Circ_ARHGAP32 acts as miR-665 sponge to upregulate FGF2 to promote ox-LDL induced vascular smooth muscle cells proliferation and migration

Abstract

BACKGROUND:

Circular RNA (circRNA) is considered to be an important regulator of human diseases, including atherosclerosis (AS). However, the role of circ_ARHGAP32 in AS formation needs further confirmation.

OBJECTIVE:

To explore the role of circ_ARHGAP32 in AS formation.

METHODS:

Oxidized low density lipoprotein (ox-LDL) was used to treat vascular smooth muscle cells (VSMCs) to mimic AS cell models in vitro. The expression of circ_ARHGAP32, microRNA (miR)-665, and fibroblast growth factor 2 (FGF2) was analyzed by quantitative real-time PCR. VSMCs function was measured by EdU assay, cell counting kit 8 assay and transwell assay. Protein expression was determined using western blot analysis. Dual-luciferase reporter assay and RNA pull-down assay were performed to verify RNA interaction.

RESULTS:

Circ_ARHGAP32 was highly expressed in AS patients and ox-LDL-induced VSMCs. Knockdown of circ_ARHGAP32 repressed ox-LDL-induced proliferation and migration in VSMCs. Circ_ARHGAP32 sponged miR-665 to positively regulate FGF2. MiR-665 inhibitor reversed the regulation of sh-circ_ARHGAP32 on ox-LDL-induced VSMCs proliferation and migration. MiR-665 also had a suppressive effect on the proliferation and migration of ox-LDL-induced VSMCs, and this effect could be reversed by FGF2 overexpression.

CONCLUSIONS:

Circ_ARHGAP32 might be a potential target for AS treatment, which promoted ox-LDL-induced VSMCs proliferation and migration by regulating miR-665/FGF2 network.

Keywords

Atherosclerosis circ_ARHGAP32 miR-665 FGF2

1 Introduction

Atherosclerosis (AS) is a common vascular disease, mainly due to the accumulation of lipid and complex sugars in the intima of the artery, resulting in reduced arterial elasticity and narrowing of the lumen [1, 2]. Many studies have confirmed that thickening of the arterial vessel wall to plaque formation is the main pathological feature of AS [3, 4]. Vascular smooth muscle cells (VSMCs) have been found to be abnormally activated during the formation of AS, and their massive proliferation and migration are important steps in lipid plaques formation [5 –7]. Elucidating the molecular mechanisms affecting VSMCs function may provide potential targets for AS treatment. Oxidized low density lipoprotein (ox-LDL) is considered to be an important risk factor for AS occurrence [8 –10]. At present, ox-LDL-induced VSMCs is often used to simulate AS cell models in vitro [11 –13].

Circular RNA (circRNA) is a special non-coding RNA formed by back-splicing and has a stable circular structure [14, 15]. Many evidences have demonstrated that circRNA can function as microRNA (miRNA) sponge to indirectly mediate downstream mRNA expression [16, 17]. Studies have shown that circRNA is a key regulator of human disease progression, including AS [18, 19]. At present, many circRNAs have been found to regulate VSMCs biological functions. For example, circ_0010283 facilitated VSMCs viability and migration under ox-LDL treatment through the miR-370-3p/HMGB1 axis [20]. Moreover, circ_0029589 also was discovered to promote ox-LDL-treated VSMCs proliferation and migration by increasing STIM1 via sponging miR-214-3p [21].

In a previous study, Yang et al. used microarray analysis to find that hsa_circ_0002984 (derived from ARHGAP32 gene, also named as circ_ARHGAP32) was a higher expressed circRNA in ox-LDL-stimulated VSMCs [22]. However, circ_ARHGAP32 roles in ox-LDL-stimulated VSMCs biological function remains to be further elucidated. Our study aims to explore the effect of circ_ARHGAP32 on ox-LDL-induced VSMCs function to reveal circ_ARHGAP32 roles in AS formation. By searching for miRNAs that interacted with circ_ARHGAP32 and the downstream targets, we further revealed the potential molecular mechanism of circ_ARHGAP32 regulating AS formation.

2 Materials and methods

2.1 Serum samples

In this study, 27 AS patients and 15 healthy controls who came for physical examination were recruited from Shanghai Municipal Hospital of Traditional Chinese Medicine. Their bloods were collected and centrifuged to obtain serum for later use. All participants had signed written informed consents. This study was approved by the Ethics Committee of Shanghai Municipal Hospital of Traditional Chinese Medicine.

2.2 Cell culture, treatment and transfection

Human VSMCs (ATCC, Rockville, MD, USA) were cultured in DMEM (Gibco, Grand Island, NY, USA) containing 10% FBS (Gibco) and 1% penicillin/streptomycin at 37°C with 5% CO2. For ox-LDL treatment, VSMCs were treated with 100μg/mL ox-LDL (Solarbio, Beijing, China) for 24 h.

For cell transfection, lentivirus short hairpin RNA against circ_ARHGAP32 (sh-circ_ARHGAP32), miR-665 mimic or inhibitor (anti-miR-665), pcDNA fibroblast growth factor 2 (FGF2) overexpression vector, and their controls were synthesized by GenePharma (Shanghai, China). According to the instructions of Lipofectamine 3000 (Invitrogen), cell transfection was carried out. After that, transfected cells were treated with 100μg/mL ox-LDL for 24 h.

2.3 Quantitative real-time PCR (qRT-PCR)

Total RNA was separated by Trizol reagent (Invitrogen) and was reverse-transcribed into cDNA by Reverse Transcriptase Kit (Promega, Madison, WI, USA). SYBR Green PCR Mastermix (Solarbio) was used to perform qRT-PCR with specific primers. Relative expression was counted by 2^-ΔΔCt method with GAPDH or U6 as internal control. Table 1 showed the primer sequences.

Table 1
Primer sequences used for qRT-PCR

Name Primers (5^′-3^′)

circ_ARHGAP32 Forward TCAGAAGAACAGAATGAAGTA

(hsa_circ_0002984) Reverse TTAAGAGTAAGATCTCCAGGA

ARHGAP32 Forward CCTGGGACAAATGCGTTGAAGAA

Reverse GCGGTGGTGGTGGGATAAGAGAG

FGF2 Forward TTCAAGCAGAAGAGAGAGGAGTT

Reverse AGCAGACATTGGAAGAAAAAGTA

miR-665 Forward GTATGAACCAGGAGGCTGAGGC

Reverse TGGTGTCGTGGAGTCGT

GAPDH Forward AAGGCTGTGGGCAAGGTCATC

Reverse GCGTCAAAGGTGGAGGAGTGG

U6 Forward CTCGCTTCGGCAGCACATA

Reverse CGAATTTGCGTGTCATCCT

Name	Primers (5^′-3^′)
circ_ARHGAP32	Forward	TCAGAAGAACAGAATGAAGTA
(hsa_circ_0002984)	Reverse	TTAAGAGTAAGATCTCCAGGA
ARHGAP32	Forward	CCTGGGACAAATGCGTTGAAGAA
	Reverse	GCGGTGGTGGTGGGATAAGAGAG
FGF2	Forward	TTCAAGCAGAAGAGAGAGGAGTT
	Reverse	AGCAGACATTGGAAGAAAAAGTA
miR-665	Forward	GTATGAACCAGGAGGCTGAGGC
	Reverse	TGGTGTCGTGGAGTCGT
GAPDH	Forward	AAGGCTGTGGGCAAGGTCATC
	Reverse	GCGTCAAAGGTGGAGGAGTGG
U6	Forward	CTCGCTTCGGCAGCACATA
	Reverse	CGAATTTGCGTGTCATCCT

2.4 Identification of circRNA

In subcellular localization assay, the circ_ARHGAP32, GAPDH and U6 expression was detected by qRT-PCR in the nucleus RNA and cytoplasm RNA extracted by PARIS Kit (Invitrogen) according to kit instructions.

In RNase R assay, extracted RNA was incubated with RNase R (Geneseed, Guangzhou, China) and then was used to perform qRT-PCR for analyzing circ_ARHGAP32 and linear RNA ARHGAP32 expression.

In Actinomycin D (ActD) assay, VSMCs were treated with ActD (Sigma-Aldrich, St. Louis, MO, USA). At each time point, RNA was extracted for qRT-PCR to examine circ_ARHGAP32 and linear RNA ARHGAP32 expression.

2.5 EdU assay

EdU Imaging Kit was bought from RiboBio (Guangzhou, China). Transfected VSMCs were seeded in 96-well plates. 24 h later, VSMCs were incubated with EdU solution, fixed with paraformaldehyde, and decolorized by glycine. Then, VSMCs were incubated with Apollo solution and DAPI. After washing, EdU-positive cells were observed by fluorescence microscopy and cell rate was counted by ImageJ software.

2.6 Cell counting kit 8 (CCK8) assay

VSMCs were seeded in 96-well plates (2000 cells/well) and cultured overnight. Subsequently, 10μL CCK8 solution (Solarbio) was added to each well at the indicated time points. The optical density (OD) value at 450 nm was determined by microplate reader to evaluate cell viability.

2.7 Western blot (WB) analysis

RIPA buffer (Solarbio) was used to extract the protein from VSMCs. Quantified protein was separated via 10% SDS-PAGE gel and transferred onto PVDF membranes. Membranes were treated with primary antibodies against cyclin D1 (1:1,000, ab16663), PCNA (1:1,000, ab18197, Abcam), MMP2 (1:1,000, ac92536, Abcam), FGF2 (1:10,000, ab208687, Abcam) or GAPDH (1:2,500, ab9485, Abcam), and then hatched with secondary antibodies (1:20,000, ab97051, Abcam). Protein signals were visualized using ECL Western Blotting Substrate (Solarbio). Relative expression was counted by ImageJ software with GAPDH as loading control.

2.8 Transwell assay

VSMCs re-suspended in DMEM medium were seeded into the upper of 24-well transwell chambers (Corning Inc. Corning, NY, USA). The bottom chambers were filled with serum medium. After cultured for 24 h, VSMCs that migrated to the bottom chambers were fixed with paraformaldehyde and stained with crystal violet. Five fields were randomly selected to photograph under a microscope, and the number of migrated cells was counted by ImageJ software.

2.9 Dual-luciferase reporter assay

Basing on the prediction results of online software, the wild-type or mutant-type sequences of circ_ARHGAP32 or FGF2 3’UTR were inserted into pGL3 luciferase reporter vector. Then, the circ_ARHGAP32-WT/MUT or FGF2-WT/MUT vectors were co-transfected with miR-665 mimic/miR-NC into 293T cells. Dual-Luciferase Assay System kit (Promega) was carried out to test cell luciferase activity.

2.10 RNA pull-down assay

The biotin-labeled circ_ARHGAP32-WT/MUT probe (Bio-circ_ARHGAP32-WT/MUT), FGF2-WT/MUT probe (Bio-FGF2-WT/MUT) and negative probe (Bio-NC) were obtained from GenePharma. They were incubated with Dynabeads (Invitrogen) to make probe-coated beads. VSMCs were incubated with the probe-coated beads, and then RNA complexes was isolated for qRT-PCR to analyze miR-665 enrichment.

2.11 Statistical analysis

Data were shown as means±SD and analyzed by GraphPad Prism 7.0 software. Group’s comparison was analyzed by Student’s t-test or one-way ANOVA followed by Tukey post-hoc test. Pearson correlation analysis was used to assess linear correlation. P < 0.05 indicated a significant difference.

3 Results

3.1 Circ_ARHGAP32 was upregulated in AS patients and ox-LDL-treated VSMCs

Circ_ARHGAP32 is located at chr11 with 264 bp, and is formed by back-splicing the exons 3–5 of ARHGAP32 gene (Fig. 1A). In the serum of AS patients, circ_ARHGAP32 was highly expressed compared with that in healthy controls (Fig. 1B). Besides, circ_ARHGAP32 expression was higher in VSMCs treated with ox-LDL than in non-treated control cells (Fig. 1C). In addition, we verified the circular characteristics of circ_ARHGAP32. Our data showed that circ_ARHGAP32 was mainly distributed in the cytoplasm (Fig. 1D), could resist the digestion of RNase R (Fig. 1E), and was more stable than linear RNA ARHGAP32 (Fig. 1F). These data confirmed that circ_ARHGAP32 indeed was a circRNA.

Fig. 1

Circ_ARHGAP32 expression in AS patients and ox-LDL-treated VSMCs. (A) The basic information of circ_ARHGAP32 was shown. (B) The expression of circ_ARHGAP32 was detected by qRT-PCR in the serum of AS patients and healthy control. (C) The circ_ARHGAP32 expression in VSMCs treated with or without ox-LDL was measured by qRT-PCR. Subcellular localization assay (D), RNase R assay (E) and ActD assay (F) were used to confirm the circular characteristics of circ_ARHGAP32. ^*P < 0.05.

3.2 Knockdown of circ_ARHGAP32 inhibited ox-LDL-induced proliferation and migration in VSMCs

To explore the role of circ_ARHGAP32 in AS formation, we constructed sh-circ_ARHGAP32 to silence circ_ARHGAP32 expression. As shown in Fig. 2A, the transfection of circ_ARHGAP32 only specifically reduced circ_ARHGAP32 expression without affecting linear RNA ARHGAP32 expression. Function analysis showed that ox-LDL treatment increased EdU-positive cells and the viability of VSMCs, while circ_ARHGAP32 knockdown could inhibit the EdU-positive cells and the viability in ox-LDL-induced VSMCs (Fig. 2B-C). Silenced circ_ARHGAP32 also reduced the proliferation markers (cyclin D1 and PCNA) protein expression promoted by ox-LDL in VSMCs (Fig. 2D). Also, ox-LDL treatment enhanced the number of migrated cells and MMP2 protein expression, while the transfection of sh-circ_ARHGAP32 suppressed these effects (Fig. 1E-F). Therefore, we confirmed that circ_ARHGAP32 might promote VSMCs proliferation and migration to aggravate AS formation.

Fig. 2

Circ_ARHGAP32 regulated ox-LDL-induced proliferation and migration in VSMCs. (A) The transfection efficiency of sh-circ_ARHGAP32 was confirmed by detecting circ_ARHGAP32 and linear RNA ARHGAP32 expression using qRT-PCR. (B-F) VSMCs were transfected with sh-NC or sh-circ_ARHGAP32, and then treated with ox-LDL. EdU assay (B) and CCK8 assay (C) were used to assess cell proliferation. (D) The protein expression of cyclin D1 and PCNA was detected by WB analysis. (E) Transwell assay was performed to examine cell migration. (F) MMP2 protein expression was examined by WB analysis. ^*P < 0.05.

3.3 MiR-665 could be sponged by circ_ARHGAP32

Through the online software circinteractome, we predicted the targeted miRNA for circ_ARHGAP32 and discovered that miR-665 had binding sites with circ_ARHGAP32 (Fig. 3A). Dual-luciferase reporter assay and RNA pull-down assay were performed to further confirm the interaction between circ_ARHGAP32 and miR-665. Our data suggested that miR-665 mimic only could reduce the luciferase activity of circ_ARHGAP32-WT vector without affecting that of the corresponding MUT vector (Fig. 3B), and miR-665 could be enriched in Bio-circ_ARHGAP32-WT probe rather than in Bio-circ_ARHGAP32-MUT probe (Fig. 3C). After knockdown of circ_ARHGAP32, miR-665 expression was significantly increased (Fig. 3D). Moreover, we found that miR-665 was lowly expressed in ox-LDL-induced VSMCs (Fig. 3E). In the serum of AS patients, miR-665 was downregulated, and its expression was negatively correlated with circ_ARHGAP32 expression (Fig. 3F-G). All data revealed that circ_ARHGAP32 could sponge miR-665.

Fig. 3

Circ_ARHGAP32 sponged miR-665. (A) The binding sites and designed mutant sites between circ_ARHGAP32 and miR-665 were shown. Dual-luciferase reporter assay (B) and RNA pull-down assay (C) were performed to assess the interaction between circ_ARHGAP32 and miR-665. (D) MiR-665 expression was measured by qRT-PCR in VSMCs transfected with sh-NC or sh-circ_ARHGAP32. (E) MiR-665 expression in VSMCs treated with or without ox-LDL was determined by qRT-PCR. (F) The expression of miR-665 was detected by qRT-PCR in the serum of AS patients and healthy control. (G) Pearson correlation analysis was performed to assess the correlation between circ_ARHGAP32 and miR-665. ^*P < 0.05.

3.4 Anti-miR-665 reversed the regulation of sh-circ_ARHGAP32 on proliferation and migration in ox-LDL-induced VSMCs

VSMCs were co-transfected with sh-circ_ARHGAP32 and anti-miR-665 to explore whether miR-665 was involved in the regulation of circ_ARHGAP32 on AS formation. The addition of anti-miR-665 abolished the increasing effect of sh-circ_ARHGAP32 on miR-665 expression (Fig. 4A). After the transfected VSMCs were treated with ox-LDL, we measured cell proliferation and migration. Our data showed that the inhibitory effect of circ_ARHGAP32 knockdown on EdU-positive cell rate, cell viability and the protein expression of cyclin D1 and PCNA in ox-LDL-induced VSMCs could be reversed by anti-miR-665 (Fig. 4B-D). In addition, miR-665 inhibitor also overturned the suppressive effect of sh-circ_ARHGAP32 on the number of migrated cells and MMP protein expression in ox-LDL-induced VSMCs (Fig. 4E-F). These results indicated that circ_ARHGAP32 sponged miR-665 to promote VSMCs proliferation and migration.

Fig. 4

Circ_ARHGAP32 and miR-665 regulated the proliferation and migration of ox-LDL-induced VSMCs. (A) MiR-665 expression was detected by qRT-PCR in VSMCs transfected with sh-NC, sh-circ_ARHGAP32, sh-circ_ARHGAP32 + anti-miR-NC or sh-circ_ARHGAP32 + anti-miR-665. (B-F) The transfected VSMCs were treated with ox-LDL. Cell proliferation was determined by EdU assay (B) and CCK8 assay (C). (D) WB analysis was used to test the protein expression of cyclin D1 and PCNA. (E) Cell migration was evaluated by transwell assay. (F) WB analysis was utilized for detecting MMP2 protein expression. ^*P < 0.05.

3.5 Circ_ARHGAP32 sponged miR-665 to regulate FGF2

The starBase3.0 software was used to predict the target of miR-665 to perfect the molecular mechanism of circ_ARHGAP32. As presented in Fig. 5A, miR-665 could bind with the 3’UTR of FGF2. Further analysis showed that miR-665 could reduce the luciferase activity of FGF2-WT vector rather than the FGF2-MUT vector (Fig. 5B), and miR-665 could be pull-downed by Bio-FGF2-WT probe (Fig. 5C). These data confirmed the interaction between miR-665 and FGF2. After confirmed that miR-665 mimic or inhibitor could increase or decrease miR-665 expression, respectively (Fig. 5D), we measured FGF2 mRNA and protein expression. The data indicated that FGF2 expression could be inhibited by miR-665 overexpression and promoted by miR-665 inhibition at the mRNA and protein levels (Fig. 5E-F). Additionally, FGF2 mRNA and protein expression also was upregulated in ox-LDL-induced VSMCs compared to non-treated control cells (Fig. 5G-H). In the serum of AS patients, we found that FGF2 mRNA expression was significantly increased (Fig. 5I), and it was negatively correlated with miR-665 expression and positively correlated with circ_ARHGAP32 expression (Fig. 5J-K). Knockdown of circ_ARHGAP32 remarkably inhibited the mRNA and protein expression of FGF2 in VSMCs, and this effect could be abolished by miR-665 inhibitor (Fig. 5L-M). The above data confirmed that circ_ARHGAP32 positively regulated FGF2 via sponging miR-665.

Fig. 5

Circ_ARHGAP32 sponged miR-665 to regulate FGF2. (A) The binding sites and designed mutant sites between FGF2 3’UTR and miR-665 were exhibited. The interaction between FGF2 and miR-665 was confirmed by dual-luciferase reporter assay (B) and RNA pull-down assay (C). (D) The transfection efficiency of miR-665 mimic or inhibitor was examined by detecting miR-665 expression using qRT-PCR. (E-F) The mRNA and protein expression of FGF2 was determined by qRT-PCR and WB analysis in VSMCs transfected with miR-665 mimic or inhibitor. (G-H) FGF2 mRNA and protein expression in VSMCs treated with or without ox-LDL was analyzed by qRT-PCR and WB analysis. (I) The FGF2 mRNA expression was detected by qRT-PCR in the serum of AS patients and healthy control. (J-K) The correlation between FGF2 and miR-665 or circ_ARHGAP32 was analyzed by Pearson correlation analysis. (L-M) The mRNA and protein expression of FGF2 was measured by qRT-PCR and WB analysis in VSMCs co-transfected with sh-circ_ARHGAP32 and anti-miR-665. ^*P < 0.05.

3.6 MiR-665 suppressed the proliferation and migration of ox-LDL-induced VSMCs by targeting FGF2

Subsequently, miR-665 mimic and FGF2 overexpression vector were co-transfected into VSMCs to confirm that miR-665 targeted FGF2 to mediate AS formation. After transfection, we discovered that the decreasing effect of miR-665 mimic on FGF2 mRNA and protein expression could be enhanced by the addition of FGF2 overexpression vector (Fig. 6A-B). Then, the transfected VSMCs were treated with ox-LDL. Our results revealed that miR-665 overexpression inhibited EdU-positive cell rate, suppressed cell viability, and reduced the protein expression of cyclin D1 and PCNA in ox-LDL-induced VSMCs. However, these effects could be reversed by overexpressing FGF2 (Fig. 6C-E). Meanwhile, overexpressed miR-665 also repressed the number of migrated cells and MMP2 protein expression, while FGF2 overexpression could reverse these effects (Fig. 6F-G). Hence, we confirmed that miR-665 targeted FGF2 to inhibit VSMCs proliferation and migration. Above all, our data illuminated that under ox-LDL treatment, circ_ARHGAP32 sponged miR-665 to upregulate FGF2, thereby promoting VSMCs proliferation and migration (Fig. 7).

Fig. 6

MiR-665 and FGF2 regulated the proliferation and migration of ox-LDL-induced VSMCs. (A-B) The mRNA and protein expression was detected by qRT-PCR and WB analysis in VSMCs transfected with miR-NC, miR-665, miR-665 + pcDNA or miR-665 + FGF2. (C-G) The transfected VSMCs were treated with ox-LDL. EdU assay (C) and CCK8 assay (D) were used to determine cell proliferation. (E) WB analysis was performed to examine the protein expression of cyclin D1 and PCNA. (F) Cell migration was analyzed by transwell assay. (G) MMP2 protein expression was measured using WB analysis. ^*P < 0.05.

Fig. 7

Main mechanism diagram of this study. Circ_ARHGAP32 promoted ox-LDL-treated VSMCs proliferation and migration by regulating miR-665/FGF2 axis.

4 Discussion

VSMCs proliferation and migration to the inner membrane play an essential function in AS development [23, 24]. As an important risk factor for AS occurrence, ox-LDL has been proven to simulate the in vitro AS model by inducing VSMCs proliferation and migration [25, 26]. Many evidences have confirmed that circRNA is an important regulator of AS progression. Here, we investigated the effect of circ_ARHGAP32, an upregulated circRNA in AS patients, on ox-LDL-stimulated VSMCs proliferation and migration. A recent report suggested that circ_ARHGAP32 had a promotion effect on proliferation and migration in ox-LDL-stimulated VSMCs [27]. Similar with these results, our study also pointed out that circ_ARHGAP32 had the effect of promoting proliferation and migration in VSMCs, which showed that ox-LDL-stimulated VSMCs proliferation and migration were significantly reduced after knockdown of circ_ARHGAP32. These results once again confirmed the vital role of circ_ARHGAP32 in AS formation, and suggested that targeted inhibition of circ_ARHGAP32 might be an effective treatment for AS.

More and more studies have confirmed that circRNA can function as a sponge for miRNA [28 –30]. By bioinformatics analysis, we found the complementary binding sites between circ_ARHGAP32 and miR-665. In past studies, miR-665 was discovered to have a dual role in cancers. MiR-665 could be used as a tumor promoter to enhance the proliferation and migration of many cancers, such as hepatocellular carcinoma [31], and it could also be used as a tumor suppressor to exert opposite effects, such as gastric cancer [32]. Studies had reported that miR-665 was downregulated in the patients with coronary artery disease, and its overexpression suppressed VSMCs proliferation [33]. Also, miR-665 had been found to play an inhibition effect on VSMCs proliferation, invasion and migration [34]. Here, we confirmed that miR-665 was underexpressed in AS patients. Functional analysis showed that miR-665 could inhibit ox-LDL-stimulated VSMCs proliferation and migration, suggesting that miR-665 had anti-proliferation and anti-migration effects in VSMCs, which was consistent with previous reports [33, 34]. Additionally, we confirmed that anti-miR-665 reversed the function of sh-circ_ARHGAP32, revealing that circ_ARHGAP32 indeed sponged miR-665 to regulate ox-LDL-induced VSMCs function.

FGF2 is a member of the FGF family and participates in many biological processes, such as nervous system development, wound healing and tumor growth [35, 36]. FGF2 is considered to be a proto-oncogene that promotes cell proliferation and migration in many cancers, including esophageal cancer [37] and renal cancer [38]. FGF2 had been discovered to participate in the regulation on human aortic smooth muscle cells proliferation and migration [39]. Studies have pointed out that circWDR77 increased FGF2 expression by targeting miR-124, thereby increasing VSMCs proliferation and migration [40]. In this, we confirmed that FGF2 was targeted by miR-665, and it could be positively regulated by circ_ARHGAP32. Our data showed that FGF2 was overexpressed in AS patients, and its overexpression overturned the effect of miR-665 on ox-LDL-induced VSMCs function. These data revealed that miR-665 targeted FGF2 to restrain VSMCs proliferation and migration under ox-LDL treatment, and confirmed the existence of the circ_ARHGAP32/miR-665/FGF2 axis.

In conclusion, our study showed that circ_ARHGAP32 acted as miR-665 sponge to promote FGF2 expression, which in turn promoted ox-LDL-induced VSMCs proliferation and migration. Our research provided a potential target for AS treatment, and the proposed circ_ARHGAP32/miR-665/FGF2 axis provided a basis for circ_ARHGAP32-related research.

Footnotes

Acknowledgment

None.

Disclosure of interest

The authors declare that they have no conflicts of interest.

Funding

This study was supported by: Key Subject Construction Project of Traditional Chinese Medicine of Shanghai (B01B1).

References

Schaftenaar

, Frodermann

, Kuiper

, Lutgens

. Atherosclerosis: The interplay between lipids and immune cells. Curr Opin Lipidol. 2016;27:209–215.

Milutinovic

, Suput

, Zorc-Pleskovic

. Pathogenesis of atherosclerosis in the tunica intima, media, and adventitia of coronary arteries: An updated review. Bosn J Basic Med Sci. 2020;20:21–30.

Bentzon

, Otsuka

, Virmani

, Falk

. Mechanisms of plaque formation and rupture. Circ Res. 2014;114:1852–1866.

Sakakura

, Nakano

, Otsuka

, Ladich

, Kolodgie

, Virmani

. Pathophysiology of atherosclerosis plaque progression. Heart Lung Circ. 2013;22:399–411.

Bennett

, Sinha

, Owens

. Vascular smooth muscle cells inatherosclerosis. Circ Res. 2016;118:692–702.

, Gu

, Zhang

, et

. TRIM7 promotes proliferation and migration of vascular smooth muscle cells in atherosclerosis through activating c-Jun/AP-1. IUBMB Life. 2020;72:247–258.

Yang

, Mao

, Wang

, Lu

, Pang

. Circular RNA circLMF1 regulates PDGF-BB-induced proliferation and migration of human aortic smooth muscle cells by regulating the miR-125a-3p/VEGFA or FGF1 axis. Clin Hemorheol Microcirc. 2022;80:167–183.

Wang

, Zhao

, Nan

, et al. Long noncoding RNA CASC2 inhibits ox-LDL-mediated vascular smooth muscle cells proliferation and migration via the regulation of miR-532-3p/PAPD5. Mol Med. 2020;26:74.

Wang

, Wei

, Li

, et al. MiR-377-3p inhibits atherosclerosis-associated vascular smooth muscle cell proliferation and migration via targeting neuropilin2. Biosci Rep. 2020;40.

10.

, Li

, Lou

, Li

, Gu

, Wang

. Circ-CHFR modulates the proliferation, migration, and invasion of ox-LDL-induced human aorta vascular smooth muscle cells through the miR-214-3p/PAPPA axis. Clin Hemorheol Microcirc. 2022;80:399–412.

11.

Zhang

, Cheng

, Yue

, Li

, Zhang

, He

. H19 knockdown suppresses proliferation and induces apoptosis by regulating miR-148b/WNT/beta-catenin in ox-LDL -stimulated vascular smooth muscle cells. J Biomed Sci. 2018;25:11.

12.

Wang

, Zhang

, Ge

, Gong

. CTBP1AS2 inhibits proliferation and induces autophagy in oxLDLstimulated vascular smooth muscle cells by regulating miRp/ATG14. Int J Mol Med. 2020;46:839–848.

13.

, Qian

, Yuan

, Lu

MicroRNA-223-3p inhibits oxidized low-density lipoprotein-mediated NLRP3 inflammasome activation via directly targeting NLRP3 and FOXO3. Clin Hemorheol Microcirc. 2022. doi: 10.3233/CH-211232.

14.

Chen

. The expanding regulatory mechanisms and cellular functions of circular RNAs. Nat Rev Mol Cell Biol. 2020;21:475–490.

15.

Xiao

, Ai

, Wilusz

. Biogenesis and functions of circular RNAs come into focus. Trends Cell Biol. 2020;30:226–240.

16.

Liu

, Zhang

, Wu

, et al. Construction of a circular RNA-microRNA-messengerRNA regulatory network in stomach adenocarcinoma. J Cell Biochem. 2020;121:1317–1331.

17.

, Lv

. Revealing new landscape of cardiovascular disease through circular RNA-miRNA-mRNA axis. Genomics. 2020;112:1680–1685.

18.

Cao

, Guo

, Du

, Ling

, Song

. Circular RNAs in the pathogenesis of atherosclerosis. Life Sci. 2020;255:117837.

19.

Sun

, Shi

, Cai

, Liu

. Potential diagnostic and therapeutic value of circular RNAs in cardiovascular diseases. Cell Signal. 2020;71:109604.

20.

Ding

, Ding

, Tian

, Lei

. Circular RNA circ_283 regulates the viability and migration of oxidized lowdensity lipoproteininduced vascular smooth muscle cells via an miRp/HMGB1 axis in atherosclerosis. Int J Mol Med. 2020;46:1399–1408.

21.

Huang

, Li

, Wu

, et al. Hsa_circ_589 knockdown inhibits the proliferation, migration and invasion of vascular smooth muscle cells via regulating miR-214-3p and STIM1. Life Sci. 2020;259:118251.

22.

Yang

, Yang

, Zhao

, Wang

, Zhang

. Circular RNA circCHFR facilitates the proliferation and migration of vascular smooth muscle via miR-370/FOXO1/cyclin D1 pathway. Mol Ther Nucleic Acids. 2019;16:434–441.

23.

Xue

, Wang

, Deng

, Huang

, Tian

. CEMIP regulates the proliferation and migration of vascular smooth muscle cells in atherosclerosis through the WNT-beta-catenin signaling pathway. Biochem Cell Biol. 2020;98:249–257.

24.

Chen

, Zhu

, Cheng

, et al. T-cell death-associated gene 8 accelerates atherosclerosis by promoting vascular smooth muscle cell proliferation and migration. Atherosclerosis. 2020;297:64–73.

25.

Pirillo

, Norata

, Catapano

. LOX-1, OxLDL, and atherosclerosis. Mediators Inflamm. 2013;2013:152786.

26.

Andres V . Control of vascular smooth muscle cell growth and its implication in atherosclerosis and restenosis (review). Int J Mol Med. 1998;2:81–89.

27.

, Jiang

, Zheng

. Circ_984 induces proliferation, migration and inflammation response of VSMCs induced by ox-LDL through miR-326-3p/VAMP3 axis in atherosclerosis. J Cell Mol Med. 2021;25:8028–8038.

28.

Hansen

, Jensen

, Clausen

, et al. Natural RNA circles function as efficient microRNA sponges. Nature. 2013;495:384–388.

29.

Panda

. Circular RNAs act as miRNA sponges. Adv Exp Med Biol 2018;1087:67–79.

30.

Weidle

, Sela

, Brinkmann

, Niewoehner

. Circular RNAs withefficacy in preclinical In vitro and In vivo models of esophagealsquamous cell carcinoma. Cancer Genomics Proteomics. 2022;19:283–298.

31.

, Yang

, Cheng

, Rao

, Wang

. miR-665 promotes hepatocellular carcinoma cell migration, invasion, and proliferation by decreasing Hippo signaling through targeting PTPRB. Cell Death Dis. 2018;9:954.

32.

, Zhang

, Pei

, Dai

. miR-665 Suppresses the epithelial-mesenchymal transition and progression of gastric cancer by targeting CRIM1. Cancer Manag Res. 2020;12:3489–3501.

33.

Wang

, Zhou

, Guo

, Yao

, Zhang

. MicroRNA-665 regulates cell proliferation and apoptosis of vascular smooth muscle cells by targeting TGFBR1. Int Heart J. 2021;62:371–380.

34.

, Pan

, Wang

, Liu

, Wang

. MiR-665 regulates VSMCs proliferation via targeting FGF9 and MEF2D and modulating activities of Wnt/beta-catenin signaling. Am J Transl Res. 2017;9:4402–4414.

35.

Woodbury

, Ikezu

. Fibroblast growth factor-2 signaling in neurogenesis and neurodegeneration. J Neuroimmune Pharmacol. 2014;9:92–101.

36.

Giulianelli

, Riggio

, Guillardoy

, et al. FGF2 induces breast cancer growth through ligand-independent activation and recruitment of ERalpha and PRBDelta4 isoform to MYC regulatory sequences. Int J Cancer. 2019;145:1874–1888.

37.

Shi

, Xu

, Zhao

, Wu

, Gu

, Chen

. FGF2 regulatesproliferation, migration, and invasion of ECA109 cells throughPI3K/Akt signalling pathway In vitro. Cell Biol Int. 2016;40:524–533.

38.

, Gu

, Zhang

, Zhou

, Wang

, Da

. miR-203 inhibition of renal cancer cell proliferation, migration and invasion by targeting of FGF2. Diagn Pathol. 2015;10:24.

39.

, Chi

, Sun

, et al. Linc-ROR targets FGF2 to regulate HASMC proliferation and migration via sponging miR-195-5Gene 2020;725:144143.

40.

Chen

, Cui

, Yuan

, Zhang

, Sang

. Circular RNA WDR77 target FGF-2 to regulate vascular smooth muscle cells proliferation and migration by sponging miR-124. Biochem Biophys Res Commun. 2017;494:126–132.