LINC00668 promoted non-small lung cancer progression by miR-518c-3p/TRIP4 axis

Abstract

BACKGROUND:

Non-small lung cancer ranks first in the cancer-related death of all malignant tumors. Exploring novel biological targets is of great significance for diagnosis and therapy of NSCLC.

OBJECTIVE:

In this study, we aimed to explore the effect of LINC00668 on the biological functions of NSCLC cells and the underlying mechanism.

METHODS:

RT-qPCR assays and western blot assays were utilized to estimate the relative gene expression at mRNA and protein levels, respectively. CCK8, colony formation, wound healing, transwell, and cell apoptosis assays were employed to assess cell function. IHC and FISH assays were used to determine the gene expression in NSCLC tissues. RIP and dual-luciferase assays were conducted to validate the combination between LINC00668 and miR-518c-3p. The correlation of expression between miR-518c-3p and LINC00668 or TRIP4 was determined by Pearson correlation analysis.

RESULTS:

LINC00668 was aberrantly upregulated in NSCLC tumor tissues and cell lines. Inhibition of LINC00668 significantly suppressed tumor proliferation, migration, invasion and promoted cell apoptosis. Mechanistically, LINC00668 could bind to miR-518c-3p, thus targeting the 3’UTR of TRIP4. TRIP4 overexpression rescued the weakened cell function mediated by LINC00668 silencing.

CONCLUSIONS:

LINC00668 acted as an oncogene in NSCLC progression through miR-518c-3p/TRIP4 axis. Our study disclosed a new mechanism of LINC00668 functioned in NSCLC and may give a deeper insight of the targeted therapy of NSCLC in the future.

Keywords

Non-small lung cancer long non-coding RNA competing endogenous RNA LINC00668 TRIP4

1. Introduction

Lung cancer is one of the major death-caused malignancies that threaten the global health. According to the 2020 global cancer statistics, there were approximately 2.2 million new cases of lung cancer, ranking second, and 1.8 million deaths, ranking first [1, 2]. Non-small cell lung carcinoma (NSCLC) accounted for the majority of all histological subtypes of lung cancer [3, 4]. Regrettably, the five-year overall survival rate for NSCLC was less than 25% for all stages combined, underscoring the poor prognosis for affected individuals [5, 6]. Thus, identifying novel molecular targets for clinical diagnosis and treatment, and improving NSCLC patient prognosis were of paramount significance.

Long non-coding RNAs (lncRNAs) comprised a group of RNAs that exceed 200 nucleotides in length and lacked the capacity for protein coding or could only encode some small peptides [7, 8]. LncRNAs were categorized based on their relative location to protein-coding genes, including long intergenic non-coding RNAs (lincRNAs), natural antisense transcripts (NATs), bidirectional lncRNAs, overlapping transcripts, and sense intronic lncRNAs[9]. They participated in tumorigenesis and malignant tumor progression through various mechanisms, including chromatin modification, miRNA sponging, endogenous siRNA formation, and promoter activation [10, 11]. Recent evidence has confirmed that lncRNAs play crucial roles in the epigenetic modification of NSCLC. For example, LINC00673 sponged miR-150-5p to regulate ZEB1 expression, a key regulator of epithelial mesenchymal transition [12]. LY6K-AS promoted mitotic progression by regulating H3 lysine 4 trimethylation (H3K4me3) transcription at the promoter of kinetochore members [13]. MELTF-AS1 promoted NSCLC tumorigenesis by binding to YBX1 and modulating the activation of ANXA8 [14].

LINC00668, an oncogene in the development of numerous malignant tumors, has been identified to exhibit high expression levels and poor prognosis. For instance, LINC00668 was upregulated in breast cancer and promoted cell invasion and metastasis by interacting with SND1 [15]. LINC00668 sponged miR-118-5p and regulated USP47 expression to promote tumorigenesis and progression in colorectal cancer [16]. LINC00668 facilitated cell metastasis by binding to HuR-dependent upregulation of PKN2 in gastric cancer [17]. Nevertheless, the functional roles and underlying mechanisms of LINC00668 in NSCLC have not been thoroughly investigated. In this study, we validated the high expression of LINC00668 in NSCLC cell lines and performed loss-of-function assays, which indicated that LINC00668 promoted NSCLC progression. Through dual-luciferase report assays and RNA immunoprecipitation assays, we observed that LINC00668 sponged miR-518c-3p to competitively regulate the downstream gene TRIP4. Our findings suggested that the LINC00668/miR-518c-3p/TRIP4 axis played a pivotal role in the oncogenic progression of NSCLC. LINC00668 was potential to become a diagnostic and therapeutic biomarker in the future.

2. Materials and methods

2.1 Cell culture and transfection

The human lung epithelial cell line Beas-2B (CL-0496) and NSCLC cell lines H1703 (CL-0390), SK-MES-1 (CL-0213), H520 (CL-0402) were procured from Procell in Wuhan, China. A549 (SCSP-503), H1299 (SCSP-589), and H1975 (SCSP-597) were purchased from the cell bank of Chinese Science Academy in Shanghai, China. SPCA1 (CL0296) was obtained from Huifeng in Hunan, China. A549, H1299, and SK-MES-1 were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Rockville, USA) supplemented with 10% fetal bovine serum (FBS) and 1% Penicillin-Streptomycin (Gibco, Rockville, USA), while the Roswell Park Memorial Institute (RPMI-1640) medium (Gibco, Rockville, Maryland, USA) with the same components was used to culture SPCA1, H1975, H1703, H520, and Beas-2B. All cell lines were confirmed to be free of mycoplasma infection using MycoBlue Mycoplasma Detector (Vazyme, Nanjing, China), and cultured in a controlled environment of 37 ${{}^{\circ}}$ C and 5% CO ${}_{2}$ . To construct the overexpression plasmid pcDNA3.1-TRIP4, the cDNA encoding TRIP4 was amplified and cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, USA). The siRNA sequences used in the study were as follows: si-LINC00668, CUGUUUGUCUGCAAAGAAACAtt, si-NC: GAAGGCUGCUCGGAAUAAUtt, miR-518c-3p inhibitor: ACACUCUAAAGAGAAGCGCUUUG, inhibitor NC: CAGUACUUUUGUGUAGUACAA. Transfectionswere performed using Lipofectamine 3000 (Invitrogen, Tokyo, Japan) following the manufacturer’s instructions.

2.2 RNA extraction and quantitative real-time PCR (qRT-PCR)

The total RNA was extracted using RNAiso Plus (Invitrogen, Carlsbad, CA, USA) in a sequential manner involving trichloromethane, isopropanol, and ethanol. Subsequently, cDNA was reversely transcribed from the extracted RNA using the PrimeScript ${}^{\text{TM}}$ RT reagent Kit with gDNA Eraser (Takara, Tokyo, Japan). The qRT-PCR assays were performed on StepOnePlus (Applied Biosystems, USA) using SYBR ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ Premix Ex Taq (Takara, Tokyo, Japan). The expression levels of the genes were estimated using the 2 ${}^{-\Delta\Delta\text{CT}}$ method. The primer sequences were synthesized by Sangon Biotech (Shanghai, China), and listed as follows: LINC00668-F: GAACCCCAGGGAAAGCTGAT, LINC00668-R: CCGCCCAAGATTCCTCTAGC, TRIP4-F: GAGAGTGCTGAAGAGATACGAGA, TRIP4-R: AGATGGTC GCCTGATTTCTGC, GAPDH-F: GGAGCGAGATCCCTCCAAAAT, GAPDH-R: GGCTGTTGTCATACT TCTCATGG.

2.3 Fluorescence in situ hybridization assays (FISH)

Briefly, the fresh normal and cancerous lung tissues were processed according to the instructions of the in-situ hybridization kit (Beyotime, R0306S) after fixation, gradient dehydration, embedding, and sectioning. The final sample was imaged under inverted fluorescence microscope (Nikon, Ts-2R) after acetylation, prehybridization, probe denaturation, hybridization, and nuclear staining.

2.4 Cell proliferation assays

The cell proliferation was estimated by cell counting kit-8 assays and colony forming assays. Specifically, 5 $\times$ 10 ${}^{3}$ cells were seeded into 96-well plates per well and treated with 10 $\mu$ L CCK8 at the time points of 0, 1st, 2nd, 3rd, and 4th day. Cell viability was measured by determining the absorbance at 450 nm after 2 hours. Additionally, each well of the 6-well plate was seeded with a total of three hundred cells and incubated in the complete medium until the forming colonies could be observed by naked eyes. The medium was replaced every 5 days. Then the medium was discarded and the cells were fixed in 4% paraformaldehyde for 15 min. Following, the colonies were stained using 0.5% crystal violet (Beyotime, Shanghai, China). The detection of colony numbers was performed by the Fiji.

2.5 Cell apoptosis assay

After 48 hours of transfection, the supernatant containing the suspended cells was collected first, followed by the addition of the digested adherent cells to the corresponding flow cytometry tube. Apoptosis of the cells was assessed using the Annexin V-FITC Apoptosis Detection Kit (eBioscience, San Diego, USA), according to the manufacturer’s instructions. In brief, each sample was treated with 5 $\mu$ l of propidium iodide (PI) and 5 $\mu$ l of FITC-Annexin V to detect DNA and phosphatidylserine, respectively, and then analyzed by FACSAccuriC6 (BD, New Jersey, USA). The data was analyzed using FlowJo software (BD, New Jersey, USA).

2.6 Cell migration and invasion assays

The wound-healing assays were carried out to assess cell migration. In brief, cells were seeded into 6-well plates and incubated until they fully covered the well surface. Then, a 200 $\mu$ l pipette tip was used to scratch the overgrown cells in the center of the well. The migratory cells were imaged at the 0 h, 12 h, and 24 h time points. The transwell assays were utilized to assess cell invasion. Specifically, a total of 5 $\times$ 10 ${}^{4}$ cells in serum-free medium were added into the upper compartment of the Transwell apical chamber (Millipore, Massachusetts, USA) with Matrigel (Corning, NY, USA), while 700 $\mu$ l complete medium was added into the lower compartment. After 24 h, the medium was removed, and the cells were fixed with 400 $\mu$ L of 4% paraformaldehyde. Next, 400 $\mu$ L of 0.5% crystal violet (Beyotime, Shanghai, China) was used for staining. The cells that did not invade were removed, and the invasive cells were captured by microscopy in five fields per chamber.

2.7 Western blot assay

To extract proteins, RIPA lysis buffer (Beyotime, Shanghai, China) was used, and protein degradation during lysis was inhibited using protease inhibitor cocktail (Millipore Sigma, Darmstadt, Germany). The protein concentration was determined using the BCA Protein Assay kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. Proteins were separated by 4%–20% SurePAGE (GeneSript, Nanjing, Jiangsu, China) under constant voltage electrophoresis, and the protein gel was transferred to a PVDF membrane (Millipore, Massachusetts, USA). After the transfer, the membrane was blocked with 5% bovine serum albumin (BSA) in TBST for one hour. Subsequently, the membrane was incubated with GAPDH antibody (1:5000) and TRIP4 antibody (1:1000) overnight. These antibodies were purchased from Zen-bio, Suzhou, China. Following primary antibody incubation, HRP Goat Anti-Rabbit IgG (Beyotime, Shanghai, China) at a dilution ratio of 1:5000 was used for secondary antibody incubation. The band was then developed using Tanon ECL (Shanghai, China) and detected under Tannon 5200 (Shanghai, China) using gray scale analysis by ImageJ Software.

2.8 Dual-luciferase report assay

The pGL6-miR-linc00668-wt, pGL6-miR-linc00668-mut, pGL6-miR-TRIP4-wt, and pGL6-miR-TRIP4-mut plasmids were synthesized by General biosystems, North Carolina, USA. The pRL-TK plasmid was utilized as a renilla luciferase reporter. Co-transfection of miR-518c-3p NC (or mimic) and the wild-type plasmid (or mutant type) was performed using Lipofectamine 3000 (Invitrogen, Tokyo, Japan). Luciferase assays were conducted using the Dual-Luciferase ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ Reporter Assay System (Promega, Madison, Wisconsin, USA) according to the manufacturer’s instructions, and the results were detected by Spectra Max M5e (Molecular Devices, California, USA).

2.9 RNA Immunoprecipitation (RIP) assays

RIP assays were performed using the EZ-Magna RIP kit (Millipore, MA, USA) following the manufacturer’s instructions. The IgG antibody (Abcam, Cambridge, UK) and AGO2 antibody (Proteintech, Rosemount, USA) were combined with Magnet Protein A/G beads (Invitrogen, Carlsbad, USA), and incubated with cell lysates of H1299 and A549. Following this, the protein was digested by Protein K at 55 ${{}^{\circ}}$ C for 30 minutes. The total RNA was then extracted using phenol chloroform isoamylol (25:24:1), and the extracted RNAs were reverse transcribed to cDNA. qRT-PCR was subsequently carried out to detect the differential level of enrichment between the negative control group and the AGO2 group.

2.10 Immunohistochemistry (IHC) staining

The fresh tissues were fixed in 4% paraformaldehyde for over 24 h and then dehydrated using graded ethanol. Following, the tissue soaked in paraffin was embedded in an embedding machine and cut into sections at 4 $\mu$ m. The sections were restored using EDTA antigen repair solution and followed by 3% hydrogen peroxide solution immersion. After being blocked by 5% BSA, sections were incubated with antibodies against TRIP4 (1:200, Affinity, DF3295) overnight. Sections were washed and incubated with an HRP-conjugated goat anti-rabbit secondary antibody (Dako Denmark, K4003) for 1 h. The sections were lastly stained by hematoxylin.

2.11 Statistical analysis

The data between different experimental groups were tested for normality, and the statistical differences were observed using the unpaired student $t$ -test. All the analyses were performed using Prism 8.0. $P<$ 0.05 was defined as statistically different. Significance levels were denoted as follows: ${}^{*}P<$ 0.05, ${}^{**}P<$ 0.01, ${}^{***}P<$ 0.001. All the data were obtained from 3 independent experiments.

3. Results

3.1 LINC00668 was upregulated in NSCLC and LINC00668 knockdown suppressed biological behaviors of NSCLC cells

Figure 1.

LINC00668 was aberrantly upregulated in NSCLC and LINC00668 knockdown suppressed cell proliferation, migration, invasion, and facilitated cell apoptosis in NSCLC cell lines. A. LINC00668 was upregulated in NSCLC cell lines (A549, SPCA1, H1975, H1703, SK-MES-1, and H520) compared with Beas-2B; B. LINC00668 was upregulated in LUAD and LUSC tissues in the GEPIA database; C. LINC00668 expression was upregulated in NSCLC tissues compared to normal tissues using FISH assays; D. LINC00668 knockdown impaired the cell viability of A549 and H1299 cells through CCK8 assays; E. Suppression of LINC00668 decreased the cell colonies; F. LINC00668 inhibition accelerated cell apoptosis in NSCLC cells; G–H. LINC00668 silencing inhibited cell invasion (G) and migration (H) of A549 and H1299 cells using transwell assays and wound healing assays respectively. Data were analyzed by unpaired student’s $t$ -test. ${}^{***}P<$ 0.001, ${}^{**}P<$ 0.01, ${}^{*}P<$ 0.05. Variables were presented as the Mean $\pm$ SD.

We first detected the differential expression level of LINC00668 in NSCLC cell lines compared with the normal. The qRT-PCR assays were performed, and the results demonstrated a significant upregulation of LINC00668 expression in A549, SPCA1, H1299, H1975, H1703, SK-MES-1, and H520 compared to normal pulmonary epithelial cells Beas-2B (Fig. 1A). A549 and H1299 showed the highest expression of LINC00668 and were selected for subsequent experiments. LINC00668 was upregulated in lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) compared to normal tissues according to the GEPIA database (Fig. 1B). Through FISH assays, we found there were positive signals after hybridization in tumor lung tissue in contrast to normal lung tissue (Fig. 1C).

In order to examine the biological function of LINC00668, a specific small interfering RNA (siRNA) was designed to silence LINC00668 expression. Subsequently, knockdown of LINC00668 led to a decrease in cell viability and colony formation in NSCLC, as shown in Fig. 1D and E. Moreover, cell apoptosis assays showed an increase in the rate of apoptosis in NSCLC cell lines following LINC00668 silencing, as depicted in Fig. 1F. Additionally, transwell assays suggested that LINC00668 knockdown restrained the invasion capability of A549 and H1299 cells (Fig. 1G). Furthermore, wound healing assays indicated that the downregulation of LINC00668 inhibited the migration of NSCLC cells (Fig. 1H). Overall, these findings suggested that LINC00668 silencing suppressed cell proliferation, invasion, and migration while accelerating cell apoptosis in NSCLC.

Figure 2.

LINC00668 sponged miR-518c-3p and knockdown of LINC00668 upregulated miR-518c-3p expression in NSCLC. A. miR-518c-3p had a binding locus for LINC00668 based on Starbase; B. miR-518c-3p was downregulated in 7 NSCLC cell lines (A549, SPCA1, H1299, H1975, H1703, SK-MES-1, and H520) compared with Beas-2B; C. Dual-Luciferase assays detected the luciferase activities after being co-transfected with miRNA (NC or miR-518c-3p) and luciferase reporter vectors (WT or MUT); D. miR-518c-3p was enriched by AGO2 compared to IgG in A549 and H1299 cells; E. LINC00668 knockdown upregulated miR-518c-3p expression; F. miR-518c-3p inhibition decreased miR-518c-3p expression mediated by LINC00668 silencing. Data were analyzed by unpaired student’s $t$ -test. ${}^{***}P<$ 0.001, ${}^{**}P<$ 0.01. Variables were presented as the Mean $\pm$ SD.

3.2 LINC00668 sponged miR-518c-3p and downregulation of miR-518c-3p rescued the declined cell function mediated by LINC00668 silencing in NSCLC

LncRNA-miRNA-mRNA was a crucial axis through which lncRNAs functioned in the carcinogenesis and progression of NSCLC. Using the ENCORI database, we identified miR-518c-3p as a highly potential miRNA to interact with LINC00668, and the binding site was illustrated in Fig. 2A. We further evaluated the expression of miR-518c-3p in several NSCLC cell lines and found that it was significantly downregulated in A549 and H1299 cells (Fig. 2B). Additionally, we constructed the LINC00668 mut plasmid with altered nucleotides at the binding sites for comparison, and the dual-luciferase reporter assays revealed that miR-518c-3p mimics weakened the luciferase activity in the WT group (Fig. 2C). Moreover, the RIP assays demonstrated that miR-518c-3p was significantly enriched by AGO2 compared to IgG, indicating its interaction with LINC00668 (Fig. 2D). Furthermore, LINC00668 knockdown significantly upregulated the expression of miR-518c-3p in A549 and H1299 cells (Fig. 2E). The qRT-PCR results further revealed that the miR-518c-3p inhibitor partially reversed the upregulation of miR-518c-3p induced by LINC00668 silencing (Fig. 2F).

Figure 3.

miR-518c-3p inhibition rescued the decreased cell function mediated by LINC00668 knockdown. A–B. miR-518c-3p suppression partly retrieved the suppressed abilities of proliferation that LINC00668 knockdown mediated in NSCLC cell lines (A: CCK8; B: colony formation); C. miR-518c-3p inhibition decreased the elevated apoptotic cells mediated by LINC00668 knockdown in A549 and H1299 cells; D–E. miR-518c-3p partially rescued the inhibited abilities of invasion (D) and migration(E) induced by LINC00668 silencing. Data were analyzed by unpaired student’s $t$ -test. ${}^{***}P<$ 0.001, ${}^{**}P<$ 0.01, ${}^{*}P<$ 0.05. Variables were presented as the Mean $\pm$ SD.

Subsequently, we conducted several rescue assays to investigate the biological function of miR-518c-3p in NSCLC cells. As shown in Fig. 3A and B, miR-518c-3p inhibition partially rescued the declined proliferation ability of NSCLC cells mediated by LINC00668 knockdown, as demonstrated by CCK8 and colony forming assays. Moreover, the inhibition of miR-518c-3p reversed the increased apoptosis rate caused by LINC00668 suppression (Fig. 3C). The wound healing and transwell assays further indicated that the repression of miR-518c-3p recovered cell migration and invasion, which had declined due to LINC00668 knockdown (Fig. 3D–F).

Figure 4.

TRIP4 was upregulated in NSCLC tumor tissues and was negatively regulated by miR-518c-3p. A. miR-518c-3p had a binding site for TRIP4 basing on Starbase; B. Dual-Luciferase assays were utilized to detect the luciferase activities in A549 and H1299 cells after transfected with miRNAs (NC, miR-518-3p) and luciferase reporter vectors (WT and MUT) respectively; C. TRIP4 interacted with miR-518c-3p by RIP detection using AGO2 antibody in A549 and H1299; D–E. miR-518-3p negatively regulated TRIP4 at mRNA (D) and protein (E) levels; F. miR-518c-3p expression was negatively correlated to LINC00668 and TRIP4 expression using Pearson correlation analysis; G. TRIP4 was upregulated in tumor tissues compared to normal in 7 paired tissues. H. The IHC staining of TRIP4 in NSCLC tumors and normal tissues. Data were analyzed by unpaired student’s $t$ -test. ${}^{***}P<$ 0.001, ${}^{**}P<$ 0.01, ${}^{*}P<$ 0.05. Variables were presented as the Mean $\pm$ SD.

3.3 TRIP4 was negatively regulated by miR-518c-3p

Figure 5.

LINC00668 silencing downregulated TRIP4 and miR-518c-3p inhibition could partly rescue such decline. A. Suppression of miR-518c-3p partially rescued the downregulated TRIP4 expression mediated by LINC00668 silencing at mRNA level in NSCLC cells; B–C. Inhibition of miR-518c-3p partially retrieved the decreasing TRIP4 mediated by LINC00668 knockdown at protein level in A549 (B) and H1299 (C) cells. D–E. The transfection of pcDNA3.1-TRIP4 was estimated by RT-qPCR (D) and western blot assays (E). Data were analyzed by unpaired student’s $t$ -test. ${}^{***}P<$ 0.001, ${}^{**}P<$ 0.01, ${}^{*}P<$ 0.05. Variables were presented as the Mean $\pm$ SD.

Figure 6.

TRIP4 rescued the impaired cell function mediated by LINC00668 downregulation in NSCLC cells. A–B. TRIP4 partly retrieved the suppressed abilities of proliferation that LINC00668 knockdown mediated in A549 and H1299 cells (A: CCK8; H: colony formation); C. TRIP4 overexpression decreased the elevated apoptotic cells mediated by the inhibition of LINC00668 in NSCLC cell lines; D–E. TRIP4 partially rescued the inhibited abilities of invasion (D) and migration(E) induced by LINC00668 knockdown. Data were analyzed by unpaired student’s $t$ -test. ${}^{***}P<$ 0.001, ${}^{**}P<$ 0.01, ${}^{*}P<$ 0.05. Variables were presented as the Mean $\pm$ SD.

TRIP4 (Thyroid hormone receptor interactor 4, TRIP4) was predicted to interact with miR 518c-3p by the Starbase database and the potential binding site was illustrated in Fig. 4A. The dual-luciferase reporter assays demonstrated that miR-518c-3p mimics significantly decreased luciferase activity in both A549 and H1299 cells (Fig. 4B). To further validate the interaction between miR-518c-3p and TRIP4, RIP assays were performed, which revealed a significantly higher enrichment of TRIP4 and miR-518c-3p by AGO2 compared with IgG, as shown in Fig. 4C. The expression of TRIP4 was found to be downregulated at both the mRNA and protein levels after transfection with miR-518c-3p mimics, and conversely, upregulated after suppression of miR-518c-3p (Fig. 4D–E). Furthermore, miR-518c-3p expression was negatively correlated to both LINC00668 and TRIP4 expression (Fig. 4F). The expression of TRIP4 was then examined in 7 NSCLC tumor tissues and normal tissues using western blot assays. As Fig. 4G revealed, TRIP4 was significantly upregulated in NSCLC tumor tissues. The same result was observed in the IHC staining of TRIP4 (Fig. 4H).

3.4 TRIP4 rescued the decreased cell function mediated by the inhibition of LINC00668

The RT-qPCR demonstrated that LINC00668 silencing significantly downregulated the expression of TRIP4 at both the mRNA and protein levels, while inhibition of miR-518c-3p partly retrieved the decreased TRIP4 expression induced by LINC00668 knockdown, as shown in Fig. 5A–C. In light of TRIP4’s potential role as a downstream gene regulated by LINC00668, we synthesized the overexpression plasmid, pcDNA3.1-TRIP4. As evidenced by Fig. 5D–E, pcDNA3.1-TRIP4 effectively elevated TRIP4 expression at both mRNA and protein levels in A549 and H1299 cell lines. Functional assays including CCK8 and colony formation assays revealed that overexpression of TRIP4 countered the inhibitory effect of LINC00668 knockdown on NSCLC cell proliferation (Fig. 6A–B). Moreover, TRIP4 partially attenuated the elevated apoptosis rate induced by LINC00668 suppression (Fig. 6C). Additionally, upregulation of TRIP4 rescued the migration and invasion abilities of NSCLC cells that were reduced by LINC00668 knockdown (Fig. 6D–E). Collectively, these findings demonstrate that LINC00668 promoted NSCLC tumorigenesis and progression through modulation of TRIP4 expression.

4. Discussion

Lung cancer was the primary cause of cancer-related deaths and posed a significant threat to global health. Recent evidence has shown that long non-coding RNAs (lncRNAs) such as MALAT1 [18], CCAT2 [19], HOTAIR [20], and others play oncogenic or suppressive roles in NSCLC, which could have clinical significance for prognosis and treatment. Among these lncRNAs, LINC00668 has been identified to play oncogenic roles in the development of many malignancies, including breast cancer [15], gastric cancer [21], glioma [17], hepatocellular carcinoma [22], and colorectal cancer [23] as well as lung cancer. For instance, STAT3-induced LINC00668 was overexpressed in patients with NSCLC, and LINC00668/miR-193a/KLF7 pathway was identified [24]. Some compounds from traditional Chinese medicine played anticancer roles through LINC00668. Ophiopogonin-B (OP-B) inhibited metastasis of A549 cells via the LINC00668/miR-432-5p/EMT axis [25]. Sodium new houttuyfonate (SNH) was found to inhibit the metastasis of NSCLC cells. The underlying mechanism may associate with the LINC00668/miR-147a/Slug axis [26]. Consistent with the existing investigations, we found that LINC00668 was significantly upregulated in NSCLC tumor tissues and cell lines. Our in vitro experiments also revealed that LINC00668 silencing significantly inhibited NSCLC cell proliferation, invasion, and migration, while promoting cell apoptosis, indicating that LINC00668 acts as an oncogene in NSCLC development.

According to the competing endogenous RNA (ceRNA) theory, lncRNAs engaged in communication and co-regulation by competing for or interacting with common microRNAs, thus leading to the degradation and inhibition of downstream genes. These microRNAs are small non-coding RNAs that play crucial roles in post-transcriptional regulation. The ceRNA theory of lncRNAs has gained widespread acceptance among a growing body of research. For example, BC069792 sponged miR-658 and miR-4739 to upregulate KCNQ4, thus inhibiting JAK2 and p-AKT to suppress breast cancer progression [27]. LncRNA TINCR sponged miR-199a-5p to upregulate USP20 mRNA stability and therefore promote PD-L1 expression in breast cancer [28]. Ferroptosis-induced lncRNA NEAT1 promoted hepatocellular carcinoma proliferation through miR-362-3p/MIOX axis [29]. Given the crucial role of ceRNA mechanism in the progression of malignancies, we hypothesized that LINC00668 could facilitate NSCLC development by sponging miRNAs. We predicted the potential miRNAs that could bind to LINC00668 using the StarBase database and identified miR-518c-3p. Through a combination of RIP assays, RT-qPCR assays, and dual-luciferase reporter assays, it was demonstrated that LINC00668 exerted a negative regulatory effect on the expression of miR-518c-3p. MiR-518c-3p has been found to be dysregulated in various types of tumors and functions as a tumor suppressor [21, 30]. Our rescue experiments showed that miR-518c-3p suppression could reverse the inhibitory effects of LINC00668 inhibition on NSCLC progression, indicating that LINC00668 acts as a sponge for miR-518c-3p. MiRNAs primarily functioned by targeting mRNAs of downstream genes [31, 32]. We predicted the potential miR-518c-3p-targeted mRNAs through the StarBase database and identified TRIP4 mRNA as a potential binding site of miR-518c-3p. TRIP4 is located in 15q22.31 and has been shown to act as an oncogene in various malignancies. For instance, TRIP4 promoted glioma progression by activating DDIT4 and mTOR signaling [33]. TRIP4 activated MAPK, PI3K/AKT, and hTERT signaling to facilitate cervical cancer growth and metastasis [34]. Additionally, TRIP4 was targeted by miR-518-3p in colorectal cancer and the latter could inhibit tumor proliferation, invasion, and migration [35]. TRIP4 facilitated the growth of melanoma by influencing the expression of COX-2 and iNOS [36]. This effect was achieved in two ways: firstly, by indirectly activating NF- $\kappa$ B signaling; secondly, by directly binding to the promoters of COX-2 and iNOS with the assistance of p300. Similar to previous investigations, we first disclosed that TRIP4 promoted lung cancer progression. In this study, we found that TRIP4 was significantly upregulated in NSCLC tumor tissues and could be negatively regulated by miR-518c-3p. Through rescue assays in vitro, it was confirmed that TRIP4 overexpression recovered the impaired cell function of NSCLC cells induced by LINC00668 knockdown, further supporting the implication of the LINC00668/miR-518c-3p/TRIP4 axis in NSCLC progression.

In conclusion, our study has shed light on the significance of lncRNA LINC00668 in the development and progression of NSCLC. Mechanistically, LINC00668 sponged miR-518c-3p, leading to the upregulation of TRIP4, which in turn contributed to the progression of NSCLC, including cell proliferation, invasion, and migration. Moreover, the study highlighted the important roles of lncRNAs and miRNAs in cancer progression, suggesting that the ceRNA mechanism may be an essential process in the development of malignant tumors. Future studies should investigate the regulatory networks involving lncRNAs, miRNAs, and mRNAs to provide a more comprehensive understanding of the pathogenic mechanisms involved in NSCLC. Ultimately, the identification of LINC00668 in NSCLC may contribute to the development of diagnostic tests, personalized medicine, prognostic indicators, therapeutic targets, and preventive strategies. However, it is essential to conduct more rigorous studies, validate these findings in larger cohorts, and engage in collaborative efforts between researchers, clinicians, and industry partners to translate the discoveries of LINC00668 into practical clinical applications.

Footnotes

Acknowledgments

This work was supported by key projects of Science and Technology Development Fund of Pukou Branch of Jiangsu Province Hospital (KJ2021-8, KJ2022-7).

Conflict of interest

The authors declare that they have no conflict of interest.

Contributions

Conception: L. Chen.

Interpretation or analysis of data: Z.B. Lu, Z.C. Xiao, Q. Wang.

Preparation of the manuscript: Z.B. Lu, Z.C. Xiao, Q. Wang.

Revision for important intellectual content: C.F, Pan, Y. Xia, W.B. Wu.

Supervision: L. Chen.

References

Hirsch

F.R.

Scagliotti

G.V.

, et al., Lung cancer: current therapies and new targeted treatments, Lancet 389(10066) (2017), 299–311.

Sung

Ferlay

, et al., Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries, CA Cancer J Clin 71 (2021), 209–249.

Rodak

Peris-Díaz

M.D.

, et al., Current Landscape of Non-Small Cell Lung Cancer: Epidemiology, Histological Classification, Targeted Therapies, and Immunotherapy, Cancers (Basel) 3(18) (2021), 4705.

Travis

W.D.

Brambilla

, et al., The 2015 World Health Organization Classification of Lung Tumors: Impact of Genetic, Clinical and Radiologic Advances Since the 2004 Classification, J Thorac Oncol 10 (2015), 1243–1260.

Miller

K.D.

Nogueira

, et al., Cancer treatment and survivorship statistics, CA Cancer J Clin 69 (2019), 363–385.

Srivastava

Mohanty

, et al., Chemokines and NSCLC: Emerging role in prognosis, heterogeneity, and therapeutics, Semin Cancer Biol 86(Pt 2) (2022), 233–246.

, et al., Emerging role of tumor-related functional peptides encoded by lncRNA and circRNA, Mol Cancer 9(1) (2020), 22.

Bach

D.H.

and Lee

S.K.

, Long noncoding RNAs in cancer cells, Cancer Lett 419 (2018), 152–166.

Knauss

J.L.

and Sun

, Regulatory mechanisms of long noncoding RNAs in vertebrate central nervous system development and function, Neuroscience 235 (2013), 200–214.

10.

Magistri

Faghihi

M.A.

, et al., Regulation of chromatin structure by long noncoding RNAs: focus on natural antisense transcripts, Trends Genet 28(8) (2012), 389–396.

11.

Zhou

Guo

, et al., The patterns of antisense long non-coding RNAs regulating corresponding sense genes in human cancers, J Cancer 12(5) (2021), 1499–1506.

12.

Zhang

, et al., Long non-coding RNA linc00673 regulated non-small cell lung cancer proliferation, migration, invasion and epithelial mesenchymal transition by sponging miR-150-5p, Mol Cancer 16(1) (2017), 118.

13.

Ali

M.M.

Di Marco

, et al., LY6K-AS lncRNA is a lung adenocarcinoma prognostic biomarker and regulator of mitotic progression, Oncogene 40(13) (2021), 2463–2478.

14.

Wang

, et al., Copy number amplification and SP1-activated lncRNA MELTF-AS1 regulates tumorigenesis by driving phase separation of YBX1 to activate ANXA8 in non-small cell lung cancer, Oncogene 41(23) (2022), 3222–3238.

15.

Qian

Zhu

, et al., Linc00668 Promotes Invasion and Stem Cell-Like Properties of Breast Cancer Cells by Interaction with SND1, Front Oncol 10 (2020), 88.

16.

Yan

Yue

, et al., LINC00668 promotes tumorigenesis and progression through sponging miR-188-5p and regulating USP47 in colorectal cancer, Eur J Pharmacol 858 (2019), 172464.

17.

Dong

, et al., LINC00668 cooperated with HuR dependent upregulation of PKN2 to facilitate gastric cancer metastasis, Cancer Biol Ther 22(4) (2021), 311–323.

18.

Goyal

Yadav

S.R.M.

, et al., Diagnostic, prognostic, and therapeutic significance of long non-coding RNA MALAT1 in cancer, Biochim Biophys Acta Rev Cancer 1875(2) (2021), 188502.

19.

Chen

Dragomir

M.P.

, et al., The Long Noncoding RNA CCAT2 Induces Chromosomal Instability Through BOP1-AURKB Signaling, Gastroenterology 159(6) (2020), 2146–2162.

20.

Yang

Peng

, et al., Long non-coding RNA HOTAIR promotes exosome secretion by regulating RAB35 and SNAP23 in hepatocellular carcinoma, Mol Cancer 18(1) (2019), 78.

21.

Liu

Wang

, et al., LINC00668 Modulates SOCS5 Expression Through Competitively Sponging miR-518c-3p to Facilitate Glioma Cell Proliferation, Neurochem Res 45(7) (2020), 1614–1625.

22.

Wang

Zhou

, et al., Genome wide investigation of the clinical implications and molecular mechanism of long noncoding RNA LINC00668 and protein coding genes in hepatocellular carcinoma, Int J Oncol 55(4) (2019), 860–878.

23.

Yan

Yue

, et al., LINC00668 promotes tumorigenesis and progression through sponging miR-188-5p and regulating USP47 in colorectal cancer, Eur J Pharmacol 858 (2019), 172464.

24.

Y.X.

Shang

Y.J.

, et al., STAT3-induced long noncoding RNA LINC00668 promotes migration and invasion of non-small cell lung cancer via the miR-193a/KLF7 axis, Biomed Pharmacother 116 (2019), 109023.

25.

Jiang

, et al., Ophiopogonin-B Suppresses Epithelial-mesenchymal Transition in Human Lung Adenocarcinoma Cells via the Linc00668/miR-432-5p/EMT Axis, J Cancer 10(13) (2019), 2849–2856.

26.

Jiang

, et al., Sodium new houttuyfonate suppresses metastasis in NSCLC cells through the Linc00668/miR-147a/slug axis, Exp Clin Cancer Res 38(1) (2019), 155.

27.

Zhang

Dong

, et al., LncRNA-BC069792 suppresses tumor progression by targeting KCNQ4 in breast cancer, Mol Cancer 22(1) (2023), 41.

28.

Wang

, et al., LncRNA TINCR impairs the efficacy of immunotherapy against breast cancer by recruiting DNMT1 and downregulating MiR-199a-5p via the STAT1-TINCR-USP20-PD-L1 axis, Cell Death Dis 14(2) (2023), 76.

29.

Zhang

Luo

, et al., Long noncoding RNA NEAT1 promotes ferroptosis by modulating the miR-362-3p/MIOX axis as a ceRNA, Cell Death Differ 29(9) (2022), 1850–1863.

30.

Cao

Chen

, et al., MiR-518c-3p alleviates endometriosis by inhibiting ectopic endometrial migration and epithelial-mesenchymal transition via targeting ZNF608. Arch Gynecol Obstet. 307(1) (2023), 205–213.

31.

Chen

, et al., lncRNA SNHG6 regulates EZH2 expression by sponging miR-26a/b and miR-214 in colorectal cancer, J Hematol Oncol 12(1) (2019), 3.

32.

Cai

Sheng

, et al., LncRNA HMMR-AS1 promotes proliferation and metastasis of lung adenocarcinoma by regulating MiR-138/sirt6 axis, Aging (Albany NY) 11(10) (2019), 3041–3054.

33.

, et al., TRIP4 transcriptionally activates DDIT4 and subsequent mTOR signaling to promote glioma progression, Free Radic Biol Med 177 (2021), 31–47.

34.

Che

, et al., TRIP4 promotes tumor growth and metastasis and regulates radiosensitivity of cervical cancer by activating MAPK, PI3K/AKT, and hTERT signaling, Cancer Lett 452 (2019), 1–13.

35.

Yang

Ren

, et al., MicroRNA-518-3p suppresses cell proliferation, invasiveness, and migration in colorectal cancer via targeting TRIP4, Biochem Cell Biol 98(5) (2020), 575–582.

36.

Hao

, et al., The Tumor-Promoting Role of TRIP4 in Melanoma Progression and its Involvement in Response to BRAF-Targeted Therapy, J Invest Dermatol 38(1) (2018), 159–170.