Angiotensin-converting enzyme inhibitors provide a protective effect on hypoxia-induced injury in human coronary artery endothelial cells via Nrf2 signaling and PLVAP

Abstract

BACKGROUND:

Angiotensin-converting enzyme inhibitors (ACEIs) were reported to protect from hypoxia-induced oxidative stress in coronary endothelial cells (CECs) after acute myocardial infarction (AMI). Nrf2 shows a protective effect in hypoxia-induced CECs after AMI. Plasmalemma vesicle-associated protein (PLVAP) plays a pivotal role in angiogenesis after AMI.

AIM:

To explore the protective effect of ACEIs and the involved mechanisms under hypoxia challenge.

METHODS:

Human coronary endothelial cells (HCAECs) were used to establish hypoxia-induced oxidative stress injury in vitro. Flow cytometry was used to evaluate the protective effect of ACEI on hypoxia conditions.ET-1, NO, ROS, and VEGF were detected by ELISA. HO-1, Nrf2, and Keap-1, the pivotal member in the Nrf2 signaling pathway, eNOS and PLVAP were detected in HEAECs treated with ACEI by immunofluorescence, qPCR, and western blotting.

RESULTS:

The hypoxia ACEI or Nrf2 agonist groups showed higher cell viability compared with the hypoxia control group at 24 (61.75±1.16 or 61.23±0.59 vs. 44.24±0.58, both P < 0.05) and 48 h (41.85±1.19 or 59.64±1.13 vs. 22.98±0.25, both P < 0.05). ACEI decreased the levels of ET-1 and ROS under hypoxia challenge at 24 and 48 h (all P < 0.05); ACEI increased the VEGF and NO levels (all P < 0.05). ACEI promoted the expression level of eNOS, HO-1, Nrf2 and PLVAP but inhibited Keap-1 expression at the mRNA and protein levels (all P < 0.05). Blockade of the Nrf2 signaling pathway significantly decreased the expression level of PLVAP.

CONCLUSION:

ACEI protects hypoxia-treated HEAECs by activating the Nrf2 signaling pathway and upregulating the expression of PLVAP.

Keywords

Acute myocardial infarction angiotensin-converting enzyme inhibitor nuclear factor erythroid 2 signaling pathway human coronary endothelial cells plasmalemma vesicle-associated protein

1 Introduction

Acute myocardial infarction (AMI) is an emergent condition and accounts for an important proportion of global mortality [1, 2]. Despite successful revascularization and survival, the coronary endothelial cells remain dysfunctional and under oxidative stress due to ischemia-reperfusion injury [3 –7]. Although the expression of the angiotensin type 2 receptor (AT2R) is relatively low in adults, its expression increases in pathological conditions [8]. AT2R is involved in the bradykinin/NO/cGMP pathway, which promotes vasodilation and activates phospholipase A2 (linked to potassium current control) and the serine/threonine phosphatases [9]. AT2R blockage can reduced vascular tone [10]. AT2R affects arterial remodeling, prevents atherosclerosis, and decreases blood pressure (when associated with an AT1R inhibitor). The AT2R enhances cardiac function after myocardial infarction by reducing infarct size, cardiac hypertrophy, and fibrosis. Moreover, it was reported that angiotensin-converting enzyme inhibitors (ACEIs), widely used in managing cardiovascular diseases, protect the vascular endothelial cells by regulating intracellular oxidation-reduction reactions [11, 12]. Nevertheless, the exact mechanisms and signaling pathways of ACEI protection are still not fully understood, and their role in the heart remains controversial [13].

The nuclear factor erythroid 2 (Nrf2) signaling pathway plays a pivotal role in oxidative stress after AMI, and the activation of the Nrf2 signaling pathway showed protective effects on coronary endothelial cells (CECs) after AMI [14 –16]. Meanwhile, the plasmalemma vesicle-associated protein (PLVAP) plays a pivotal role in angiogenesis after AMI [17 –21]. Li et al. reported that PLVAP was increased in the new blood vessels in the infarcted area after AMI [22]. In addition, knocking out PLVAP inhibits the proliferation of endothelial cells, indicating that PLVAP has the potential to be a novel therapeutic target for AMI [22]. Nevertheless, the relationship between ACEI and Nrf2 or PLVAP is still unclear.

Therefore, the present study aimed to use human coronary endothelial cells (HCAECs) to explore the protective effect of ACEIs and the involved mechanisms under hypoxia challenge. The results could help define the usefulness of ACEIs in managing AMI.

2 Materials and methods

2.1 Cell culture

The HCAECs (CP-H087, Punosai Biological Co., Wuhan, China) were cultured at 37°C under 5% CO₂ in RPMI 1640 medium containing 10% fetal bovine serum and 1% penicillin/streptomycin. The passage was performed when the cells reached 80–90% confluence.

The cells were divided into a control group and a hypoxic group for cell modeling by random grouping method after three passages of cells [23]. The cells in control group did not receive any treatment, while the cells in the hypoxia group were treated with 100μmoL/L CoCl₂ for 8 hours to induce hypoxia. Eight hours later, cells were returned to normal culture conditions and continued to be cultured and divided into subgroups. Four subgroups were set in each group: control group, ACEI group (perindopril tert-butylamine), Keap1-Nrf2-ARE signaling pathway agonist group (TAT-14 TFA; agonist group) [24], and Keap1-Nrf2-ARE signaling pathway blocker group (Nrf2-IN-1; blocker group). The cells were cultured in 6-well plates and added with 100μmoL/L ACEI, 50μmoL/L TAT-14 TFA, or 10μmoL/L Nrf2-IN-1 according to grouping. The cells were collected after treatment for 0, 24, and 48 h for the subsequent experiments. 0 h was used to observe the changes of each index after the establishment of hypoxia model, 24 and 48 h were used to observe the effect of ACEI on each index.

2.2 Analysis of tissue single-cell suspension and flow cytometry

The cells were digested in DMEM medium at 37°C with 0.1 mg/mL collagenase (Sigma, St. Louis, MO, USA) and 1 mg/mL disperse enzyme II (Sigma, St. Louis, MO, USA) for 30 min and then crushed through a screen to obtain a single-cell suspension. In order to measure the microvascular density of HCAECs, the cells were stained with anti-human CD31 (Biolegend, San Diego, CA, USA) and CD34 (Biolegend, San Diego, CA, USA), according to the manufacturer’s instructions. The samples were analyzed by flow cytometry (FCM).

2.3 Enzyme-linked immunosorbent assay (ELISA)

The cell culture medium of each group was collected and centrifuged at 4000 rpm for 20 min. Commercial kits for endothelin-1 (ET-1), nitric oxide (NO), total reactive oxygen species (ROS), and vascular endothelial growth factor (VEGF) were used according to the manufacturer’s instructions (Shanghai Enzyme-linked Biotechnology Co., Ltd, China). The microplates were read using a microplate reader (Molecular Devices,San Jose,CA, USA) at the wavelength specified in each kit.

2.4 Immunofluorescence

HCAECs were grown to confluence on coverslips in 35-mm polystyrene cell culture plates coated with 2μg/cm² fibronectin before treatment. The cells were initially treated with the drugs for 1, 2, 4, 8, and 12 h to determine the optimal duration of treatment for visualizing Nrf2 nuclear localization. According to the time course experiments, all treatments lasted 1 h. The cells were washed with PBS, fixed for 30 min in 4% paraformaldehyde, washed with PBS, and permeabilized in cold acetone for 30 min. The cells were blocked for 1 h in 5% bovine serum albumin with 0.5% goat serum and then incubated with the primary antibody (1:500) for 1 h at room temperature. The cells were washed with PBS and incubated for 45 min in FITC-conjugated secondary antibody (1:50) at room temperature in the dark. The coverslips were mounted on slides using DAPI containing mounting medium to identify cell nuclei and visualized by fluorescence microscopy (Nikon TE2000) using Metamorph data acquisition software (Molecular Devices, San Jose, CA, USA).

2.5 Reverse transcriptase polymerase chain reaction (RT-PCR)

The first-strand cDNA was synthesized using the M-MLV reverse transcriptase (GIBCO, Invitrogen Inc., Carlsbad, CA, USA) using oligomer (dT) primers. The reaction was carried out for 50 min at 55°C in a final volume of 20μL. The RT-PCR mix included 2μL of cDNA, 10μL of 2×T5 Fast qPCR Mix (Beijing Tsingke Biotech Co., Ltd, China), 0.4μL of 50×ROX Reference Dye II (Beijing Tsingke Biotech Co., Ltd, China) Each primer (0.8μL) (Table 1) was added to a reaction volume of 20μl. RT-PCR with GADPH as the internal was carried out in the same tube, and the amplification products increased linearly through 40 cycles. The amplified solution (5μL) was run in 3% agarose gel electrophoresis triester borate/EDTA buffer and stained with 0.5μg/mL ethidium bromide.

Table 1
Primer sequences

Transcript number Length of output (bp) Forward (5’-3’) Reverse (5’-3’)

eNOS NM_000603.5 188 ATGTTTGTCTGCGGCGATGTTAC ATGCGGCTTGTCACCTCCTG

Nrf2 NM_006164.5 106 AGTGGATCTGCCAACTACTC CATCTACAAACGGGAATGTCTG

HO-1 NM_002133.3 167 CCTTCTTCACCTTCCCCAACAT CAGCTCCTGCAACTCCTCAAA

PLVAP NM_031310.3 202 GCCCTTTCACACACACTTTCT ATGGCTTCCTGTTCTCACCTC

GAPDH NM_001256799.3 101 CTGGGCTACACTGAGCACC AAGTGGTCGTTGAGGGCAATG

	Transcript number	Length of output (bp)	Forward (5’-3’)	Reverse (5’-3’)
eNOS	NM_000603.5	188	ATGTTTGTCTGCGGCGATGTTAC	ATGCGGCTTGTCACCTCCTG
Nrf2	NM_006164.5	106	AGTGGATCTGCCAACTACTC	CATCTACAAACGGGAATGTCTG
HO-1	NM_002133.3	167	CCTTCTTCACCTTCCCCAACAT	CAGCTCCTGCAACTCCTCAAA
PLVAP	NM_031310.3	202	GCCCTTTCACACACACTTTCT	ATGGCTTCCTGTTCTCACCTC
GAPDH	NM_001256799.3	101	CTGGGCTACACTGAGCACC	AAGTGGTCGTTGAGGGCAATG

2.6 Western blot

HCAECs were seeded in 65-mm polystyrene cell culture dishes and grown to at least 80% confluence before treatment. Following treatment, the cells were scraped in RIPA buffer (50 mM Tris, 0.15 M NaCl, 1% Na deoxycholic acid, 1 mM EGTA, 1% NP40) containing protease and phosphatase inhibitors and sonicated 3×10 s. Protein concentrations were determined using a BCA assay, and the samples were diluted using Laemmli sample buffer (Thermo Fisher Scientific, Waltham, MA, USA). Samples were separated on 10% polyacrylamide gels at 125 V and transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA, USA) for 1 h at 50 V. The membranes were blocked for 1 h in Superblock (Thermo Fisher Scientific, Waltham, MA, USA) and then incubated with primary antibodies (1:1000) against eNOS, HO-1, Nrf2, PLVAP and GAPDH followed by the appropriate HRP-conjugated secondary antibodies (1:2000). Membranes were developed by chemiluminescence using the SuperSignal West Dura substrate (Thermo Fisher Scientific, Waltham, MA, USA), with digital images obtained using the Biospectrum UVP system. All signals were normalized to GAPDH obtained from the same blot and expressed as the percent of the vehicle control (no drug) condition.

2.7 Statistical analysis

SPSS 22.0 (IBM, Armon, NY, USA) was used for statistical analysis. One-way ANOVA and Tukey’s post hoc test were used to compare more than two groups. The data were presented as means±standard deviations. Two-sided P-values < 0.05 were considered statistically significant.

3 Results

3.1 Protective effect of ACEI on hypoxia-induced cell injury

In order to determine whether ACEI could protect against hypoxia-induced cell injury, the mortality of HCAECs was assessed using flow cytometry (Fig. 1). There were no significant differences in the cell death rate among the control, ACEI, blockers, and agonist groups in the absence of hypoxia. Hypoxia significantly decreased cell viability compared with the control group at 24 h (44.24±0.58 vs. 96.12±0.06, P < 0.05) and 48 h (22.98±0.25 vs. 93.34±0.42, P < 0.05). Moreover, compared with the corresponding groups without hypoxia, the cell viability of the hypoxia groups treated with ACEI, blockers, or agonists was significantly decreased (P < 0.05) at 0, 24, and 48 h. The cell viability of the hypoxia Nrf2 blocker groups was lower compared with the hypoxia control group at 24 h (30.19±0.26 vs. 44.24±0.58, P < 0.05) and 48 h (10.28±0.33 vs. 22.98±0.25, P < 0.05), suggesting a relationship between hypoxia and Nrf2 signaling. In comparison, the hypoxia ACEI or Nrf2 agonist groups showed higher cell viability compared with the hypoxia control group at 24 h (61.75±1.16 or 61.23±0.59 vs. 44.24±0.58, both P < 0.05) and 48 h (41.85±1.19 or 59.64±1.13 vs. 22.98±0.25, both P < 0.05). These results suggest that ACEI improves the viability of HCAECs exposed to hypoxia for a short time (Fig. 1).

Fig. 1

Protective effect of angiotensin-converting enzyme inhibitor (ACEI) on hypoxia-induced cell injury. Human coronary endothelial cells (HCAECs) were treated with hypoxia, hypoxia + ACEI, hypoxia + blocker, and hypoxia + agonists for 24 and 48 h, respectively. The cell mortality was determined by PI staining. n = 10. *P < 0.05 vs. the blank control group; ^#P < 0.05 vs. the normal ACEI group; ▴P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway blocker group; ^&P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway agonist group; •P < 0.05 vs. the hypoxic blank control.

3.2 Protective effect of ACEI on oxidative stress

In order to determine the protective effect of ACEI on oxidative stress, ELISA was used to detect the levels of ET-1, NO, total ROS, and VEGF in HCAECs. As shown in Fig. 2, the levels of ET-1, ROS, and VEGF in the hypoxia control group were significantly higher than in the control group at 0, 24 and 48 h (all P < 0.05). ACEI significantly decreased the levels of ET-1 and ROS under hypoxia challenge at 24 and 48 h (all P < 0.05) (Fig. 2A, 2B). The VEGF levels in the hypoxia groups added with ACEI or Nrf2 agonists were significantly increased, compared with the hypoxia control group at 24 and 48 h (all P < 0.05) (Fig. 2C). NO, as an antioxidant marker, was significantly decreased in the hypoxia control group compared with the control group at all time points (P < 0.05) (Fig. 2D). Treatment with ACEI or Nrf2 agonist increased the NO levels compared with the hypoxia control group at 24 and 48 h (P < 0.05). Nrf2 blockers decreased the NO levels relative to the hypoxia control group at 24 and 48 h (all P < 0.05). These findings suggest that ACEI may reverse hypoxia-induced injury of HCAEC cells by regulating oxidative stress.

Fig. 2

Angiotensin-converting enzyme inhibitor (ACEI) alleviates hypoxia-induced oxidative stress in human coronary endothelial cells (HCAECs). ELISA was conducted to evaluate the oxidative stress indicators in HCAECs, including ET-1, ROS, VEGF, and NO. (A) The level of ET-1 in HCAECs. (B) The level of ROS in HCAECs. (C) The level of VEGF in HCAECs. (D) The level of NO in HCAECs. n = 10. *P < 0.05 vs. the normal blank control group; ^#P < 0.05 vs. the normal ACEI group; ▴P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway blocker group; ^&P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway agonist group; •P < 0.05 vs. the hypoxic blank control group; ★P < 0.05 vs. the hypoxic Keap1-Nrf2-ARE signaling pathway blocker group. A-D The level of ET-1, ROS, VEGF, and NO in HCAECs.

3.3 Effect of ACEI on the Nrf2 signaling pathway in hypoxia-induced cell injury

In order to evaluate the relationship between the Nrf2 signaling pathway and ACEI in hypoxia-induced cell injury, the expression of the molecules in the Nrf2 signaling pathway was assessed by immunofluorescence, including HO-1, Nrf2, and Keap-1.

As shown in Fig. 3, the expression of HO-1 in the hypoxia control group was higher than in the control group (P < 0.05) at 0, 24, and 48 h. Similar changes were observed in the ACEI, blockers, and agonist groups with or without hypoxia. The expression of HO-1 in the control and hypoxia control groups was notably decreased under Nrf2 blocker treatment (P < 0.05). On the other hand, the ACEI and agonist treatments significantly upregulated HO-1 compared with the hypoxia control group (P < 0.05). These results suggested that ACEI increased the HO-1 expression.

Fig. 3

The effect of angiotensin-converting enzyme inhibitor (ACEI) on HO-1 expression in the hypoxia-induced cell injury. (A) The representative fluorescent images of HO-1 at different time courses. (B) Quantitative analysis of fluorescence intensity of HO-1 at 0 h. (C) Quantitative analysis of fluorescence intensity of HO-1 at 24 h. (D) Quantitative analysis of fluorescence intensity of HO-1 at 48 h. n = 10. *P < 0.05 vs. the normal blank control group; ^#P < 0.05 vs. 1 the normal ACEI group; ▴P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway blocker group; ^&P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway agonist group; •P < 0.05 vs. the hypoxic blank control group; ★P < 0.05 vs. the hypoxic Keap1-Nrf2-ARE signaling pathway blocker group. A. The representative fluorescent images of HO-1 at different time courses. B-D. Quantitative analysis of fluorescence intensity of HO-1.

As shown in Fig. 4, the expression of Nrf2 was increased in the hypoxia control group compared with the control group (P < 0.05) at 0, 24, and 48 h. Treatment with ACEI enhanced the expression of Nrf2 in the hypoxia groups (P < 0.05) at 24 and 48 h (Fig. 4C-D).

Fig. 4

The effect of angiotensin-converting enzyme inhibitor (ACEI) on Nrf2 expression in the hypoxia-induced cell injury. (A) The representative fluorescent images of Nrf2 at different time courses. (B) Quantitative analysis of fluorescence intensity of Nrf2 at 0 h. (C) Quantitative analysis of fluorescence intensity of Nrf2 at 24 h. (D) Quantitative analysis of fluorescence intensity of Nrf2 at 48 h. n = 10. P < 0.05 vs. the normal blank control group; ^#P < 0.05 vs. the normal ACEI group; ▴P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway blocker group; ^&P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway agonist group; •P < 0.05 vs. the hypoxic blank control group; ★P < 0.05 vs. the hypoxic Keap1-Nrf2-ARE signaling pathway blocker group. A The representative fluorescent images of Nrf2 at different time courses. B-D Quantitative analysis of fluorescence intensity of Nrf2.

As shown in Fig. 5, the expression of Keap-1 in the four hypoxia groups was decreased compared with the relevant group without hypoxia condition (all P < 0.05). Compared with the hypoxia control group, the expression of Keap-1 in the hypoxia groups treated with ACEI was further decreased (both P < 0.05) at 24 and 48 h.

Fig. 5

The effect of angiotensin-converting enzyme inhibitor (ACEI) on Keap-1 expression in the hypoxia-induced cell injury. (A) The representative fluorescent images of Keap-1 at different time courses. (B) Quantitative analysis of fluorescence intensity of Keap-1 at 0 h. (C) Quantitative analysis of fluorescence intensity of Keap-1 at 24 h. (D) Quantitative analysis of fluorescence intensity of Keap-1 at 48 h. n = 10. P < 0.05 vs. the normal blank control group; ^#P < 0.05 vs. the normal ACEI group; ▴P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway blocker group; ^&P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway agonist group; •P < 0.05 vs. the hypoxic blank control group; ★P < 0.05 vs. the hypoxic Keap1-Nrf2-ARE signaling pathway blocker group. A. The representative fluorescent images of Keap-1 at different time courses. B-D Quantitative analysis of fluorescence intensity of Keap-1.

3.4 Effect of ACEI on the expression of PLVAP in the hypoxia-induced cell injury

As shown in Fig. 6, the changes in PLVAP were similar to the changes in Nrf-2. The increased expression of PLVAP induced by hypoxia at 24 and 48 h compared with the control group could be further upregulated by ACEI and Nrf2 agonist (P < 0.05). Whereas, at 24 and 48 h, the expression of PLVAP in the hypoxia plus Nrf2 blockers group was decreased compared with the hypoxia control group (P < 0.05).

Fig. 6

The effect of angiotensin-converting enzyme inhibitor (ACEI) on PLVAP expression in the hypoxia-induced cell injury. (A) The representative fluorescent images of PLVAP at different time courses. (B) Quantitative analysis of fluorescence intensity of PLVAP at 0 h. (C) Quantitative analysis of fluorescence intensity of PLVAP at 24 h. (D) Quantitative analysis of fluorescence intensity of PLVAP 1 at 48 h. n = 10. P < 0.05 vs. the normal blank control group; ^#P < 0.05 vs. the normal ACEI group; ▴P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway blocker group; ^&P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway agonist group; •P < 0.05 vs. the hypoxic blank control group; ★P < 0.05 vs. the hypoxic Keap1-Nrf2-ARE signaling pathway blocker group. A. The representative fluorescent images of PLVAP at different time courses. B-D Quantitative analysis of fluorescence intensity of PLVAP.

3.5 Effect of ACEI on the Nrf2 signaling pathway and PLVAP in HCAECs at the mRNA level

The mRNA expression of the Nrf2 signaling pathway and PLVAP were examined by RT-PCR (Fig. 7). As shown in Fig. 7A, the decrease in the expression of the endothelial NO synthase (eNOS) induced by hypoxia was reversed by ACEI or Nrf2 agonist treatment at 24 and 48 h (P < 0.05). The Nrf2 blocker did not significantly change the expression of eNOS in the presence of hypoxia. The expression of Nrf2 was significantly increased in all four hypoxia groups compared with the control group at 0, 24 and 48 h (Fig. 7B). Moreover, the hypoxia groups treated with ACEI or Nrf2 agonist showed higher expression levels of Nrf2 compared with the hypoxia group at 24 and 48 h. ACEI and Nrf2 agonists increased the expression of HO-1 mRNA (Fig. 7C). As shown in Fig. 7D, the increased level of PLVAP induced by hypoxia at 24 and 48 h compared with the control group could be further upregulated by ACEI or Nrf2 agonist (P < 0.05). At 24 and 48 h, the expression of PLVAP in the hypoxia plus Nrf2 blocker group was decreased compared with the hypoxia control group (P < 0.05). Hence, these data indicated that ACEI could upregulate the mRNA expression of eNOS, Nrf2, and HO-1 under hypoxic conditions. Meanwhile, ACEI and Nrf2 agonists could upregulate the mRNA expression of PLVAP in the hypoxic condition, and the expression levels of PLVAP were decreased when Nrf2 was blocked.

Fig. 7

The effect of angiotensin-converting enzyme inhibitor (ACEI) on the Nrf2 signaling pathway and PLCAP in human coronary endothelial cells (HCAECs) at the mRNA level. The molecules in the Nrf2 signaling pathway and PLVAP were further detected through RT-PCR. (A) The mRNA expression of eNOS in HCAECs. (B) The mRNA expression of Nrf2 in HCAECs. (C) The mRNA expression of HO-1 in HCAECs. (D) The mRNA expression of PLVAP in HCAECs. n = 10. P < 0.05 vs. the normal blank control group; ^#P < 0.05 vs. the normal ACEI group; ▴P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway blocker group; ^&P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway agonist group; •P < 0.05 vs. the hypoxic blank control group; ★P < 0.05 vs. the hypoxic Keap1-Nrf2-ARE signaling pathway blocker group. A-D The mRNA expression of eNOS,Nrf2, HO-1 and PLVAP in HCAECs.

3.6 Effect of ACEI on the Nrf2 signaling pathway and PLVAP in HCAECs at the protein levels

The protein levels of eNOS, HO-1, Nrf2, and PLVAP in HCAECs were measured by western blotting (Fig. 8). The decreased levels of eNOS induced by hypoxia compared with the control group were partly reversed by ACEI and Nrf2 agonist (P < 0.05) at 24 and 48 h. Under hypoxia, the Nrf2 blocker failed to change the protein expression of eNOS (Fig. 8B). At 24 and 48 h, the levels of HO-1 in the hypoxia group treated with ACEI or Nrf2 agonist were higher than in the control and hypoxia control groups (all P < 0.05) (Fig. 8C). The protein levels of Nrf2 (Fig. 8D) and PLVAP (Fig. 8E) in the hypoxia control group were significantly higher than in the control group (P < 0.05). Treatment with ACEI or Nrf2 agonist enhanced Nrf2 and PLVAP protein expression in the hypoxia groups (P < 0.05). Furthermore, compared with the hypoxia control group, PLVAP was decreased at 24 and 48 h when Nrf2 was blocked (P < 0.05). These results indicated that ACEI and Nrf2 agonist could upregulate the protein expression of eNOS, Nrf2, HO-1, and PLVAP under hypoxic conditions.

Fig. 8

The effect of angiotensin-converting enzyme inhibitor (ACEI) on the Nrf2 signaling pathway and PLVAP in human coronary endothelial cells (HCAECs) at the protein level. (A) The representative blots of eNOS, HO-1, Nrf2, and PLVAP in HCAECs, and GAPDH served as the internal reference, The groups on the blotting at each time point were from left to right:Control, ACEI, Blockers, Agonists,Oxygen Control,Oxygen ACEI,Oxygen Blockers,Oxygen Agonists. (B) Quantitative analysis of protein expression of eNOS in HCAECs. (C) Quantitative analysis of protein expression of HO-1 in HCAECs. (D) Quantitative analysis of protein expression of Nrf2 in HCAECs. (E) Quantitative analysis of protein expression of PLVAP in HCAECs. n = 10. P < 0.05 vs. the normal blank control group; ^#P < 0.05 vs. the normal ACEI group; ▴P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway blocker group; ^&P < 0.05 vs. the normal Keap1-Nrf2-ARE signaling pathway agonist group; •P < 0.05 vs. the hypoxic blank control group; ★P < 0.05 vs. the hypoxic Keap1-Nrf2-ARE signaling pathway blocker group. A. The representative blots of eNOS, Nrf2, HO-1 and PLVAP in HCAECs, and GAPDH served as the internal reference. B-E Quantitative analysis of protein expression of eNOS, HO-1,Nrf2 and PLVAP in HCAECs.

4 Discussion

In this study, ACEI had a protective effect against hypoxia-induced cell damage in HCAECs, and the underlying mechanisms were explored. The results first demonstrated that ACEI could inhibit hypoxia-induced cell death of HCAECs within a short period. In addition, ACEI can activate the antioxidant Nrf2 signaling pathway, which alleviates oxidative stress in HCAECs after hypoxia. ACEI could upregulate the expression of PLVAP, a protein pivotal in revascularization. Hence, these results provide a potential therapeutic target for AMI.

Indeed, AMI is a critical condition involving the ischemia of a part of the heart muscle [25]. If reperfusion is not achieved rapidly, the ischemic part will die, and the extent of the infarct area will determine the fate of the patient [25 –27]. Still, reperfusion after ischemia is also associated with cell injury (the so-called ischemia-reperfusion injury), mainly through oxidative stress [28, 29]. Hence, examining ways to alleviate the oxidative stress after AMI could be conducive to mitigating the impact of the ischemia-reperfusion injury and improving patient outcomes. Still, oxidative stress is also involved in the first phase (i.e., ischemia) of the injury [30]. New evidence suggest that the cells died in autophagy when the ischemia-reperfusion injury occurs [31]. However, the loss of antioxidant defenses is an essential feature of apoptosis, which is induced by hypoxia through the antioxidant system [32, 33]. During ischemia increased adhesion of white blood cells to the endothelium and edema (after 1 hour) are reversible [34]. However, after longer-lasting ischemia (up to 6 hours) a homogenization of cells occurs, accompanied by cell necrosis [35]. At this time the occlusion might become manifest and structural changes in the vessel wall with massive diapedesis can occur. In the present study, a model of hypoxia (without reperfusion) was used. Findings methods to decrease oxidative stress after AMI is clinically significant.

ACEIs are widely used to manage blood pressure, heart failure, left ventricular dysfunction, diabetes, nephrotic syndrome, chronic kidney disease, and glomerular diseases [36]. ACEIs interfere with the renin-angiotensin-aldosterone system by blocking the conversion of angiotensin I into angiotensin II, which possesses vasoconstriction properties [36]. Furthermore, recent studies showed that ACEIs could also protect the vascular endothelial cells by alleviating oxidative stress [11, 12]. In the present study, ACEI protected the HCAECs from hypoxia-induced cell death, decreased ET-1 and ROS, and increased VEGF and NO. NO is a potent vasodilator and a ROS scavenger [37]. Its amount is a direct marker of the antioxidation potential of cells and blood vessels [37]. ROS are byproducts of mitochondrial activity, and dysfunctional mitochondria will produce large amounts of ROS; ROS can also be produced by various immune cells to attack microorganisms [37]. ET-1 is generally elevated after AMI and is involved in vascular and myocardial damage [38]. VEGF is involved in neovascularization after AMI, and elevated VEGF levels participate in the formation of collateral circulation to the infarct area [39]. Hence, the effects of ACEI of decreasing ROS and ET-1 and increasing NO and VEGF could be associated with benefits after AMI. Of note, these effects started to be significant as early as after 24 h of hypoxia, suggesting that ACEIs are cardioprotective in the very early stages of AMI.

Nevertheless, the exact protective mechanisms of ACEIs remain not fully understood [13, 36]. The present study examined two potential candidates: the Nrf2 axis and PLVAP. Nrf2 signaling was reported to hold protective effects in cardiovascular disease [15, 49–41]. Indeed, the activation of Nrf2 signaling alleviates inflammation and oxidative stress in rat models of left anterior descending coronary artery ligation [42]. Furthermore, Nrf2 participates in antioxidant defenses, maintains iron homeostasis, decreases inflammation, and promotes mitochondrial biogenesis to decrease mitochondrial dysfunction [41]. However, only rare studies explored the Nrf2 signaling pathway in human CECs after AMI. The present study demonstrated that the activation of the Nrf2 signaling pathway alleviated hypoxia-induced HCAEC damage, as supported by the Nrf2 agonist and blocker experiments. In addition, ACEI treatment activated Nrf2 signaling in a similar way as the Nrf2 agonist did, leading to better cell viability and decreased oxidative stress. Hence, activating the Nrf2 pathway is probably one of the mechanisms of ACEIs’ beneficial effects after AMI.

PLVAP is an essential regulator in neovascularization after ischemic injury [43]. Considering that the function of PLVAP in human coronary endothelial cells after AMI is still unclear, this study explored whether ACEI treatment could protect against hypoxia-induced injury by upregulating PLVAP [20, 21]. The results showed that ACEI significantly increased the expression of VEGF in HCAECs. VEGF activates VEGFR-2 and upregulates the expression of PLVAP in human umbilical vein endothelial cells [43, 44]. Therefore, the present study showed that the PLVAP expression levels were increased in HCAECs after ACEI treatment. Unexpectedly, the activation of Nrf2 signaling using an Nrf2 agonist also increased the expression of PLVAP, and the blockade of Nrf2 signaling could decrease the expression of PLVAP, indicating that the expression of PLVAP is partially regulated by Nrf2 signaling. It is the first study showing a relationship between Nrf2 signaling and PLVAP under ACEI treatment. Additional studies are necessary to understand it better.

This study was exploration study which had several limitations. The first time point was 24 h, and it is unknown how early ACEIs can act after the onset of hypoxia or ischemia. Second, the present study used a model of hypoxia, which does not completely mimic the conditions observed in ischemia. Third, this study was performed in cells, and whether similar effects can be seen in vivo will require animal studies. Fourth, only Nrf2 agonists and blockers were used. Comprehensive experiments using inhibitors and activators of all involved proteins will be necessary to understand the mechanisms of ACEI. Fifth, despite the observed effects of ACEIs on Nrf2 and PLVAP, how the signal is transduced from a receptor down to Nrf2 and PLVAP remains unknown. Hence, much study is still necessary to understand the effects of ACEIs on AMI.

5 Conclusion

In HEACEs, ACEIs protect against hypoxia-induced injury via Nrf2 signaling and PLVAP. ACEI significantly prevented cell death, alleviated oxidative stress and promotes neovascularization. These results provide some understanding of the benefits of ACEIs after AMI.

Conflict of interest

The authors declare that there is no conflict of interest.

Funding

This study was supported by the Guiding Science and Technology Project of Guangyuan City, Sichuan Province (grant #21ZDYF0047) and the Medical Science Research Project of Hebei Province (grant #20200322).

Author contributions

Qiubing Zhang, Fang Gou carried out the studies, participated in collecting data, and drafted the manuscript. Ping Shi, Zhe Xu and Jun Zhang performed the statistical analysis and participated in its design. Xiaohong Yin, Zhitao Yan, Yuanjun He,Mingfang He participated in acquisition, analysis, or interpretation of data and draft the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

References

Agyemang

, van Oeffelen

, Bots

, Stronks

, Vaartjes

. Socioeconomic inequalities in acute myocardial infarction incidence in migrant groups: has the epidemic arrived? analysis of nation-wide data. Heart. 2014;100:239–46. doi: 10.1136/heartjnl-2013-304721

Wang

, Leifheit

, Krumholz

. Trends in 10-Year Outcomes Among Medicare Beneficiaries Who Survived an Acute Myocardial Infarction. JAMA Cardiol. 2022;7:613–22. doi: 10.1001/jamacardio.2022.0662

Zhang

, Huang

, Shi

, Yang

, Hua

, Ma

, Zhu

, Liu

, Xuan

, Shen

, et al. Metformin protects against myocardial ischemia-reperfusion injury and cell pyroptosis via AMPK/NLRP3 inflammasome pathway. Aging (Albany NY). 2020;12:24270–87. doi: 10.18632/aging.202143

Zhang

, Liu

, Hu

, Zhang

, Xie

, Cui

. HIF-1alpha/BNIP3 signaling pathway-induced-autophagy plays protective role during myocardial ischemia-reperfusion injury. Biomed Pharmacother. 2019;120:109464. doi: 10.1016/j.biopha.2019.109464

Zhang

, Wang

, Xu

, Tian

, Hu

, Chen

, Fu

. Melatonin attenuates myocardial ischemia-reperfusion injury via improving mitochondrial fusion/mitophagy and activating the AMPK-OPA1 signaling pathways. J Pineal Res. 2019;66:e12542. doi: 10.1111/jpi.12542

Morgan

, Liu

. Crosstalk of reactive oxygen species and NF-kappaB signaling. Cell Res. 2011;21:103–15. doi: 10.1038/cr.2010.178

Krüger-Genge

, Blocki

, Franke

, Jung

. Vascular Endothelial Cell Biology: An Update. Int J Mol Sci. 2019;20(18). doi: 10.3390/ijms20184411

Tsutsumi

, Matsubara

, Ohkubo

, Mori

, Nozawa

, Murasawa

, Kijima

, Maruyama

, Masaki

, Moriguchi

, Shibasaki

, Kamihata

, Inada

, Iwasaka

. Angiotensin II type 2 receptor is upregulated in human heart with interstitial fibrosis, and cardiac fibroblasts are the major cell type for its expression. Circ Res. 1998;83(10):1035–46.

Faria-Costa

, Leite-Moreira

, Henriques-Coelho

. Cardiovascular effects of the angiotensin type 2 receptor. Rev Port Cardiol. 2014;33:439–49. doi: 10.1016/j.repc.2014.02.011

10.

Tehrani

, White

, Tung

, Zhao

RRY

, Milad

, Seidman

, Sauge

, Theret

, Rossi

FMV

, Esfandiarei

, van Breemen

, Bernatchez

. Pleiotropic activation of endothelial function by angiotensin II receptor blockers is crucial to their protective anti-vascular remodeling effects. Sci Rep. 2022;12(1):9771.

11.

Del Re

, Amgalan

, Linkermann

, Liu

, Kitsis

. Fundamental Mechanisms of Regulated Cell Death and Implications for Heart Disease. Physiol Rev. 2019;99:1765–817. doi: 10.1152/physrev.00022.2018

12.

Chen

, Maltagliati

. Nrf2 at the heart of oxidative stress and cardiac protection. Physiol Genomics. 2018;50:77–97. doi: 10.1152/physiolgenomics.00041.2017

13.

Juneja

, Zia

, Abeysekara

, Shams

, Singh

, Schor

, Deitch

. Angiotensin converting enzyme inhibitors and angiotensin receptor blockers have no effect on the outcomes of endovascular revascularization in tibial arterial occlusive disease. Vascul Pharmacol. 2020;131:106764. doi: 10.1016/j.vph.2020.106764

14.

Maulik

, Kumar

. Oxidative stress and cardiac hypertrophy: a review. Toxicol Mech Methods. 2012;22:359–66. doi: 10.3109/15376516.2012.666650

15.

Barancik

, Gresova

, Bartekova

, Dovinova

. Nrf2 as a key player of redox regulation in cardiovascular diseases. Physiol Res. 2016;65(Suppl 1):S1–S10. doi: 10.33549/physiolres.933403

16.

Cui

, Luk

, Li

, Chan

, Lei

, Wang

, Shen

, Leung

, Lee

. Cytoprotection of baicalein against oxidative stress-induced cardiomyocytes injury through the Nrf2/Keap1 pathway. J Cardiovasc Pharmacol. 2015;65:39–46. doi: 10.1097/FJC.0000000000000161

17.

Ichimura

, Stan

, Kurihara

, Sakai

. Glomerular endothelial cells form diaphragms during development and pathologic conditions. J Am Soc Nephrol. 2008;19:1463–71. doi: 10.1681/ASN.2007101138

18.

Madden

, Cook

, Nacht

, Weber

, Callahan

, Jiang

, Dufault

, Zhang

, Walter-Yohrling

, et al. Vascular gene expression in nonneoplastic and malignant brain. Am J Pathol. 2004;165:601–8. doi: 10.1016/s0002-9440(10)63324-x

19.

Stan

. Endothelial stomatal and fenestral diaphragms in normal vessels and angiogenesis. J Cell Mol Med. 2007;11:621–43. doi: 10.1111/j.1582-4934.2007.00075.x

20.

Strickland

, Jubb

, Hongo

, Zhong

, Burwick

, Fu

, Frantz

, Koeppen

. Plasmalemmal vesicle-associated protein (PLVAP) is expressed by tumour endothelium and is upregulated by vascular endothelial growth factor-A (VEGF). J Pathol. 2005;206:466–75. doi: 10.1002/path.1805

21.

Carson-Walter

, Hampton

, Shue

, Geynisman

, Pillai

, Sathanoori

, Madden

, Hamilton

, Walter

. Plasmalemmal vesicle associated protein-1 is a novel marker implicated in brain tumor angiogenesis. Clin Cancer Res. 2005;11:7643–50. doi: 10.1158/1078-0432.CCR-05-1099

22.

, Solomonidis

, Meloni

, Taylor

, Duffin

, Dobie

, Magalhaes

, Henderson

BEP

, Louwe

, D’Amico

, et al. Single-cell transcriptome analyses reveal novel targets modulating cardiac neovascularization by resident endothelial cells following myocardial infarction. Eur Heart J. 2019;40:2507–20. doi: 10.1093/eurheartj/ehz305

23.

Krüger

, Fuhrmann

, Jung

, Franke

. Influence of the coating with extracellular matrix and the number of cell passages on the endothelialization of a polystyrene surface. Clin Hemorheol Microcirc. 2015;60(1):153–61. doi: 10.3233/CH-151943

24.

Steel

, Cowan

, Payerne

, O’Connell

, Searcey

. Anti-inflammatory Effect of a Cell-Penetrating Peptide Targeting the Nrf2/Keap1 Interaction. ACS Med Chem Lett. 2012;3:407–10. doi: 10.1021/ml300041g

25.

Ojha

, Dhamoon

. Myocardial Infarction. In: StatPearls. Treasure Island (FL); 2023.

26.

Astapenko

, Hyspler

, Tich

, Tomasova

, Navratil

, Zrzavecky

, Byreddy

, Sedlacek

, Radochova

, Skulec

, Hahn

, Lehmann

, Malbrain

MLNG

, Cerny

. Protection of the endothelium and endothelial glycocalyx by hydrogen against ischaemia-reperfusion injury in a porcine model of cardiac arrest. Clin Hemorheol Microcirc. 2023 Sep 2. doi: 10.3233/CH-231768

27.

Zhao

, Yu

. Sirtuin 1 activated by SRT1460 protects against myocardial ischemia/reperfusion injury. Clin Hemorheol Microcirc. 2021;78(3):271–81.

28.

Neri

, Riezzo

, Pascale

, Pomara

, Turillazzi

. Ischemia/Reperfusion Injury following Acute Myocardial Infarction: A Critical Issue for Clinicians and Forensic Pathologists. Mediators Inflamm. 2017;2017:7018393. doi:10.1155/2017/7018393

29.

Heusch

. Myocardial ischaemia-reperfusion injury and cardioprotection in perspective. Nat Rev Cardiol. 2020;17:773–89. doi: 10.1038/s41569-020-0403-y

30.

Basalay

, Yellon

, Davidson

. Targeting myocardial ischaemic injury in the absence of reperfusion. Basic Res Cardiol. 2020;115:63. doi: 10.1007/s00395-020-00825-9

31.

Ding

, Zhu

, Wang

, Li

, Ma

, Gao

. SIRT1 is a regulator of autophagy: implications for the progression and treatment of myocardial ischemia-reperfusion. Pharmacol Res. 2023:106957. doi: 10.1016/j.phrs.2023.106957

32.

Ding

, Zhu

, Wang

, Li

, Ma

, Gao

. SIRT1 is a regulator of autophagy: implications for the progression and treatment of myocardial ischemia-reperfusion. Pharmacol Res. 2023:106957. doi: 10.1016/j.phrs.2023.106957

33.

Dixon

, Lemberg

, Lamprecht

, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death[J]. Cell. 2012;149(5):1060–72.

34.

Romanus

, Stengqvist

, Svensjö

, Whira

. : Microvascular changes due to repeated local pressure-induced ischemia: intravital microscopic study in hamster check pouch. Arch Phys Med Rehabil. 1983;64:553–5.

35.

Jung

, Franke

, Mrowietz

, Wolf

, Kiesewetter

. Capillary Occlusion and secondary angiogenesis in a patient with Raynaud's Phenomenon. J Vasc Res. 1982;29, 71–4.

36.

Herman

, Padala

, Ahmed

, Bashir

. Angiotensin Converting Enzyme Inhibitors (ACEI). In: StatPearls. Treasure Island (FL); 2023.

37.

Tejero

, Shiva

, Gladwin

. Sources of Vascular Nitric Oxide and Reactive Oxygen Species and Their Regulation. Physiol Rev. 2019;99:311–79. doi: 10.1152/physrev.00036.2017

38.

Torres Crigna

, Link

, Samec

, Giordano

, Kubatka

, Golubnitschaja

. Endothelin-1 axes in the framework of predictive, preventive and personalised (3P) medicine. EPMA J. 2021;12:265–305. doi: 10.1007/s13167-021-00248-z

39.

Zhou

, Zhu

, Cui

, Shi

, Yuan

, Shi

, Hu

. The Role of the VEGF Family in Coronary Heart Disease. Front Cardiovasc Med. 2021;8:738325. doi: 10.3389/fcvm.2021.738325

40.

Satta

, Mahmoud

, Wilkinson

, Yvonne Alexander

, White

. The Role of Nrf2 in Cardiovascular Function and Disease. Oxid Med Cell Longev. 2017;2017:9237263. doi: 10.1155/2017/9237263

41.

Roberts

, Rainbow

, Sharma

. Mitigation of Cardiovascular Disease and Toxicity through NRF2 Signalling. Int J Mol Sci. 2023;24. doi: 10.3390/ijms24076723

42.

Sun

, Li

, Ji

. Atorvastatin attenuates inflammation and oxidative stress induced by ischemia/reperfusion in rat heart via the Nrf2 transcription factor. Int J Clin Exp Med. 2015;8:14837–14845.

43.

Guo

, Zhang

, Hou

, Wei

, Liu

. Plasmalemma vesicle-associated protein: A crucial component of vascular homeostasis. Exp Ther Med. 2016;12:1639–44. doi: 10.3892/etm.2016.3557

44.

Manavski

, Lucas

, Glaser

, Dorsheimer

, Gunther

, Braun

, Rieger

, Zeiher

, Boon

, Dimmeler

. Clonal Expansion of Endothelial Cells Contributes to Ischemia-Induced Neovascularization. Circ Res. 2018;122:670–7. doi: 10.1161/CIRCRESAHA.117.312310