included non-malignant symptom constipation ( $n=$ 1), colon polyp ( $n=$ 6), and hemorrhoid ( $n=$ 13) as control donors. The donors’ serum miRNAs were isolated with a TRIZol kit [15] and the levels of miR-762 were assessed by a real-time reverse transcription-polymerase chain reaction (RT-PCR) assay with a TaqMan ${}^{\text{TM}}$ MicroRNA Reverse Transcription Kit [16]. bdi-miR-159-3p RNA (10 ng/mL serum) was used as a control, and the primers are shown in Table 2.

2.10 Statistical analysis

The results were expressed as the mean $\pm$ standard deviation (SD) of at least three experiments. Statistical comparisons were conducted with Student’s $t$ -test or analysis of variance. A value of $p<$ 0.05 was considered to indicate a statistically significant difference. All statistical analyses were performed using SigmaStat and SigmaPlot software (Systat Software, San Jose, CA, USA).

Figure 1.

Array assay of plasma miRNA in BALB/c mice with CT26 cell implantation. (A) Animal experiment process. CT26 cells were suspension in sterile phosphate-buffered saline (PBS) and injected subcutaneously (s.c.) with 2 $\times$ 10 [5] cells in the back of mice. Fourteen days after tumor implantation, the tumors had grown to a diameter of 3–5 mm, and then the mice were sacrificed and blood samples were collected. Separate the plasma by centrifugation and analysis by miRNA array (Phalanx Biotech Group, Inc., Hsinchu, Taiwan) according to the manufacturer’s protocol. (B) Plasma mmu-miR-762 expression by miRNA array. Clustering was performed to visualize the correlations among the replicates and varying sample conditions. Up- and down-regulated genes are presented in red and green colors, respectively.

Figure 2.

(A) Viability assay, (B) Morphological observation (200X), (C) Colony assay of CT26 cells transfected with mimic and inhibitor of mmu-miR-762. Cells transfected with mmu-miR-762 mimic (150 nM) increased cell viability and colony number, while mmu-miR-762 inhibitor (50 nM and 150 nM) decreased viability and colony formation by MTT assay. CT26 cells transfected with mimic and inhibitor of mmu-miR-762 did not show altered morphology under an inverted microscope view. The results were expressed as the mean $\pm$ standard deviation (SD) for three independent experiments. Statistical comparisons were conducted with Student’s $t$ -test. * $P<$ 0.05.

Figure 3.

Invasion assay of CT26 cells transfected with mimic and inhibitor of mmu-miR-762. (A) Morphological observation of treated cells (100X), (B) Percent of invasive cells, (C) Expression of vimentin and E-cadherin by western blot analysis. Cells transfected with mmu-miR-762 mimic (150 nM) showed increased cell invasion ability, while mmu-miR-762 inhibitor (50 nM and 150 nM) decreased cell invasion. The results were expressed as the mean $\pm$ standard deviation (SD) for three independent experiments. Statistical comparisons were conducted with Student’s $t$ -test. * $P<$ 0.05.

3. Results

3.1 Expression of mmu-miR-762 in BALB/c mice implanted with CRC CT26 cells

Figure 1A shows the animal experiment flow of BALB/c mice implanted with CRC CT26 cells, and plasma samples from each group were used for miRNA array analysis. Based on the animal experimental design, differentially expressed miRNAs for each comparison were determined by clustering analysis. Standard selection criteria for identifying differentially expressed miRNAs were established at log2 $|$ fold-change $|\geqslant$ 0.8 and $p<$ 0.05. As shown in Fig. 1B, plasma mmu-miR-762 levels in CT26 cell-implanted BALB/c mice were higher than those in normal mice according to miRNA array analysis, and the log2 ratio was 2.21.

Figure 4.

(A) Apoptosis sub-G1, (B) Cell cycle assay of CT26 cells transfected with mimic and inhibitor of miR-762. Neither mmu-miR-762 mimic nor inhibitor changed the sub-G1 levels of CT26 cells analyzed by a FACScan flow cytometer. The cell cycle arrest at G0/G1 phase when CT26 cells treated with 150 nM mmu-miR-762 inhibitor. The results were expressed as the mean $\pm$ standard deviation (SD) for three independent experiments. Statistical comparisons were conducted with Student’s $t$ -test.

3.2 Viability of CRC CT26 cells transfected with mmu-miR-762 mimic and inhibitor

As shown in Fig. 2A, cells transfected with mmu-miR-762 mimic showed increased cell viability, where-as those transfected with mmu-miR-762 inhibitor showed decreased viability. However, transfection with the mimic and inhibitor of mmu-miR-762 did change the morphology of CT26 CRC cells (Fig. 2B). CT26 cells transfected with mmu-miR-762 mimic and inhibitor also showed increased and decreased colony formation, respectively, suggesting that mmu-miR-762 upregulated cell proliferation (Fig. 2C).

3.3 Invasion of CRC CT26 cells transfected with mmu-miR-762 mimic and inhibitor

As shown in Fig. 3A, cells transfected with mmu-miR-762 mimic showed increased cell invasion ability, while the mmu-miR-762 inhibitor decreased cell invasion. This suggests that mmu-miR-762 regulates specific genes related to CRC cell invasion. Additionally, mmu-miR-762 mimic transfection to CT26 cells increased vimentin and decreased E-cadherin expression, suggesting that mmu-miR-762 might upregulate EMT (Fig. 1B).

3.4 Cell cycle of CRC CT26 cells transfected with mmu-miR-762 mimic and inhibitor

Figure 4A shows that both the mmu-miR-762 mimic and inhibitor did not change sub-G1 levels in CT26 cells, suggesting that mmu-miR-762 does not regulate cell apoptosis. Moreover, cells treated with high concentration (150 nM) of mmu-miR-762 inhibitor caused cell cycle arrest at G0/G1 phase (Fig. 4B).

3.5 Signal molecule expression in CT26 cells transfected with mmu-miR-762 mimic and inhibitor

Figure 5A lists the predicted pathways that may be regulated by mmu-miR-762. The calcium signaling pathway, endocytosis, MAPK signaling pathway, and Wnt signaling pathway may be related to mmu-miR-762 regulation in CT26 cells.

Figure 5.

Wnt/ $\beta$ -catenin assay of CT26 cells transfected with mimic and inhibitor of miR-762. (A) Prediction of pathways of mmu-miR-762 assayed by DAVID Bioinformatics Resources software (NIAID/NIH), (B) Expression of Wnt-1, $\beta$ -catenin, and MMP-9 by western blotting, and (C) Nuclear and cytosolic levels of $\beta$ -catenin. The mmu-miR-762 mimic increased the expression of Wnt-1 and $\beta$ -catenin, while mmu-miR-762 inhibitor decreased the levels of these molecules. MMP-9 was not changed in either mimic- or inhibitor-transfected cells. The cytosolic and nuclear levels of transcription factor $\beta$ -catenin were both up-regulated in miR-762 mimic-transfected cells. The results were expressed as the mean $\pm$ standard deviation (SD) for three independent experiments. Statistical comparisons were conducted with Student’s $t$ -test. ${}^{*}P<$ 0.05.

Figure 6.

(A) Serum has-miR-762 expression in CRC patients and in control donors. Serum has-miR-762 expression in CRC patients ( $n=$ 20) was significantly higher than in control donors ( $n=$ 20), (B) The box plot shows the median of serum has-miR-762 expression, and the box shows the 25–75th percentile of serum has-miR-762 expression. CRC patients with distant metastasis (M1, $n=$ 6) had higher expression of serum has-miR-762 than CRC patients with no distant metastasis (M0, $n=$ 14). The results were expressed as the mean $\pm$ standard deviation (SD) for three independent experiments. Statistical comparisons were conducted with Student’s $t$ -test. ${}^{*}P<$ 0.05.

Western blot analysis showed that the mmu-miR-762 mimic increased the expression of Wnt-1 and $\beta$ -catenin, while the mmu-miR-762 inhibitor decreased the expression of these molecules (Fig. 5B). However, MMP-9 was not changed in either mimic- and inhibitor-transfected cells. Additionally, the cytosolic and nuclear levels of transcription factor $\beta$ -catenin were both up-regulated in mmu-miR-762 mimic-transfected cells (Fig. 5C), indicating that mmu-miR-762 induced the nuclear translocation of $\beta$ -catenin. The results suggest that mmu-miR-762 regulated CRC CT26 cell viability and invasion, possibly through the Wnt/ $\beta$ -catenin pathway.

3.6 Serum has-miR-762 level in CRC cancer patients

The human subject solicitation were performed form April to October, 2017. Table 1 shows the basic characters of control donors ( $n=$ 20) and CRC patients ( $n=$ 20). The CRC patients are diagnosed for the first time or relapsed, participating in this project before receiving clinical treatment. Table 2 lists the primers used for the RT-PCR assay of serum has-miR-762 levels. There were no significant differences in gender and age between the two groups. The serum has-miR-762 level in CRC cancer patients was significant higher than in control donors (Fig. 6A). Relative has-miR-762 expression in CRC patients (T2–T4, M0–M1) was 464.7 $\pm$ 142.3, while control donors showed a value of 53.2 $\pm$ 11.7 ( $p=$ 0.0073). According to the TNM staging, CRC patients with distant metastasis (M1, $n=$ 6) showed significantly higher expression of serum has-miR-762 than CRC patients without distant metastasis (M0, $n=$ 14) (M0 vs. M1, 129.2 $\pm$ 142.1 vs. 724.5 $\pm$ 872.3, $p=$ 0.019) (Fig. 6B). These results in animal, cell culture, and CRC patients suggested that has-miR-762 is a crucial factor that stimulates CRC growth and invasion, and such effects may be accompanied by the Wnt/ $\beta$ -catenin pathway.

4. Discussion

miRNAs are a group of endogenous, small (18–25-nucleotide long), and non-coding RNA molecules that regulate the expression of specific mRNAs by either translational inhibition or mRNA degradation [5]. More than 50% of miRNAs are reported to be in cancer-associated genomic break points and function as tumor suppressors or oncogenic molecules [6]. Among the cancers, most CRCs form from the normal mucosa through the adenoma stage, which is accompanied by numerous gene mutations. Our study has screened circulating mmu-miR-762 expression in mice with CRC CT26 cell implantation. Further study demonstrate that CT26 cells transfected with mmu-miR-762 mimic promoted the cell viability and invasion/EMT of CRC cells. A similar result was also seen in human subjects. Expression of mmu-miR-762 in circulation was significantly higher in clinical CRC patients than in control donors. We subsequently confirmed that mmu-miR-762 significantly increased in distant metastasis of CRC, resulting in poor prognosis. Our study of the biological roles of miR-762 in CRC development revealed that Wnt/ $\beta$ -catenin may be as a downstream signaling pathway. These findings suggest that miR-762 plays a fundamental role in colorectal cancer tumorigenesis by affecting cancer cell viability and invasion/EMT.

miR-762 is upregulated in radiation-induced tumors in mice and may affect the pathways involved in apoptosis in this context [17]. Previous studies reported abnormal miRNA expression in numerous cancers, and miR-762 overexpression has been reported in breast cancer and ovarian cancer, where it promoted cancer cell growth and metastasis [18, 19]. A previous study also demonstrated an association between miR-762 expression and oral carcinogenesis [20]. However, no studies have examined the expression and function of circulating miR-762 in CRC. In this study, CRC cell line with mmu-miR-762 transfection was frequently up-regulated the cell viability and EMT, as well as has-miR-762 detected in serum extracted from CRC patients. Overexpression of mmu-miR-762 enhanced CRC cell proliferation and invasion. The ability of miR-762 to promote cell proliferation and invasion was confirmed by both overexpression and down-regulation experiments in vitro. Therefore, our results suggest that miR-762 is a novel oncogenic RNA in CRC.

To explore the molecular mechanisms by which miR-762 enhances CRC cell growth and invasion, Wnt/ $\beta$ -catenin was predicted as a target of mmu-miR-762 in CRC cells. First, the Wnt/ $\beta$ -catenin signaling pathway was predicted to be regulated by miR-762 in previous reports [21, 22]. Second, western blot analysis showed that the miR-762 mimic increased the expression of Wnt-1 and $\beta$ -catenin. Third, the cytosolic and nuclear levels of transcription factor $\beta$ -catenin were both up-regulated in miR-762 mimic-transfected cells. However, CT26 cells transfected with the mimic and inhibitor of miR-762 did not show altered sub-G1 levels in CT26 cells. The cell cycle was arrested at G0/G1 phase in cells treated with high concentration (150 nM) of miR-762 inhibitor. Additionally, MMP-9 was not changed in either mimic- and inhibitor-transfected cells. These data suggest that mmu-miR-762 regulates CRC CT26 cell viability and invasion/EMT might accompanied by the Wnt/ $\beta$ -catenin pathway, but does not regulate apoptosis.

Although miR-762 is overexpressed in several cancers, no studies have investigated miR-762 in CRC. In this study, real-time PCR analysis of human subjects confirmed that the expression of serum has-miR-762 in CRC patients was much higher than that in control donors. There was also an association between serum has-miR-762 expression and CRC patients with distant metastasis. miR-762 exerted its regulatory effects on cell proliferation and invasion/EMT, and accompanied by affecting the Wnt/ $\beta$ -catenin signaling pathway. $\beta$ -Catenin can influence metastasis through its effects on the EMT [23]. An article reported that FOXP3 interacts with $\beta$ -catenin could induce transcription of Wnt target genes to promote cell proliferation, invasion and EMT induction [24]. The present study demonstrated a similar result in CRC that miR-762 promoted CRC cell invasion may be through the promotion of Wnt/ $\beta$ -catenin pathway according to the results of the Transwell invasion assay and EMT molecules (vimentin and E-cadherin) by Western blotting.

To confirm that human miR-762 can regulate Wnt pathway as well as mouse miR-762, we used the TargetScan microRNA target prediction which algorithm is considered the conservation among species. The target prediction results were listed of both human hsa-miR-762 target and murine mmu-miR-762 target prediction, demonstrating that the Wnt ligands may be regulated by miR-762 in both human and murine. In human, has-miR-762 has predicted to suppress Wnt family such as 7B, 2B, 3A, 9A, 5A, 10B, 3, 7A, and 11. In mmu-miR-762, it has predicted to suppress Wnt ligands 9B, 7B, 6, 10B, 10A, 4, 3A, 7A, and 8. Among these, Wnt-7B, -3A, and -10B have the genetic conservation of miR-762 binding site between human and murine 3’-UTR. Although the miR-762 has certain different target specify among human and mice, they still share some intersection in Wnt signaling. In the on-going work, further analysis of the regulation of circulating miR-762 on cancer promotion and progression in CRC patients will be advanced elucidated.

Hou et al. reported that miR-762 can downregulate the expression of a tumor suppressor protein menin through a binding site in its 3’-UTR and consequently upregulate the Wnt cell signaling pathway to promote the development of ovarian cancer [19]. Our present study first revealed that circulating miR-762 expression may be useful as a biomarker for diagnosing CRC and higher serum miR-762 expression-caused distant metastasis of patients with CRC. While patients with high expression of miR-762 may have shorter survival times than those with low expression of miR-762, survival analysis could not be performed because of the relatively small sample size and short time. Furthermore, the associations between serum miR-762 and tumor size and lymph node invasion were not thoroughly investigated. Therefore, further large-scale studies are necessary to investigate whether serum miR-762 levels can be used as a predictive and a prognostic factor of patients with CRC.

Conclusions, CT26 cell line is a highly metastatic colon cancer which possesses aggressive and invasion activities. The present study first demonstrated that the circulating mmu-miR-762 levels in CT26 cell-implanted BALB/c mice were higher than those in normal mice determined by miRNA array analysis. Then, mmu-miR-762 inhibitor was used for in vitro assay. CRC CT26 cells transfected with miR-762 inhibitor showed the elimination of cell viability, colony formation, cell invasion, and EMT. The results in mice and in cell culture indicated that miR-762 may play a certain role on CRC growth. Further analysis in human subjects also demonstrated that the serum has-miR-762 levels in CRC patients were higher than in control donors. Additionally, the CRC patients expressed distant metastasis have accompanied with higher circulating has-miR-762 levels. Finally, the present study also tried to clarify the predicted pathways related to miR-762 regulation, such as calcium signaling pathway, endocytosis, MAPK signaling pathway, and Wnt signaling pathway. Among them, we found that the miR-762 regulation is accompanied with the expression of Wnt/ $\beta$ -catenin, suggesting that Wnt/ $\beta$ -catenin may be regulated by miR-762. In the future, more analysis in clinical data is necessary to demonstrate the exact pathway on miR-762 regulation. Therefore, we suggested that miR-762 might be used as a potential biomarker for clinical diagnosis of CRC in the future. Moreover, it also be possible to develop miR-762 inhibitors or antagonists for advanced in vivo study in animals and human subjects, which may beneficial to the treatment of CRC patients.

Footnotes

Acknowledgments

This work was supported by Grants NTUHYL106. C003 from the National Taiwan University Hospital Yunlin Branch, Yunlin, Taiwan.

Conflict of interest

No potential conflicts of interest are disclosed.

Author contribution

Liao HF and Chen CY conceived and designed the experiments, Chang WM, Chen YY and Lin YF performed the experiments, Lai PS, Liao HF and Chen CY analyzed the data and wrote the paper.

References

Chang

Wen

Chen

and Jin

, Small regulatory RNAs in neurodevelopmental disorders, Hum Mol Genet 18(R1) (2009), R18–26.

Lee

J.J.

and Chu

, Sequencing of antiangiogenic agents in the treatment of metastatic colorectal cancer, Clin Colorectal Cancer 13(3) (2014), 135–44.

Amri

Bordeianou

L.G.

Sylla

and Berger

D.L.

, Variations in metastasis site by primary location in colon cancer, J Gastrointest Surg 19(8) (2015), 1522–7.

Kraus

Nabiochtchikov

Shapira

and Arber

, Recent advances in personalized colorectal cancer research, Cancer Lett 347(1) (2014), 15–21.

Wei

and Pei

, microRNAs: critical regulators in Th17 cells and players in diseases, Cell Mol Immunol 7(3) (2010), 175–81.

Bueno

M.J.

and Malumbres

, MicroRNAs and the cell cycle, Biochim Biophys Acta 1812(5) (2011), 592–601.

Calin

G.A.

and Croce

C.M.

, MicroRNA-cancer connection: the beginning of a new tale, Cancer Res 66(15) (2006), 7390–4.

Xie

Ding

Han

and Wu

, miRCancer: a microRNA-cancer association database constructed by text mining on literature, Bioinformatics 29(5) (2013), 638–44.

Zhang

Wang

Zhang

Yang

Shi

Xia

Peng

Liu

Yang

and Qin

, Elevated oncofoetal miR-17-5p expression regulates colorectal cancer progression by repressing its target gene P130, Nat Commun 3 (2012), 1291.

10.

Kanaan

Rai

S.N.

Eichenberger

M.R.

Roberts

Keskey

Pan

and Galandiuk

, Plasma miR-21: a potential diagnostic marker of colorectal cancer, Ann Surg 256(3) (2012), 544–51.

11.

E.K.

Chong

W.W.

Jin

Lam

E.K.

Shin

V.Y.

Poon

T.C.

S.S.

and Sung

J.J.

, Differential expression of microRNAs in plasma of patients with colorectal cancer: a potential marker for colorectal cancer screening, Gut 58(10) (2009), 1375–81.

12.

Motoyama

Inoue

Takatsuno

Tanaka

Mimori

Uetake

Sugihara

and Mori

, Over- and under-expressed microRNAs in human colorectal cancer, Int J Oncol 34(4) (2009), 1069–75.

13.

Wang

Liu

Cho

W.C.

and Yang

, MicroRNAs as regulator of signaling networks in metastatic colon cancer, Biomed Res Int 2015 (2015), 823620.

14.

Zhou

Wan

Spizzo

Ivan

Mathur

Fan

Xia

Calin

G.A.

Ellis

L.M.

and Lu

, miR-203 induces oxaliplatin resistance in colorectal cancer cells by negatively regulating ATM kinase, Mol Oncol 8(1) (2014), 83–92.

15.

Marabita

de Candia

Torri

Tegnér

Abrignani

and Rossi

R.L.

, Normalization of circulating microRNA expression data obtained by quantitative real-time RT-PCR, Brief Bioinform 17(2) (2016), 204–212.

16.

Varkonyi-Gasic

Wood

Walton

E.F.

and Hellens

R.P.

, Protocol: a highly sensitive RT-PCR method for detection and quantification of microRNAs, Plant Methods 3 (2007), 12.

17.

Gao

Chen

Sun

et al., MiR-467a is upregulated in radiation-induced mouse thymic lymphomas and regulates apoptosis by targeting Fas and Bax, Int J Biol Sci 11(1) (2015), 109–21.

18.

Huang

Wang

et al., microRNA-762 promotes breast cancer cell proliferation and invasion by targeting IRF7 expression, Cell Prolif 48(6) (2015), 643–9.

19.

Hou

Yang

Wang

Chu

Liu

and Jiang

, miR-762 can negatively regulate menin in ovarian cancer, Onco Targets Ther 10 (2017), 2127–37.

20.

Wang

X.Y.

Gong

R.G.

et al., The expression profile of microRNAs in a model of 7,12-dimethyl-benz[a]anthrance-induced oral carcinogenesis in Syrian hamster, J Exp Clin Cancer Res 28 (2009), 64.

21.

and Hua

, Menin represses tumorigenesis via repressing cell proliferation, Am J Cancer Res 1(6) (2011), 726–39.

22.

Cao

Liu

Jiang

et al., Nuclear-cytoplasmic shuttling of menin regulates nuclear translocation of {beta}-catenin, Mol Cell Biol 29(20) (2009), 5477–87.

23.

Balasubramaniam

S.L.

Gopalakrishnapillai

Petrelli

N.J.

and Barwe

S.P.

, Knockdown of sodium-calcium exchanger 1 induces epithelial-to-mesenchymal transition in kidney epithelial cells, J Biol Chem 292(27) (2017), 11388–99.

24.

Yang

Liu

M.Y.

C.S.H.

Yang

S.L.

Wang

Zou

Dong

Long

Liu

L.Z.

Wan

I.Y.P.

Mok

Underwood

M.J.

and Chen

G.G.

, FOXP3 promotes tumor growth and metastasis by activating Wnt/β-catenin signaling pathway and EMT in non-small cell lung cancer, Mol Cancer 16(1) (2017), 124.

Circulating microRNA-762 upregulation in colorectal cancer may be accompanied by Wnt-1/ β -catenin signaling

Abstract

Keywords

1. Introduction

2. Materials and methods

2.1 Cells and cell culture

2.2 Animal experiments and mouse miRNA arrays

2.3 Transfection of mmu-miR-762 mimic and inhibitor

2.4 Cell viability assay

2.5 Colony formation assay

Table 1 Characters of control donors and colorectal cancer (CRC) patients

2.7 Cell cycle and sub-G1 assay

2.8 Prediction and western blot assay of regulatory pathways

2.9 Patients and data collection

2.10 Statistical analysis

3.1 Expression of mmu-miR-762 in BALB/c mice implanted with CRC CT26 cells

3.3 Invasion of CRC CT26 cells transfected with mmu-miR-762 mimic and inhibitor

3.4 Cell cycle of CRC CT26 cells transfected with mmu-miR-762 mimic and inhibitor

3.5 Signal molecule expression in CT26 cells transfected with mmu-miR-762 mimic and inhibitor

4. Discussion

Footnotes

Acknowledgments

Conflict of interest

Author contribution

References

Table 1
Characters of control donors and colorectal cancer (CRC) patients