The regulatory role and mechanism of USP14 in endothelial cell pyroptosis induced by coronary heart disease

Abstract

OBJECTIVE:

The present study probes into the role and mechanism of ubiquitin specific peptidase 14 (USP14) in coronary heart disease (CHD)-triggered endothelial cell pyroptosis.

METHODS:

An in vitro CHD model was established by inducing human coronary artery endothelial cells (HCAECs) with oxidized low-density lipoprotein (ox-LDL). HCAECs were transfected with si-USP14, followed by evaluation of cell viability by CCK-8 assay, detection of lactate dehydrogenase (LDH) activity by assay kit, detection of USP14, miR-15b-5p, NLRP3, GSDMD-N, and Cleaved-Caspase-1 expressions by qRT-PCR or Western blot, as well as IL-1β and IL-18 concentrations by ELISA. Co-IP confirmed the binding between USP14 and NLRP3. The ubiquitination level of NLRP3 in cells was measured after protease inhibitor MG132 treatment. Dual-luciferase reporter assay verified the targeting relationship between miR-15b-5p and USP14.

RESULTS:

USP14 and NLRP3 were highly expressed but miR-15b-5p was poorly expressed in ox-LDL-exposed HCAECs. USP14 silencing strengthened the viability of ox-LDL-exposed HCAECs, reduced the intracellular LDH activity, and diminished the NLRP3, GSDMD-N, Cleaved-Caspase-1, IL-1β, and IL-18 expressions. USP14 bound to NLRP3 protein and curbed its ubiquitination. Repression of NLRP3 ubiquitination counteracted the inhibitory effect of USP14 silencing on HCAEC pyroptosis. miR-15b-5p restrained USP14 transcription and protein expression. miR-15b-5p overexpression alleviated HCAEC pyroptosis by suppressing USP14/NLRP3.

CONCLUSION:

USP14 stabilizes NLRP3 protein expression through deubiquitination, thereby facilitating endothelial cell pyroptosis in CHD. miR-15b-5p restrains endothelial cell pyroptosis by targeting USP14 expression.

Keywords

Coronary heart disease endothelial cell pyroptosis USP14 miR-15b-5p NLRP3

1 Introduction

Coronary heart disease (CHD), one of the most frequent form of cardiovascular diseases, occurs as a consequence of coronary stenosis resulted from the accumulation of atherosclerotic plaques in the blood vessels, which leads to the inability of the coronary artery circulation to provide enough oxygenated blood for myocardial tissues and surrounding tissues [1]. Despite the progress in modifying conventional CHD risk factors, CHD still brings about substantial cardiovascular morbidity and mortality worldwide [2]. The vascular endothelium is formed by a monolayer of endothelial cells (ECs) lining the vascular system surface, separating the vascular wall from circulating blood [3]. The endothelium is not only a mere barrier between blood and tissues but also plays a vital role in the regulation of vascular tone, immune responses, inflammation, and angiogenesis [4]. Evidence has also confirmed that the release of NO by ECs can chronically be reduced with ageing or in the course of vascular diseases. Arteries covered with regenerated endothelium selectively lose the pathway for NO release which favours vasospasm, thrombosis, and inflammatory reaction, leading to cardiovascular diseases [5]. Endothelial dysfunction, such as barrier disruption, increased permeability, and endothelial to mesenchymal transition, is a key hallmark in several cardiovascular diseases or adverse cardiovascular events [6]. Moreover, the inflammatory nature of CHD is now firmly established, and one of the driving forces behind inflammation is endothelial dysfunction [7]. EC death precedes various cardiovascular ailments [8], and a variety of programmed cell deaths in ECs, such as pyroptosis, apoptosis, and ferroptosisis, frequently occur in CHD [9]. Hence, targeting EC death may confer promising therapeutic strategies for the management of CHD.

Pyroptosis is a pro-inflammatory mode of programmed cell death morphologically featured by the the cleavage of membrane pore-forming protein gasdermin D, subsequent cell swelling and lysis, as well as the activation of pro-inflammatory cytokines including IL-1β and IL-18 [10]. Pyroptosis inhibitors have shown cardiovascular benefits in clinical trials by abating cardiac inflammation, alleviating myocardial fibrosis, and promoting cardiac functional recovery [11]. Canonical pyroptosis pathway is mediated by inflammasome-dependent caspase-1 activation. Among them, NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome activation in the coronary arterial endothelium significantly magnifies the caspase-1 activity, and NLRP3-mediated pyroptotic EC death has been deemed as a preliminary event in CHD [12]. Accordingly, various methods have been used for the protection of ECs by suppressing the activation of the NLRP3 inflammasome [13]. Mechanistically, the activation of NLRP3 inflammasome is strictly manipulated by diverse post-translational modifications including ubiquitination [14]. Ubiquitination functions as a crucial determinator of protein fate by marking proteins for degradation via the proteasome system [15]. Deubiquitinating enzymes (DUBs) are essential for ubiquitin homeostasis by mediating the removal of ubiquitin, thus ensuring the normal progress of various biological processes, and the ubiquitin-specific proteases (USPs) constitute the largest family of DUBs [16].

USP14, a family member of USPs, can trigger the deubiquitination of tagged proteins to stabilize the substrate protein [17]. The functionality of USP14 often deviates from its normal state in many cardiovascular pathologies. For example, USP14 expression is notably elevated in an animal model of cardiac hypertrophy and USP14 silencing restrains the levels of cardiac hypertrophy markers [18]. USP14 is also revealed as a pro-atherosclerotic factor, and USP14 knockdown suppresses the proliferation and migration of human aortic smooth muscle cells exposed to PDGF-BB stimulation, implying the potential of USP14 knockdown in alleviating atherosclerosis [19]. Moreover, inhibition of USP14 can diminish oxidized low-density lipoprotein (ox-LDL)-stimulated up-regulation of CD36 and repress foam cell formation in atherosclerosis [20]. Notably, USP14 accelerates the pyroptosis of annulus fibrosus cells isolated from patients with intervertebral disc degeneration by mediating NLRP3 deubiquitination [21]. Nevertheless, whether USP14 can impact EC pyroptosis in CHD by mediating the deubiquitination of NLRP3 remains unknown. Ox-LDL is a well-documented pro-inflammatory marker that eventuates NLRP3 inflammasome activation and subsequent EC pyroptosis [22]. Herein, this study applied ox-LDL to treat human coronary artery endothelial cells (HCAECs) for establishing an in vitro CHD model, and probed into the regulatory mechanism of USP14 in EC pyroptosis by stabilizing NLRP3 protein expression through deubiquitination, gearing towards conferring novel therapeutic insights for CHD.

2 Materials and methods

2.1 Cell culture and treatment

HCAECs procured from ATCC (Manassas, Virginia, USA) were maintained in complete Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum and 1% penicillin-streptomycin in a constant-temperature incubator at 37°C with 5% CO₂. The medium was refreshed every other day. HCAECs in the logarithmic growth phase were selected for experimentation. Shortly, HCAECs were treated with 100μg/mL ox-LDL for 48 h for establishing an in vitro model of CHD, with cells free of ox-LDL treatment as controls.

2.2 Cell transfection

miR-15b-5p-mimic and its negative control mimic-NC, as well as si-USP14-1, si-USP14-2 and its negative control si-NC were designed and synthesized by GenePharma (Shanghai, China). When reaching 90% confluence, HCAECs were transfected with the above mimics and sequences using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA). Corresponding treatments were performed 48 h later. Quantitative real-time polymerase chain reaction (qRT-PCR) confirmed the transfection efficiency.

2.3 Cell counting kit-8 (CCK-8) assay

HCAECs were seeded into 96-well plates (5×10³ cells/well) for 48 h of incubation. After cell attachment, 10μL CCK-8 solution (Dojindo, Kumamoto, Japan) was added into each well, followed by 4 h of incubation avoid of light. The optical density at 450 nm was measured with a microplate reader after 2 h. Cell viability (%)=(measured value - blank value)/(control value - blank value)×100%.

2.4 Cytotoxicity testing

HCAECs were seeded into 96-well plates (5×10³ cells/well). After centrifugation at 400 g for 5 min, the lactate dehydrogenase (LDH) activity in the supernatant was determined using the LDH cytotoxicity detection kit (Beyotime, Shanghai, China).

2.5 Enzyme-linked immunosorbent assay (ELISA)

The cell culture medium was collected from each group and centrifuged to obtain the supernatant. The levels of IL-18 and IL-1β in the supernatant of HCAECs were detected using the human IL-18 ELISA kit (ab215539; Abcam, Cambridge, MA, USA) and the human IL-1β ELISA kit (ab214025; Abcam), respectively.

2.6 qRT-PCR

The total RNA was extracted from HCAECs using TRIzol reagent (Thermo Fisher Scientific) and reverse-transcribed into cDNA using Evo M-MLV RT kit (Accurate Biology, Hunan, China). Next, qRT-PCR was performed using SYBR Green Pro Taq HS qPCR kit (Accurate Biology) on the ABI 7000 qPCR instrument, with U6 as the internal reference of miR-15b-5p [23] and GAPDH as the internal reference of USP14. The relative gene expression was quantified by the 2^-ΔΔ_Ct method [24]. Table 1 displays the primer sequences.

Table 1
qPCR primers

Forward primer (5^′-3^′) Reverse primer (5^′-3^′)

miR-15b-5p GCCGAGTAGCAGCACATCAT CTCAACTGGTGTCGTGGA

USP14 TGGCTTCAGCGCAGTATATTAC CCTTGTTCACCTTTCTCGGCA

U6 GTGCTCGCTTCGGCAGCA AAAATATGGAACGCTTCA

GAPDH CTCAACTACATGGTTTAC CCAGGGGTCTTACTCCTT

	Forward primer (5^′-3^′)	Reverse primer (5^′-3^′)
miR-15b-5p	GCCGAGTAGCAGCACATCAT	CTCAACTGGTGTCGTGGA
USP14	TGGCTTCAGCGCAGTATATTAC	CCTTGTTCACCTTTCTCGGCA
U6	GTGCTCGCTTCGGCAGCA	AAAATATGGAACGCTTCA
GAPDH	CTCAACTACATGGTTTAC	CCAGGGGTCTTACTCCTT

Note: miR-15b-5p, microRNA-15b-5p; USP14, ubiquitin specific peptidase 14; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

2.7 Western blot

The total protein in HCAECs was lysed with radio-immunoprecipitation assay buffer. SDS-PAGE was performed after the detection of protein concentration by bicinchoninic acid method. After the polyvinylidene fluoride membrane was activated, 260 mA constant current was used for membrane transferring for 2 h. Next, the membrane was blocked with TBST containing 5% skim milk for 2 h and incubated with primary antibodies USP14 (1 : 500, ab246010, Abcam), NLRP3 (1 : 1000, ab263899, Abcam), GSDMD-N (1 : 1000, ab215203, Abcam), cleaved-caspase-1 (1 : 500, YC0002; ImmunoWay), and β-actin (1 : 1000, ab8227, Abcam) at 4°C overnight. Subsequently, the corresponding secondary antibody (1 : 2000, ab6721; Abcam) was added for 2 h of incubation at room temperature. Finally, enhanced chemiluminescence reagent was dropped onto the membrane for image exposure, and the images were analyzed using Image J (NIH, Bethesda, MD, USA).

2.8 Co-immunoprecipitation (Co-IP) and ubiquitination detection

In Co-IP, HCAECs were collected and lysed on ice with cell lysis buffer containing protease inhibitor for 30 min. After centrifugation at 12000×g and 4°C for 15 min, the supernatant was collected and incubated with NLRP3 antibody (ab263899, Abcam) on a rotary shaker at 4°C overnight. Pre-washed protein A/G agarose beads were added to the cell lysate incubated with the antibody, and slowly shaken at 4°C for 2 h. After immunoprecipitation, the immune complex was resuspended in 2×SDS loading buffer, boiled for 5 min, and added with USP14 antibody (ab246010, Abcam) or control IgG (ab7155, Abcam) for Western blot analysis.

In ubiquitination detection, the cells were treated with 10μM MG132 for 8 h, lysed with 1% SDS, and added with NLRP3 antibody (ab263899, Abcam) for immunoprecipitation. Subsequently, the sample was harvested and supplemented with ubiquitin antibody (ab7780, Abcam) for Western blot.

2.9 Bioinformatics

The upstream miRNAs of USP14 were predicted through the Targetscan (http://www.targetscan.org/) [25], miRDB (http://mirdb.org/) [26], miRWalk (http://mirwalk.umm.uni-heidelberg.de/) [27], and Starbase (http://starbase.sysu.edu.cn/) [28].

2.10 Dual-luciferase reporter assay

The wild-type USP14 3’ UTR sequence and mutant sequence containing the miR-15b-5p binding site were inserted into the pmirGLO vector (Promega, Madison, WI, USA) to produce WT-USP14 and MUT-USP14, respectively. HCAECs were seeded into 24-well plates (1×10⁵ cells/well) and then transfected with the above vectors and miR-15b-5p-mimic or mimic-NC using Lipofectamine 3000. After incubation at 37°C and 5% CO₂ for 48 h, the dual-luciferase assay kit (Promega) was utilized to test luciferase activity.

2.11 Statistical analysis

GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA) was employed for data analysis and plotting. Measurement data are presented as mean±standard deviation (mean±SD). Comparisons between two groups were performed using the t-test, while comparisons among multiple groups were performed using one-way or two-way analysis of variance (ANOVA), following Tukey’s post-hoc test. P < 0.05 indicated statistical significance.

3 Results

3.1 USP14 is highly expressed in ox-LDL-induced cell model of CHD

To investigate the role of USP14 in EC pyroptosis in CHD, we established a cell model of CHD by treating HCAECs with 100μg/mL ox-LDL. Relative to the control cells, ox-LDL-induced HCAECs presented with significantly elevated USP14 expression (Fig. 1A-B, P < 0.05), attenuated cell viability (Fig. 1C, P < 0.05), augmented LDH levels (Fig. 1D, P < 0.05), and elevated pyroptosis-related proteins NLRP3, Cleaved Caspase-1, and GSDMD-N, as well as uplifted pyroptosis-related inflammatory factors IL-1β and IL-18 (Fig. E-G, P < 0.05), indicating that ox-LDL eventuated pyroptosis in HCAECs and enhanced USP14 expression.

Fig. 1

USP14 expression is upregulated in ox-LDL-induced cell model of CHD. HCAECs were subjected to ox-LDL treatment. A: The USP14 mRNA expression was detected by qRT-PCR. B: The USP14 protein expression was detected by Western blot. C: The cell viability was assessed by CCK-8 assay. D: The cytotoxicity was measured by LDH kit. E: The NLRP3, Cleaved-Caspase-1, and GSDMD-N protein expressions were detected by Western blot. F-G: The IL-1β and IL-18 concentrations were detected by ELISA. The cell experiments were repeated 3 times independently. Data are presented as mean±SD. The independent t-test was adopted for data comparisons between two groups.

3.2 USP14 silencing attenuates EC pyroptosis

We transfected si-USP14-1 and si-USP14-2 into HCAECs to silence USP14 expression (Fig. 2A, F, P < 0.05), and selected si-USP14-1 with better transfection efficiency for subsequent detection. USP14 silencing treatment notably enhanced the viability of ox-LDL-exposed cells (Fig. 2B, P < 0.05), decreased the intracellular LDH (Fig. 2C, P < 0.05), reduced the concentrations of IL-1β and IL-18 (Fig. 2D-E, P < 0.05), and diminished the levels of NLRP3, Cleaved Caspase-1, and GSDMD-N (Fig. 2F, P < 0.05), indicating that USP14 silencing was sufficient to alleviate the pyroptosis of ox-LDL-stimulated HCAECs.

Fig. 2

USP14 silencing attenuates endothelial cell pyroptosis. si-USP14-1 and si-USP14-2 were transfected into HCAECs, with si-NC as a control. A: qRT-PCR verified the transfection efficiency, and si-USP14-1 with better transfection efficiency was used for subsequent experiments. After ox-LDLtreatment, B: the cell viability was measured by CCK-8 assay. C: The cytotoxicity was measured by LDH kit. D-E: The IL-1β and IL-18 concentrations were detected by ELISA. F: The USP14, NLRP3, Cleaved-Caspase-1, and GSDMD-N protein expressions were detected by Western blot. The cell experiments were repeated 3 times independently. Data are presented as mean±SD. Data comparisons among multiple groups were performed using one-way ANOVA, following Tukey’s post-hoc test.

3.3 USP14 stabilizes NLRP3 protein expression through deubiquitination

USP14 can stabilize protein expression through deubiquitination [29]. The stability of NLRP3 is manipulated by deubiquitination enzymes [30], and USP14 stabilizes NLRP3 expression through deubiquitination to boost cell pyroptosis [21]. Accordingly, we speculated that USP14 could stabilize NLRP3 through deubiquitination and thereby impact pyroptosis. To verify our hypothesis, we collected HCAECs for Co-IP and found that USP14 protein binds to NLRP3 protein (Fig. 3A). Subsequent ubiquitination experiments revealed a decrease in NLRP3 ubiquitination levels in cells exposed to ox-LDL, while USP14 silencing resulted in an increase in NLRP3 ubiquitination levels. To further confirm the ubiquitination regulation of NLRP3 by USP14, we conducted combined experiments using protease inhibitor MG132 and si-USP14-1, and noted that the NLRP3 ubiquitination levels were diminished after MG132 treatment (Fig. 3B). The above results implied that USP14 mediated the deubiquitination of NLRP3.

Fig. 3

USP14 stabilizes NLRP3 protein expression through deubiquitination. A: The interaction between USP14 and NLRP3 was detected by Co-IP. Proteasome inhibitor MG132 and si-USP14-1 were used for a combined experiment, with DMSO treatment as a control. B: The ubiquitination level of NLRP3 was detected. The cell experiments were repeated 3 times independently.

3.4 Downregulation of ubiquitination reverses the inhibitory effect of USP14 silencing on EC pyroptosis

Next, we further observed the changes in pyroptosis levels after inhibition of NLRP3 ubiquitination by MG132 treatment. Compared with the ox-LDL+si-USP14-1 group, the ox-LDL+si-USP14-1 + MG132 group showed significantly elevated NLRP3, Cleaved Caspase-1, and GSDMD-N (P < 0.05, Fig. 4A), weakened cell viability (P < 0.05, Fig. 4B), enhanced intracellular LDH (P < 0.05, Fig. 4C), as well as raised IL-1β and IL-18 (P < 0.05, Fig. 4D-E), indicating that downregulating NLRP3 ubiquitination counteracted the inhibitory effect of USP14 silencing on the pyroptosis of HCAECs.

Fig. 4

Downregulation of ubiquitination reverses the inhibitory effect of USP14 silencing on endothelial cell pyroptosis. Proteasome inhibitor MG132 and si-USP14-1 were used for a combined experiment, with DMSO treatment as a control. A: The NLRP3, Cleaved-Caspase-1, and GSDMD-N protein expressions were detected by Western blot. B: The cell viability was measured by CCK-8 assay. C: The cytotoxicity was measured by LDH kit. D-E: The IL-1β and IL-18 concentrations were detected by ELISA. The cell experiments were repeated 3 times independently. Data are presented as mean±SD. Data comparisons among multiple groups were performed using one-way ANOVA, following Tukey’s post-hoc test.

3.5 miR-15b-5p is an upstream gene of USP14

USP14 expression is under the regulation of miRNAs [31]. We predicted the upstream miRNAs of USP14 online through miRDB, TargetScan, Starbase, and miRWalk, and obtained the intersection data (Fig. 5A), from which we focused on miR-15b-5p. miR-15b-5p is weakly expressed in CHD [32]. We speculated that miR-15b-5p was an upstream gene of USP14. Dual-luciferase reporter assay unveiled the binding between miR-15b-5p and 3’ UTR sequence of USP14 (P < 0.05, Fig. 5B). miR-15b-5p displayed a low-expression profiling in ox-LDL-stimulated HCAECs (P < 0.05, Fig. 5C). Shortly, miR-15b-5p was an upstream gene of USP14 and was poorly expressed in CHD.

Fig. 5

miR-15b-5p is an upstream gene of USP14. A: The upstream miRNAs of USP14 online through miRDB, TargetScan, Starbase, and miRWalk databases. B: The binding relationship between miR-15b-5p and USP14 was validated by dual-luciferase reporter assay. C: The miR-15b-5p expression in cells was detected by qRT-PCR. The cell experiments were repeated 3 times independently. Data are presented as mean±SD. Data comparisons in panel B were performed using two-way ANOVA, following Tukey’s post-hoc test, and data comparisons in panel C were performed using independent t-test.

3.6 Overexpression of miR-15b-5p restrains pyroptosis by repressing USP14/NLRP3

Finally, we validated whether miR-15b-5p participated in pyroptosis of HCAECs by mediating USP14. miR-15b-5p-mimic was transfected into cells, and qRT-PCR confirmed the transfection efficiency (P < 0.05, Fig. 6A). Overexpression of miR-15b-5p dramatically reduced the USP14 expression in ox-LDL-triggered cells (P < 0.05, Fig. 6B-C), augmented the ubiquitination of NLRP3 (Fig. 6D), lowered the protein expressions of NLRP3, Cleaved Caspase-1, and GSDMD-N (P < 0.05, Fig. 6C), enhanced the cell viability (P < 0.05, Fig. 6E), abated the intracellular LDH (P < 0.05, Fig. 6F), and also diminished the concentrations of IL-1β and IL-18 (P < 0.05, Fig. 6G-H), suggesting that overexpression of miR-15b-5p attenuated the pyroptosis of HCAECs by repressing USP14/NLRP3.

Fig. 6

Overexpression of miR-15b-5p restrains pyroptosis by repressing USP14/NLRP3. miR-15b-5p-mimic was transfected into HCAECs, with mimic-NC as a control. A: qRT-PCR verified the transfection efficiency of miR-15b-5p-mimic, followed by ox-LDLtreatment. B: The USP14 mRNA expression was detected by qRT-PCR. C: The USP14, NLRP3, Cleaved-Caspase-1, and GSDMD-N protein expressions were detected by Western blot. D: The ubiquitination level of NLRP3 was detected. E: The cell viability was measured by CCK-8 assay. F: The cytotoxicity was measured by LDH kit. G-H: The IL-1β and IL-18 concentrations were detected by ELISA. The cell experiments were repeated 3 times independently. Data are presented as mean±SD. The independent t-test was adopted for data comparisons in panel A. Data comparisons in panels B/C/E/F/G/H were performed using one-way ANOVA, following Tukey’s post-hoc test. *P<0.05.

4 Discussion

CHD remains a salient global health issue that critically compromises human health and poses huge medical burden [33]. USP14 is a deubiquitinating enzyme that extensively participates in a sequence of canonical cellular signaling pathways, and dysregulation of USP14 has been observed in varying pathological conditions including cardiovascular disease [17]. The present study reveals that USP14 is abundantly expressed in the in vitro model of CHD and facilitates NLRP3-mediated HCAEC pyroptosis via deubiquitination of NLRP3 protein.

CHD is always accompanied by aberrant EC death, which aggravates atherosclerotic plaque formation and accelerates the progression of CHD [34]. Ox-LDL as a vital pathogenic factor of numerous acute coronary syndromes deteriorates EC death by secreting pro-inflammatory mediators and synthesizing adhesion molecules [35]. Ox-LDL exerts potent cytotoxicity, and ECs incubated with ox-LDL exhibits apoptotic features, with cytoplasmic condensation, cell or nuclear fragmentation, and accumulation of DNA fragments [36]. Ox-LDL stimulates caspase-1 activation and NLRP3 elevation in HCAECs, exciting pyroptosis steering by NLRP3 inflammasome [37]. Therefore, ox-LDL is commonly utilized to treat HCAECs for establishing an in vitro model to investigate the mechanism of EC dysfunction in CHD [38, 39]. Ox-LDL induction can activate NLRP3 inflammasome, facilitate IL-1β and IL-18 maturation, and stimulate LDH release in ECs [35]. Inhibiting ox-LDL-mediated NLRP3 inflammasome activation offers a prospective therapeutic target for CHD [40]. Consistently, we observed that ox-LDL led to elevated USP14 expression in HCAECs, enhanced intracellular LDH secretion, as well as raised pyroptosis-related factors including NLRP3, Cleaved-Caspase-1, GSDMD-N, IL-1β, and IL-18.

USP14, a well-characterized DUB, is engaged in manifold canonical signaling pathways via the modulation of protein stability, associating with tumorigenesis, neurodegenerative disorders, inflammatory diseases, and viral infection [17]. USP14 knockdown contributes to neurological function recovery by protecting blood-brain barrier integrity and subsiding neuroinflammation in mice with middle cerebral artery occlusion [41]. USP14 silencing dramatically depresses ox-LDL uptake and subsequently curbs foam cell formation, representing a prospective therapeutic candidate for atherosclerosis [20]. Notably, we are the first to demonstrate that downregulation of USP14 can alleviate ox-LDL-stimulated pyroptosis in HCAECs.

Subsequently, we shifted to investigating the exact mechanism of USP14 in EC pyroptosis. Multiple ubiquitin modifying enzymes are implicated in NLRP3 activation and consequent pyroptosis, among which DUBs are the first to be described [42, 43]. As a sub-family member of DUBs, USP14 stabilizes target protein by inducing deubiquitination [29]. USP14 has been demonstrated to stabilizes NLRP3 expression through deubiquitination, thus provoking pyroptosis of annulus fibrosus cells [21]. Accordingly, we speculated that USP14 might affect HCAEC pyroptosis by stabilizing NLRP3 through deubiquitination. Co-IP assay confirmed that USP14 protein bound to NLRP3 protein in HCAECs. The ubiquitination level of NLRP3 in ox-LDL-exposed HCAECs was decreased, and USP14 silencing enhanced the ubiquitination level of NLRP3. Our findings implied that USP14 mediated the deubiquitination of NLRP3, and repressing NLRP3 ubiquitination averted the inhibitory effect of USP14 silencing on the pyroptosis of HCAECs.

Further, the upstream mechanism of USP14 was explored. USP14 expression is manipulate by miRNAs in many diseases [31 , 45]. Emerging evidence on the pathogenesis of CHD has hinted the appreciable prognostic and diagnostic values of miRNAs [46, 47]. miRNAs are described as evolutionarily conserved small non-coding RNAs with the capacity of posttranscriptive gene silencing via interaction with the 3’-UTR of target mRNAs, functioning as crucial “fine-tuners” of a broad spectrum of cellular behaviors and signaling pathways pathophysiologically related to CHD [48]. We predicted the miRNAs downstream of USP14 through online databases. Of note, miR-15b-5p is abundantly expressed in ECs and fulfills varying roles in different cells and tissues by modulating endothelial functions [49, 50]. miR-15b-5p overexpression diminishes TNF-α and augments IGFBP-3 expression, thus restraining apoptosis of retinal microvascular ECs under hyperglycemic stress [51]. Moreover, miR-15b-5p strengthens the viability while represses the apoptosis of endothelial progenitor cells in the context of coronary atherosclerotic heart disease [32]. Dual-luciferase reporter assay verified the binding between miR-15b-5p and the 3 ‘UTR sequence of USP14. miR-15b-5p is weakly expressed in ox-LDL-insulted human vascular ECs, and miR-15b-5p overexpression contributes to diminishing pro-inflammatory cytokine secretion and repressing ox-LDL-insulted apoptosis [52]. miR-15b-5p knockdown can offset the inhibitory effect of lncRNA XIST silencing on renal tubular epithelial cell pyroptosis in diabetic nephropathy [53]. Similarly, we also observed that miR-15b-5p expression was declined in ox-LDL-exposed HCAECs, and miR-15b-5p overexpression represses HCAEC pyroptosis by blocking the USP14/NLRP3 signal.

To conclude, USP14 exacerbates NLRP3-mediated EC pyroptosis by stabilizing NLRP3 protein expression through deubiquitination; miR-15b-5p overexpression targets USP14 expression, promotes ubiquitination degradation of NLRP3 protein, and alleviates ox-LDL-provoked EC pyroptosis. However, we only determined the regulatory mechanism of USP14 on EC pyroptosis in an in vitro model and did not validate it in vivo. This study merely revealed the regulatory effect of miR-15b-5p/USP14/NLRP3 axis on EC pyroptosis in CHD. There may be multiple molecular mechanisms involved in the pyroptosis regulated by USP14, and the interaction between USP14 and other possible genes needs further research. In the future research, we will establish an animal model of CHD to observe the effect of USP14 on EC pyroptosis in vivo and explore other involved signaling molecules.

Conflict of interest

The authors have no relevant financial or non-financial interests to disclose.

References

Malakar

, Choudhury

, Halder

, Paul

, Uddin

, Chakraborty

A review on coronary artery disease, its risk factors, and therapeutics, J Cell Physiol 2019;234(10):16812–23. doi: 10.1002/jc28350.

Kandaswamy

, Zuo

Recent Advances in Treatment of Coronary Artery Disease: Role of Science and Technology, Int J Mol Sci. 2018;19(2):424. doi: 10.3390/ijms19020424.

Zheng

, Liu

, Piao

, Zhu

, Wei

, Liu

ROS-triggered endothelial cell death mechanisms: Focus on pyroptosis, parthanatos, and ferroptosis, Front Immunol 2022;13 :1039241. doi: 10.3389/fimmu.2022.1039241.

Krüger-Genge

, Blocki

, Franke

, Jung

Vascular Endothelial Cell Biology: An Update, Int J Mol Sci 2019;20(18):4411. doi: 10.3390/ijms20184411.

Vanhoutte

, Shimokawa

, Feletou

, Tang

Endothelial dysfunction and vascular disease –a 30th anniversary update, Acta Physiol (Oxf) 2017;219(1):22–96. doi: 10.1111/apha.12646.

Immanuel

, Yun

Vascular Inflammatory Diseases and Endothelial Phenotypes, Cells 2023;12(12):1640. doi: 10.3390/cells12121640.

Lusta

, Poznyak

, Sukhorukov

, Eremin

, Nadelyaeva

, Orekhov

Hypotheses on Atherogenesis Triggering: Does the Infectious Nature of Atherosclerosis Development Have a Substruction? Cells 2023;12(5):707. doi: 10.3390/cells12050707.

, Liu

, Liang

, Yang

The role of pyroptosis in endothelial dysfunction induced by diseases, Front Immunol 2022;13 :1093985. doi: 10.3389/fimmu.2022.1093985.

, Huang

, Zeng

, Wang

Programmed Cell Death of Endothelial Cells in Myocardial Infarction and Its Potential Therapeutic Strategy, Cardiol Res Pract 2022;2022:6558060. doi: 10.1155/2022/6558060.

10.

Jia

, Chen

, Zhang

, Zhou

, Zhuge

, Niu

, et al. Role of pyroptosis in cardiovascular diseases, Int Immunopharmacol 2019;67 :311–8. doi: 10.1016/j.intim2018.12.028.

11.

Matsuzawa

, Lerman

Endothelial dysfunction and coronary artery disease: assessment, prognosis, and treatment, Coron Artery Dis 2014;25(8):713–24. doi: 10.1097/MCA.0000000000000178.

12.

Toldo

, Mezzaroma

, Buckley

, Potere

, Di Nisio

, Biondi-Zoccai

, et al. Targeting the NLRP3 inflammasome in cardiovascular diseases, Pharmacol Ther 2022;236 :108053. doi: 10.1016/j.pharmthera.2021.108053.

13.

Liu

, Zhang

, Yu

, Zhang

, Yu

Research Progress on the Role of Pyroptosis in Myocardial Ischemia-Reperfusion Injury, Cells 2022;11(20):3271. doi: 10.3390/cells11203271.

14.

Akther

, Haque

, Park

, Kang

, Lee

NLRP3 Ubiquitination-A New Approach to Target NLRP3 Inflammasome Activation, Int J Mol Sci 2021;22(16):8780. doi: 10.3390/ijms22168780.

15.

Bednash

, Mallampalli

Regulation of inflammasomes by ubiquitination, Cell Mol Immunol 2016;13(6):722–8. doi: 10.1038/cmi.2016.15.

16.

Powell

, Herrmann

, Lerman

, Patterson

, Wang

The ubiquitin-proteasome system and cardiovascular disease, Prog Mol Biol Transl Sci 2012;109 :295–346. doi: 10.1016/B978-0-12-397863-9.00009-2.

17.

Wang

, Ning

, Yu

, Wang

USP14: Structure, Function, and Target Inhibition, Front Pharmacol 2021;12 :801328. doi: 10.3389/fphar.2021.801328.

18.

Liu

, Chai

, Liu

, Zhang

, et al. Ubiquitin-specific protease 14 regulates cardiac hypertrophy progression by increasing GSK-3beta phosphorylation, Biochem Biophys Res Commun 2016;478(3):1236–41. doi: 10.1016/j.bbrc.2016.08.100.

19.

Liu

, Li

, Yan

, Lun

Knockdown of USP14 inhibits PDGF-BB-induced vascular smooth muscle cell dedifferentiation via inhibiting mTOR/P70S6K signaling pathway, RSC Adv 2019;9(63):36649–57. doi: 10.1039/c9ra04726c.

20.

Zhang

, Xia

, Chai

, Xu

, Liu

, et al. Inhibition of USP14 suppresses the formation of foam cell by promoting CD36 degradation, J Cell Mol Med 2020;24(6):3292–302. doi: 10.1111/jcmm.15002.

21.

Hai

, Mao

, Du

, Jia

, Liu

, Song

,et al. USP14 promotes pyroptosis of human annulus fibrosus cells derived from patients with intervertebral disc degeneration through deubiquitination of NLRP3, Acta Biochim Biophys Sin (Shanghai) 2022;54(11):1–11. doi: 10.3724/abbs.2022171.

22.

, He

, Wu

, Zhang

, Li

, Wu

, et al. MLKL Aggravates Ox-LDL-Induced Cell Pyroptosis via Activation of NLRP3 Inflammasome in Human Umbilical Vein Endothelial Cells, Inflammation 2020;43(6):2222–31. doi: 10.1007/s10753-020-01289-8.

23.

Wang

, Zhang

Circ_09 aggravates diabetic retinal vascular dysfunction through regulating miR-15b-5p/COL12A1, J Transl Med. 2021;19(1):294. doi: 10.1186/s12967-021-02949-5.

24.

Livak

, Schmittgen

Analysis of relative gene expression data using real-time quantitative PCR and the 2 -Delta Delta C(T)) Method. . Methods 2001;2(4):402–8. doi: 10.1006/meth.2001.1262.

25.

Agarwal

, Bell

, Nam

, Bartel

Predicting effective microRNA target sites in mammalian mRNAs, Elife 2015;4 :e05005. doi: 10.7554/eLife.05005.

26.

Chen

, Wang

miRDB: an online database for prediction of functional microRNA targets, Nucleic Acids Res 48(D1):2020):D127–D31. doi: 10.1093/nar/gkz757.

27.

Sticht

, De La Torre

, Parveen

, Gretz

miRWalk: An online resource for prediction of microRNA binding sites, PLoS One 2018;13(10):e0206239. doi: 10.1371/journal.pone.0206239.

28.

, Liu

, Zhou

, Qu

, Yang

starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data, Nucleic Acids Res. 2014;42(Database issue):D92–7. doi: 10.1093/nar/gkt1248.

29.

, Qiu

, Wu

, Zhang

, Wei

, Lu

, et al. USP14-mediated NLRC5 upregulation inhibits endothelial cell activation and inflammation in atherosclerosis, Biochim Biophys Acta Mol Cell Biol Lipids 5 2023):159258. doi: 10.1016/j.bbali2022.159258.

30.

Liu

, Fang

, Lv

, Hu

, Chen

, Zhang

, et al. Deubiquitinase OTUD6A in macrophages promotes intestinal inflammation and colitis via deubiquitination of NLRP3, Cell Death Differ 2023;30(6):1457–71. doi: 10.1038/s41418-023-01148-7.

31.

, Zheng

, Sun

, Lai

, Qiu

, Gui

, et al. Suppressing long noncoding RNA OGRU ameliorates diabetic retinopathy by inhibition of oxidative stress and inflammation via miR-320/USP14 axis, Free Radic Biol Med 2021;169 :361–81. doi: 10.1016/j.freeradbiomed.2021.03.016.

32.

Zhu

, Yang

, Duan

, Mu

, Zhang

MALAT1/miR-15b-5p/MAPK1 mediates endothelial progenitor cells autophagy and affects coronary atherosclerotic heart disease via mTOR signaling pathway, Aging (Albany NY) 2019;11(4):1089–109. doi: 10.18632/aging.101766.

33.

Wirtz

, von Kanel

Psychological Stress, Inflammation, and Coronary Heart Disease, Curr Cardiol Rep 2017;19(11):111. doi: 10.1007/s11886-017-0919-x.

34.

Medina-Leyte

, Zepeda-Garcia

, Dominguez-Perez

, Gonzalez-Garrido

, Villarreal-Molina

, Jacobo-Albavera

Endothelial Dysfunction, Inflammation and Coronary Artery Disease: Potential Biomarkers and Promising Therapeutical Approaches, Int J Mol Sci 2021;22(8):3850. doi: 10.3390/ijms22083850.

35.

Hang

, Peng

, Xiang

, Li

Ox-LDL Causes Endothelial Cell Injury Through ASK1/NLRP3-Mediated Inflammasome Activation via Endoplasmic Reticulum Stress, Drug Des Devel Ther 2020;14 :731–44. doi: 10.2147/DDDT.S231916.

36.

Kontush

, Chancharme

, Escargueil-Blanc

, Therond

, Salvayre

, Negre-Salvayre

, et al. Mildly oxidized LDL particle subspecies are distinct in their capacity to induce apoptosis in endothelial cells: role of lipid hydroperoxides, FASEB J 2003;17(1):88–90. doi: 10.1096/fj.02-0293fje.

37.

Yang

, Wang

, Xu

, Liu

, Sun

, Li

Correction to: Knockdownof lncRNA H19 alleviates ox-LDL-induced HCAECs inflammation andinjury by mediating miR-20a-5p/HDAC4 axis, Inflamm Res 2023;72(4):893. doi: 10.1007/s00011-023-01701-7.

38.

Bai

, Wang

, Li

Transcription factor GATA1 represses oxidized-low density lipoprotein-induced pyroptosis of human coronary artery endothelial cells, Clin Hemorheol Microcirc 2023;83(1):81–92. doi: 10.3233/CH-221536.

39.

Zhang

, Qin

, Wang

, Fang

, Wang

, Li

Circ_0003575 knockdown alleviates ox-LDL-induced human aortic endothelial cell dysfunction in atherosclerosis by miR-637/TRAF6 axis. Clin Hemorheol Microcirc. 2023; doi: 10.3233/CH-231858.

40.

, Qian

, Yuan

, Lu

MicroRNA-223-3p inhibits oxidized low-density lipoprotein-mediated NLRP3 inflammasome activation via directly targeting NLRP3 and FOXO3, Clin Hemorheol Microcirc 2022;81(3):241–53. doi: 10.3233/CH-211232.

41.

Hou

, Yao

, Liu

, Lin

, Wei

, Yin

, et al. USP14 inhibition promotes recovery by protecting BBB integrity and attenuating neuroinflammation in MCAO mice. CNS Neurosci Ther. 2023; doi: 10.1111/cns.14292.

42.

Singh

, Kumari

, Yadav

UCS

Regulation of oxidized LDL-induced inflammatory process through NLRP3 inflammasome activation by the deubiquitinating enzyme BRCC36, Inflamm Res 2019;68(12):999–1010. doi: 10.1007/s00011-019-01281-5.

43.

Palazon-Riquelme

, Worboys

, Green

, Valera

, Martin-Sanchez

, Pellegrini

,et al. USP7 and USP47 deubiquitinases regulate NLRP3 inflammasome activation, EMBO Rep 2018;19(10):e44766. doi: 10.15252/embr.201744766.

44.

Song

, Li

, He

, Qu

, Jiang

, Li

, et al. M2 microglia-derived exosomes protect the mouse brain from ischemia-reperfusion injury via exosomal miR-124, Theranostics 2019;9(10):2910–23. doi: 10.7150/thno.30879.

45.

Doeppner

, Doehring

, Bretschneider

, Zechariah

, Kaltwasser

, Muller

, et al. MicroRNA-124 protects against focal cerebral ischemia via mechanisms involving Usp14-dependent REST degradation, Acta Neuropathol 2013;126(2):251–65. doi: 10.1007/s00401-013-1142-5.

46.

Kalayinia

, Arjmand

, Maleki

, Malakootian

, Singh

MicroRNAs: roles in cardiovascular development and disease, Cardiovasc Pathol 2021;50 :107296. doi: 10.1016/j.carpath.2020.107296.

47.

Liao

, Wang

, Liu

, Li

, Duan

Transcriptome sequencing of lncRNA, miRNA, mRNA and interaction network constructing in coronary heart disease, BMC Med Genomics 2019;12(1):124. doi: 10.1186/s12920-019-0570-z.

48.

Feinberg

, Moore

MicroRNA Regulation of Atherosclerosis, Circ Res 2016;118(4):703–20. doi: 10.1161/CIRCRESAHA.115.306300.

49.

, Sun

, Yang

, Lu

MiR-15b facilitates breast cancer progression via repressing tumor suppressor PAQR3, Eur Rev Med Pharmacol Sci 2020;24(2):740–8. doi: 10.26355/eurrev_202001_20054.

50.

Chan

, Yue

, Wong

MicroRNA-15b contributes to ginsenoside-Rg1-induced angiogenesis through increased expression of VEGFR-2, Biochem Pharmacol 2013;86(3):392–400. doi: 10.1016/j.bc2013.05.006.

51.

, Steinle

miR-15b/16 protects primary human retinal microvascular endothelial cells against hyperglycemia-induced increases in tumor necrosis factor alpha and suppressor of cytokine signaling 3, J Neuroinflammation 2015;12 :44. doi: 10.1186/s12974-015-0265-0.

52.

, Wang

Circular RNA circCHFR downregulation protects against oxidized low-density lipoprotein-induced endothelial injury via regulation of microRNA-15b-5p/growth arrest and DNA damage inducible gamma, Bioengineered 2022;13(2):4481–92. doi: 10.1080/21655979.2022.2032967.

53.

, Wang

, Song

, Xu

, Zhu

, Chen

,et al. Long noncoding RNA X-inactive specific transcript regulates NLR family pyrin domain containing 3/caspase-1-mediated pyroptosis in diabetic nephropathy, World J Diabetes 2022;13(4):358–75. doi: 10.4239/wjd.v13.i4.358.

The regulatory role and mechanism of USP14 in endothelial cell pyroptosis induced by coronary heart disease

Abstract

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSION:

Keywords

1 Introduction

2 Materials and methods

2.1 Cell culture and treatment

2.2 Cell transfection

2.3 Cell counting kit-8 (CCK-8) assay

2.4 Cytotoxicity testing

2.5 Enzyme-linked immunosorbent assay (ELISA)

2.6 qRT-PCR

Table 1 qPCR primers Forward primer (5′-3′) Reverse primer (5′-3′) miR-15b-5p GCCGAGTAGCAGCACATCAT CTCAACTGGTGTCGTGGA USP14 TGGCTTCAGCGCAGTATATTAC CCTTGTTCACCTTTCTCGGCA U6 GTGCTCGCTTCGGCAGCA AAAATATGGAACGCTTCA GAPDH CTCAACTACATGGTTTAC CCAGGGGTCTTACTCCTT

2.8 Co-immunoprecipitation (Co-IP) and ubiquitination detection

2.9 Bioinformatics

2.10 Dual-luciferase reporter assay

2.11 Statistical analysis

3 Results

3.1 USP14 is highly expressed in ox-LDL-induced cell model of CHD

Conflict of interest

References

Table 1
qPCR primers

Forward primer (5^′-3^′) Reverse primer (5^′-3^′)

miR-15b-5p GCCGAGTAGCAGCACATCAT CTCAACTGGTGTCGTGGA

USP14 TGGCTTCAGCGCAGTATATTAC CCTTGTTCACCTTTCTCGGCA

U6 GTGCTCGCTTCGGCAGCA AAAATATGGAACGCTTCA

GAPDH CTCAACTACATGGTTTAC CCAGGGGTCTTACTCCTT