Long-chain noncoding RNA LINC01569 upregulates filamin A-interacting protein 1-like to prevent metastasis of triple-negative breast cancer via sponging miR-300

2.1 Data collection and analysis

Differential gene expression in human breast carcinoma (BRCA) in different molecular subtypes was analyzed using Breast Cancer Gene-Expression Miner v4.4 [19] and Hu’s subtypes. The Breast Cancer Gene-Expression Miner v4.4 and the online Kaplan–Meier Plotter database were used to determine the overall survival rates in patients with BC. The expression of LINC01569 in different clinical pathological stages was obtained using GEPIA 2.0 [20]. The association between LINC01569 and miR-300 expression or miR-300 and FILIP1L was assessed using SPSS software 22.0. The binding of miR-300 to LINC01569 was monitored using ENCORI and lncRNASNP online databases, and the interaction between FILIP1L and miR-300 was determined through the databases TargetScan, miRDB, ENCORI, and miRWalk.

2.2 Patient samples

Fresh TNBC tissues ( n = 35) were obtained from Women and Children’s Hospital, Xiamen University. The participants signed the informed consent and this study was approved by Women and Children’s Hospital, Xiamen University. All cases were collected based on a clear pathological diagnosis, and the patients had not received preoperative anticancer treatment. All experiments were approved by the ethics committee of Women and Children’s Hospital of Xiamen University (2021-XMFYBI0-073). The clinical characteristics of the patients are presented in Table S1.

2.3 Cell culture and transfection

Four human TNBC cell lines, including Hs578t, MDA-MB-468, BT549, and MDA-MB-231, and a normal mammary epithelial cell line MCF-10A were purchased from the Cell Line Bank of the Chinese Academy of Sciences. All cell lines were cultured in Dulbecco’s modified Eagle’s medium(Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) plus 100 U/mL penicillin and 0.1 mg/mL streptomycin in an atmosphere containing 5% CO₂ at 37^∘C. All cells were passaged every 3 days. For cell transfection, MDA-MB-231 and MDA-MB-468 cells were cultured in 6-well plates at 80% confluence and transfected with LINC01569 overexpressed plasmid or vector plasmid, LINC01569 siRNA or NC siRNA, NC mimic or miR-300 mimic and FILIP1L overexpressed or FILIP1L vector plasmids. PcDNA3.1 and pcDNA3.1-LINC01569 plasmids were obtained from GenePharma(Shanghai, CN). The short hairpin RNA (shRNA) targeting LINC01569 (sence: caccGG ACAGGACACTTCTTTATctcgagATAAAGAAGTGTCCTGTCC; anti-sence: aaacGGACAGGACACTTCTTTATctcgagATAAAGAAGTGTCCTGTCC) and negative control shRNA(GTCTCGCTTGGGCGAGAGTAAGTAGTGAAGCCACAGATGTACTTACTCTCGCCCAAGCGAGAC) were provided by Liaoning Biology (Wuhan, Hubei, China). miR-300 mimic, sense 5^′-UAUACAAGGGCAGACUCUCUCU-3^′ and anti-sense 5^′-AGAGAGAGUCU GCCCUUGUAUA-3^′; miR negative control, sense 5^′-UUCUCCGAACGUGUCACGU TT-3^′ and anti-sense 5^′-ACGUGACACGUUCGGAGA ATT-3^′; miR-300 inhibitor, sense 5^′-GAGAGAGUCU GCCCUUGUAU-3^′; miR-300-inhibitor NC, sense 5^′-CAGUACUUUUGUGUAGUACAA-3^′ were synthesized by RiboBio Corporation (Guangzhou, China). FILIP1L cDNA fragments were sub-cloned into the pcDNA3.1 vector, and the pcDNA3.1 vector served as the mock-vehicle. Before transfection, the cells were cultured for 24 h and then transiently transfected with the corresponding vector using Lipofectamine 3000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. After 48 h, cells transfected with the corresponding vector were harvested for subsequent experiments. Experiments were performed in triplicate.

2.4 Real-time quantitative PCR (RT-PCR)

Total RNA was extracted from TNBC tissue and cultured cells using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.), and RNA concentration was measured using the NanoDrop system. Additionally, miRNeasy Serum/Plasma Kit (QIAGEN, Germany) was used to extract total microRNAs from tissues and cells. The cDNA was synthesized from total RNA (1000 ng), respectively, using RevertAid first strand cDNA (Fermentas; Thermo Fisher Scientific, Inc.) or a TaqMan microRNA reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). Subsequently, the expression levels of LINC01569 and others were measured using RT-PCR using 10 μ L SYBR®Green PCR Master Mix (4312704, ABI, USA) or a TaqMan microRNA assay (Applied Biosystems; Thermo Fisher Scientific, Inc.) on an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific). The primes sequences are presented in Table 1. In addition, the FastStart Universal SYBR Green Master (Roche) quantified the PCR amplification products that were normalized to GAPDH and U6.

CCK-8 (HYK0301, MCE, US) was used to detect cell proliferation according to the manufacturer’s instructions. After attaining 80% confluence, the cells were washed twice with phosphate-buffered saline and separated using 0.25% trypsin to form a single-cell suspension. Cells were seeded into 96-well plates, 3000 cells/well, and cultured. After transfection for 24, 48, and 72 h, 10 μ L CCK-8 reagent (Sigma Aldrich, St Louis, Missouri, USA) was added to cells in each well and incubated for 2 h. The optical density (OD) of each well at the wavelength of 450 nm was read using a microplate reader (Beijing Potenov Technology Co., Ltd., Beijing, China). The cell viability graph was drawn with the time point as the horizontal coordinate and the OD value as the vertical coordinate. Experiments were performed at least three times.

2.6 Transwell and invasion assay

To detect cell migration capability, transwell chambers coated with and without Matrigel (Becton Dickinson, CA) were employed and utilized a 24-well transwell chamber (8 μ m; BD Biosciences). After 48 h of transfection, cells were inoculated into a 24-well plate. Each well was inoculated with 8 × 10⁴ cells. TNBC cells with different plasmids or miRNA mimics were deposited in the upper chamber in serum-free medium and 10% fetal bovine serum in the lower chamber. After 24 h, the migration cells were treated for 1 h with paraformaldehyde (4%; Beyotime) and crystalline violet (Beyotime), followed by taking pictures and counting with a microscope (100 cells) from five areas randomly selected.

2.7 Western blot

Total protein was extracted from tissues/cells using RIPA lysis buffer (Beyotime, Shanghai, CN), containing protease and phosphatase inhibitors cocktails. The BCA Protein Assay Kit (Beyotime) was used to measure protein concentrations according to the manufacturer’s protocol. An identical protein amount (20 μ g) was separated using SDS-PAGE and transferred to a polyvinylidene fluoride membrane. Subsequently, 5% skim milk was used to block the activated membrane for 1 h, and then the membrane was incubated at 4^∘C with primary antibodies against FILIP1L (ab122835, Abcam, UK), matrix metalloproteinase-9 (MMP9, GeneTex, GTX31891, USA), and matrix metalloproteinase-2 (MMP2, GeneTex, GTX55708, USA). β -actin (Sigma Aldrich, A2228, USA) was used as the internal control. Subsequently, the blots were incubated with a horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature and then were visualized using enhanced chemiluminescence western blotting detection reagents (Millipore, Billerica, MA, USA). Finally, photographs were taken using ChemiDoc™MP Imaging (Bio-Rad).

2.8 Luciferase reporter assay

The predicted binding sites of miR-300 with LINC01569-3^′UTR and FILIP1L-3^′UTR were obtained from RNA hybrid. The binding and mutant sequences were cloned into pmirGLO Dual-luciferase vectors (Gene Pharma, Shanghai, China). MDA-MB-231 and MDA-MB-468 cells were cultured in 96-well plates and subsequently co-transfected with the wild-type pmirGLO-LINC01569 reporter plasmid (LINC01569-WT, gccuguucuagaagCUUGUAUc) or the mutated type (LINC01569-MUT, gccuguucuagaagGAACAUAc) and miR-300 mimics or NC using Lipofectamine 3000. To analyze the binding between miR-300 and FILIP1L, cells were co-transfected with the FILIP1L-3^′UTR reporter plasmid (FILIP1L-WT, auauuuAGUCUGCACUUGUAUa) or the mutated type (FILIP1L-MUT, auauuuUCAGACGAGAACAUAa) and the above-listed mimics. The pRL-CMV plasmid (Renilla luciferase, Promega) were transfected together into cells with the above plasmids. Dual-Luciferase Reporter Assay System (Promega, Madison, WI USA) was used to analyze luciferase activity, which was recorded as the ratio of firefly luciferase activity to Renilla luciferase activity. Experiments were performed at least three times.

2.9 RNA pull-down assay

RNeasy Mini Kit (QIAGEN, 74104) was used for the RNA pull-down assay. Briefly, 1 × 10⁷ MDA-MB-231 and MDA-MB-468 cells were collected, lysed, and sonicated. To receive the RNA for protein binding, the RNA was bound to produce probe-coated beads for 2 h at 25^∘C, followed by incubation with a biotin-labeled miR-300 probe (Sangon Biotech, Shanghai, CN) or a negative control probe (Sangon Biotech, Shanghai, China). Then, miR-300 or oligo probes were incubated with cell lysates at 4^∘C overnight. Subsequently, the beads were washed with buffer and eluted on magnetic support. Finally, RNeasy Mini Kit (QIAGEN, 74104) was used to extract the RNA complex attached to the beads. Then, LINC01569 and FILIP1L primers were used for PCR in real-time. Total cell lysates were used as inputs and were defined as a value of 1.

OPEN IN VIEWER

All the tests were conducted at least three times. All methods were carried out in accordance with relevant guidelines and regulations in the Ethics declaration section including the Informed consent statement. The Kaplan–Meier approach was used to estimate the overall survival. All statistical analyses were performed with GraphPad 9.0 software (LaJolla, CA, USA). Different groups were compared using unpaired Student’s two-tailed t -test or one-way ANOVA. P values of 0.05 were considered significant.

3.1 LINC01569 is low expressed in TNBC cells

To investigate the effect of LINC01569 on the development of TNBC, an online database was used to determine the expression pattern of LINC01569. According to GEPIA, there was no significant difference in LINC01569 expression in healthy subjects ( n = 291) and patients with BC (BRCA, n = 1085) (Fig. S1A). Compared with normal breast-like, the expression of LINC01569 in basal-like and HER2-E subtypes were significantly reduced (Fig. S1B). In addition, a strong decrease in LINC01569 was observed in the TNBC samples (basal-like, n = 167) when compared with normal samples (normal breast, n = 571) (Fig. 1A). Similarly, a decrease in LINC01569 was observed in fresh human TNBC tissues ( n = 35), as opposed to the corresponding paired para-cancer tissues (Fig. 1B). The expression of LINC01569 in human TNBC cells, including Hs578t, MDA-MB-468, BT549, and MDA-MB-231, was also significantly reduced in comparison with MCF-10A (Fig. 1C). These data showed that the TNBC content was low for LINC01569. Furthermore, the evaluation of LINC01569 for the diagnosis and prognosis of TNBC was performed in this study. Using the GEPIA database, no association was observed between LINC01569 expression and clinicopathological stages in patients with BRCA (Fig. S1C). Moreover, LINC01569 expression status did not affect the overall survival in all breast cancer subtypes (Fig. S1D). However, LINC01569 expression was gradually decreased with the increased tumor stage of patients with TNBC (Fig. 1D). Patients with TNBC with high levels of LINC01569 have a significantly better prognosis than did those with low LINC01569 in TNBC (Fig. 1E). Therefore, LINC01569 expression in TNBC is low in comparison with normal basal-like subtype.

3.2 LINC01569 inhibits the growth and migration ability of TNBC cells

To determine whether LINC01569 affects the progression of TNBC, LINC01569-overexpressed TNBC or LINC01569-knocked TNBC cells were produced. In MDA-MB-231 and MDA-MB-468 cells, qRT-PCR was used to identify the transfection efficiency of LINC01569 overexpressing plasmid and the siRNA targeting LINC01569 (Figs. S2A and S2B). As shown in Fig. 2, it was found that cell viability was inhibited 48 and 72 h after the transfection of LINC01569 overexpression plasmid into MDA-MB-231 and MDA-MB-468 cells. However, siRNA-mediated LINC01569 knockdown significantly induced cell viability after 48 h in both cell lines (Fig. 2A and B). Additionally, the upregulation of LINC01569 markedly inhibited cell migration. The number of TNBC cells migrating to the lower chamber decreased drastically, whereas LINC01569 knockdown significantly stimulated cell migration in MDA-MB-231 and MDA-MB-468 cells (Figs. 2C and D). Therefore, LINC01569 can lessen the growth and migration capabilities of TNBC cells.

OPEN IN VIEWER

LincRNAs play a significant role in tumor migration via ceRNA. Therefore, the potential binding partner of LINC01569 was subsequently screened to better study the relevant mechanism of LINC01569 in regulating TNBC progression. Six potential target genes including hsa-miR-381-3p, hsa-miR-1323, hsa-miR-548o-3p, hsa-miR-103a-3p, hsa-miR-193a-5p, and hsa-miR-300 were screened combining the ENCORI and lncRNASNP online databases (Fig. 3A). Owing to the negative association between miR-300 and LINC01569 in the TNBC tissues, miR-300 was selected for the subsequent experiments (Fig. 3B). Moreover, miR-300 expression was remarkably increased in TNBC compared with the corresponding adjacent cancer tissues (Fig. 3C). The luciferase activity of the LINC01569 WT reporter was almost completely abrogated by the transfection of miR-300 mimics, whereas miR-300 mimics did not affect the luciferase activity of cells transfected with a LINC01569 reporter with site-directed mutation (Fig. 3D). In addition, the pull-down test further demonstrated that miR-300 is directly associated with LINC01569 (Fig. 3E). Moreover, in response to the challenge of exogenous LINC01569, miR-300 was robustly reduced, and increased significantly as LINC01569 was depleted in MDA-MB-468 cells (Fig. 3F). Thus, these data provide evidence that LINC01569 acts as a sponge of miR-300.

OPEN IN VIEWER

OPEN IN VIEWER

Rescue experiments were conducted to identify whether miR-300 influences the biological role of LINC01569 in TNBC. MDA-MB-231 and MDA-MB-468 cells were transfected with vector, LINC01569-OE plasmid, the combination of LINC01569-OE and NC mimics or the combination of LINC01569-OE and miR-300 mimics, followed by the measurement of tumor cell behaviors. As expected, the introduction of miR-300 mimics significantly reversed the decrease in cell viability caused by LINC01569 overexpression in MDA-MB-231 and MDA-MB-468 cells (Fig. 4A). Consistently, transwell experiments showed that LINC01569 overexpression significantly inhibited cell migration capability in MDA-MB-231 and MDA-MB-468 cells, whereas miR-300 mimics notably abolished the anti-migration effects of LINC01569 overexpression in TNBC cells, increasing the number of migratory cells (Fig. 4B and C). These results indicate that miR-300 upregulation can inhibit the tumor suppressive effect induced by LINC01569 overexpression in TNBC cells.

3.5 Filamin A–interacting protein 1-like (FILIP1L) is a downstream target gene of miR-300

We explored the underlying mechanism of LINC01569/miR-300 in regulating the development of TNBC. Combined with online databases such as TargetScan, miRDB, ENCORI, and miRWalk, two potential downstream targets were screened, including FILIP1L and transmembrane protein 14B (TMEM14B) (Fig. 5A). Actually, TMEM14B is at a high level in TNBC tissues compared to non-TNBC tissues (the below image) which was in contradiction with the previous findings in this study (Fig. S3). FILIP1L was selected as a downstream target gene of miR-300 for the subsequent experiments owing to the significant differential expression of FILIP1L in TNBC and non-TNBC. Based on the analysis of All RNA SEQ data, it was found that the expression level of FILIP1L in TNBC was lower in normal subjects ( n = 3604) than in patients with TNBC ( n = 783) (Fig. 5B). Furthermore, qRT-PCR results indicated a significant reduction in FILIP1L levels in TNBC tissues ( n = 35) than in adjacent normal tissues (Fig. 5C). miR-300 was negatively correlated with the expression of FILIP1L in TNBC (Fig. 5D). To ascertain the interaction between FILIP1L and miR-300, the wild-type of FILIP1L (WT-FILIP1L) was site-directed mutated and dual-luciferase reporter assay was launched. The relative luciferase activity of vector expressing WT-FILIP1L was abundantly decreased only with the transfection of miR-300 mimic, whereas the relative luciferase activity of the FILIP1L mut reporter plasmid was not influenced by miR-300 mimics (Fig. 5E). In addition, the pull-down experiment further confirmed the direct binding of miR-300 to FILIP1L (Fig. 5F). FILIP1L protein level was upregulated when cells were transfected with miR-300 inhibitor, whereas FILIP1L was downregulated when cells were transfected with miR-300 mimics in MDA-MB-231 and MDA-MB-468 cells (Fig. 5G and S4). Therefore, those findings show that FILIP1L, a downstream target gene of miR-300, is negatively regulated by miR-300 through direct binding.

OPEN IN VIEWER

To determine the association among LINC01569, miR-300, and FILIP1L in TNBC cells, FILIP1L protein levels were monitored in MDA-MB-231 and MDA-MB-468 cells after the transfection of LINC01569 overexpression plasmid alone, or LINC01569 overexpression plasmid plus miR-300 mimics. LINC01569 overexpression (OE) promoted the expression of FILIP1L, whereas miR-300 mimics could reverse the increased expression of FILIP1L caused by LINC01569 OE (Fig. S5). Consistently, miR-300 mimics reversed the anti-proliferation effects mediated by LINC01569 OE for 48 h using CCK8 assay in TNBC cells (Fig. 6A). However, FILIP1L overexpression reversed the increased cell viability of TNBC cells under the joint action of LINC01569 overexpression and miR-300 mimics compared with the corresponding control group for 48 h (Fig. 6A). Using a transwell experiment, FILIP1L overexpression further suppressed the upregulated migration and invasive capabilities of MDA-MB-231 cells and also increased the migration and invasive capabilities of MDA-MB-468 cells compared with cells transfected with the combination of LINC01569-OE plasmid, miR-300 mimics, and vector (Fig. 6B–C and S6A). Importantly, the LINC01569 overexpression-mediated decline of MMP9/MMP2 was reversed by the transfection of miR-300 mimics, which was partly restored by the transfection of exogenous FILIP1L (Fig. S6B). These data indicate that LINC01569/miR-300/FILIP1L pathway regulates the progression of TNBC, especially cell proliferation and migration.

OPEN IN VIEWER