Multiple sclerosis (MS) is an autoimmune disease characterized by recurrent episodes of demyelination and loss of oligodendrocytes. The demyelination process is caused by various subsets of CD4 T cells with a Th1 and Th17 phenotype. The retinoid acid-related orphan receptor A (RORA) is expressed in Th17 cells and promote Th17 differentiation. In this study, we compared the expression level of RORA gene in the blood of 50 relapsing-remitting MS (RRMS) patients who were treated with IFN- and 50 healthy controls by TaqMan Quantitative Real-Time PCR.
We found that RORA expression was significantly down-regulated in MS patients compared with controls ( 0.006). However, there was no significant correlation between RORA gene expression and Kurtzke Expanded Disability Status Scale (EDSS). Our findings suggest a possible contribution of IFN- in the downregulation of RORA. In addition, RORA downregulation may be a potential indicator of positive response to interferon beta treatment of multiple sclerosis patients.
Multiple sclerosis (MS) is a chronic inflammatory condition of the central nervous system (CNS) [1] characterized by demyelination and loss of oligodendrocytes and axons which leads to physical and cognitive problems [2]. The etiology and clinical behavior of MS is unknown, but according tocurrent data, the pathological features of MS are caused by various subsets of CD4 T cells [3]. The CD4 T cells differentiate into three helper lineages, Th1, Th2 and Th17 cells. Th1 and Th17 cells have a central role in the initiation of autoimmune CNS inflammation [4, 5]. The IL-17 cytokine family includes six members: IL-17A, B, C, D, E (IL-25) and F. IL-17A are critical for Th17 differentiation [6]. IL-17A play key regulatory roles in the pathology of several autoimmune diseases [7].
Sequence of primers and probes
Gene name
Primer and probe sequence
Primer and probe length
Product length
HPRT1
F: AGCCTAAGATGAGAGTTC
18
88
R: CACAGAACTAGAACATTGATA
21
FAM-CATCTGGAGTCCTATTGACATCGC-TAMRA
24
RORA
F: GAATATATCTAAATCGCATCTGGAAACC
28
163
R: CTGTATAGCTTCTGTAATTTTGATGGC
27
FAM-TGCCACATCACCTCCCGCTGCTTG-TAMRA
20
The retinoid acid-related orphan receptor (ROR) subfamily of orphan nuclear receptors consists of ROR, -, and -. They are expressed in several tissues and involved in the maintenance of the circadian rhythm, cellular metabolism, lymph nodes development and immune response [8, 9]. RORA is induced by activation of the STAT3 pathway by IL-6 [10] and is expressed in Th17 cells and promotes Th17 differentiation [11]. So RORA deficiency in mouse T cells results in reduced IL-17 expression in vitro and in vivo [12]. ROR 1–4, are four isoforms that are transcribed from the RORA gene that located at 15q22.2 [13]. These isoforms are produced through alternative splicing [14]. The RORA protein structure consists of four functional groups: an N-terminal (A/B) domain, a conserved DNA-binding domain containing two zinc fingers, a hinge domain, and a C-terminal ligand-binding domain [15, 16]. The purpose of our study was to investigate the expression of RORA in the whole blood of relapsing-remitting multiple sclerosis (RR-MS) patients, the most common form of MS, compared to normal individuals. Moreover, we analyzed the correlation between expression of RORA and Kurtzke Expanded Disability Status Scale (EDSS) and disease duration in patients.
Materials and methods
Patients and controls
This was a population-based case–control study of 50 Relapsing-Remitting MS (RR-MS) patients (39 females and 11 males, mean age: 35.3 3.2, age of onset: 28.36 2.4, duration of disease: 7.2 3.1, EDSS: 2.98 3.1) and 50 age and gender matched healthy controls (37 females and 13 males, mean age: 34.8 2.1). All of the patients were in the remission phase and HLA-DRB1*15 negative [17]. In addition, all of patients were clinically responsive to interferon (IFN)- and took Cinnovex™ as treatment [18, 19]. MRI (Magnetic Resonance Imaging) was used to identify MS in patients based on McDonald criteria [20, 21]. This study was approved by the local Ethics Committee of Shahid Beheshti University of Medical Science. All patients gave their informed consent to be included in the study, and the blood samples were collected at Iran MS Society Clinic.
Demographic data of patients and healthy controls
Variables
MS patient
Control
Female/male [no. (%)]
39 (78%)/11 (22%)
37 (74%)/13 (26%)
Age (mean SD, Y)
36.2 2.9
35.3 2.1
Age range (Y)
17–55
22–60
Age of onset (mean SD, Y)
31.41 2.8
–
Relapsing-remitting course (no. %)
100 (100%)
–
Duration (mean SD, Y)
4.58 3.2
–
EDSS (mean SD)
3.07 2.7
–
RORA expression levels in RR-MS patients compared with control group, based on age and sex of the participants
RORA
Control no.
MS patient no.
Expression ratio
-value
95% highest density interval
Total
50
50
0.6284
0.006
[1.54, 0.406]
Male
13
11
0.8237
0.616
[2.21, 1.33]
Female
37
39
0.5761
0.003
[1.72, 0.504]
30
Male
0
2
–
–
–
Female
8
9
0.4343
0.006
[2.85, 0.224]
30–40
Male
2
3
0.4997
0.199
–
Female
7
15
1.5376
0.375
[1.63, 3.34]
40
Male
11
6
0.8432
0.729
[3.58, 2.92]
Female
22
15
0.4513
0.0001
[2.47, 0.476]
Spearman correlation between RORA relative quantitation and EDSS in patients.
Blood sampling
In this study 5cc sample of peripheral blood was obtained from all the participants in both groups. RNA extraction and cDNA synthesis were done immediately after blood sampling.
Quantitative real time PCR
The RNA was extracted from whole blood using GeneAll HybridR™ blood RNA extraction kit (cat No. 305-101). Then the cDNA was synthesized by using the Biosystems High-Capacity cDNA Reverse Transcription Kit (PN: 4375575). Allele ID 7 (Premier Biosoft, Palo Alto, USA) was used to design the specific probes and primers for the RORA and HPRT1. HPRT1 was used as the reference marker for quantitating the relative levels of RORA. The sequence of probes and primers are shown in Table 1. The Biosystems TaqMan, Universal PCR Master Mix (PN: 4304449) was applied to perform the Real-time quantitative PCR, using Corbett Rotor Gene 6000 machine (Corbett Life Science).
Statistical methods
To compare data obtained from case and control groups, independent samples t-tests were performed. The one-way ANOVA test was also used. In order to identify the correlation between variables, Pearson correlation coefficient was applied. 0.05 was considered as statistically significant. The analyses were done using SPSS 18 windows statistical package (Chicago, IL, USA).
Spearman correlation between RORA relative quantitation and disease duration in patients.
Spearman correlation between RORA relative quantitation and age at onset in patients.
Results
Participants
Clinical characteristics, disease duration and the EDSS of MS patients are described in Table 2. Our samples were classified in three different groups based on their ages ( 30, 30–40, 40). Separate computations were carried out for the total numbers in both groups. TaqMan Real-Time-PCR was used to compare the expression level of RORA genes between the RR-MS patients and normal individuals.
Expression levels of the RORA gene
We compared the expression level of RORA between RR-MS patients and healthy subjects in age- and sex- based subgroups. Our results are demonstrated in Table 3. Statistical analysis revealed a significant down-regulation in the expression of RORA gene in MS patients versus healthy controls (Expression ratio 0.62, P value 0.006).
Correlation between RORA gene expression levels and disease duration, EDSS and age at onset
Pearson correlation was performed to examine possible correlation between the expression of RORA gene and disease duration as well as EDSS. No significant correlation was found between RORA expression and EDSS (Fig. 1), duration of the disease (Fig. 2) or age at onset (Fig. 3).
Discussion
Studies both in MS patients and in the experimental autoimmune encephalomyelitis (EAE, the animal model for multiple sclerosis) supportedthat Th17 cells have an important role in the pathogenesis of MS [22, 23, 24]. Results of EAE studies suggest that targeting the Th17 response may have a beneficial effect in MS patients [25]. In the present study, we investigated the expression levels of RORA gene in 50 RRMS patients who were treated with IFN- in comparison with 50 healthy controls. Our results demonstrated that the RORA expression level was significantly down-regulated in MS patient versus controls. In downstream of STAT3, ROR and ROR synergically mediate Th17 differentiation and IL-17A production [12, 26]. IL-17A have protective roles in host defense and inflammatory diseases [27, 28]. In addition, IL-17 family cytokines are involved in many autoimmune diseases including rheumatoid arthritis (RA), inflammatory bowel disease and MS [29, 30]. CAstro et al. conducted different approaches to determine signature genes for RORA and they have reported that IL-17A was the most important gene amongst all signature genes [11]. Moreover the results of the Yang study showed that ROR deficiency significantly reduced IL-17 expression in vitro and in vivo and attenuated pathologic effects of Th17 in EAE model [12]. So, RORA is one of the main molecules in the pathogenesis of MS. The presence of RORA in peripheral blood may reflect pathological events in the CNS. Our findings showed that the expression of RORA in MS patients was significantly lower than that in the healthy control group. The varying results between the mentioned studies and our results illustrate the complexity of the factors involved in MS.
All of the patients in this study were in the remission phase and clinically responsive to IFN- and took Cinnovex™ as treatment. IFN- is widely used over the past 15 years as first-line treatment for RRMS, however its immunomodulatory mechanisms are incompletely understood. Several studies have shown that IFN- mostly oppose the pathological processes in MS. For instance, IFN- increases anti-inflammatory cytokines such as interleukin (IL)-10 [31], induces production of proinflammatory cytokines [32], reduces leukocyte migration across the blood brain barrier [33], reduces the activity of T cell matrix metalloproteinases [34], may assist in CNS repair and recovery [35, 36], increases the number of CD56 bright natural killer cells [37] and influences known immunomodulatory and apoptosis-promoting genes [38]. In vivo studies have demonstrated that IFN- inhibits IL-17A, IL-17F secretion in patients with RRMS in comparison with the control subjects [39]. In addition, several studies indicate that RORA enhances IL-17A production [26] and promotes Th17 differentiation [11]. Therefore, RORA reduced expression in the patient group maybe resulted from IFN- and this indirectly attenuates Th17 differentiation and could affect the clinical course of disease in RRMS patients. Our finding raises a new hypothesis that RORA downregulation might be a predictor of response to IFN-. However, this study was the first work to report the lower expression of RORA in MS disease so its clinical value needs confirmation. Further validation in larger samples including RRMS patients who are not treated with INF- is still needed to examine the results of the current study and to better understand the effect of IFN- on RORA gene expression in MS.
Conclusion
Our data indicates that RORA was down-regulated in RRMS who were responsive to IFN-. There was no correlation between RORA and EDSS. Our data possibly reflect a new mechanism associated with response to IFN- treatment.
Footnotes
Acknowledgments
This study has been supported by a grant (Grant Number: 12819) from Shahid Beheshti University of Medical Sciences and has been conducted as the MSc thesis of the first author.
Conflict of interest
None.
References
1.
PassosG.R.D.SatoD.K.BeckerJ. and FujiharaK., Th17 cells pathways in multiple sclerosis and neuromyelitis optica spectrum disorders: Pathophysiological and therapeutic implications, Mediators of Inflammation2016 (2016).
2.
NagelkerkenL., Role of Th1 and Th2 cells in autoimmune demyelinating disease, Brazilian Journal of Medical and Biological Research31 (1998), 55–60.
3.
GiovannoniG. and EbersG., Multiple sclerosis: The environment and causation, Current Opinion in Neurology20 (2007), 261–268.
4.
BiY.LiuG. and YangR., Th17 cell induction and immune regulatory effects, Journal of Cellular Physiology211 (2007), 273–278.
5.
ChenZ. and O’SheaJ.J., Th17 cells: A new fate for differentiating helper T cells, Immunologic Research41 (2008), 87–102.
6.
YiH.GuoC.YuX.ZuoD. and WangX.-Y., Mouse CD11b+ Gr-1+ myeloid cells can promote Th17 cell differentiation and experimental autoimmune encephalomyelitis, The Journal of Immunology189 (2012), 4295–4304.
7.
JinW. and DongC., IL-17 cytokines in immunity and inflammation, EmerginG Microbes & Infections2 (2013), e60.
8.
ZhangY.LuoX.-Y.WuD.-H. and XuY., ROR nuclear receptors: Structures, related diseases, and drug discovery, Acta Pharmacologica Sinica36 (2015), 71–87.
9.
JettenA.M. and JooJ.H., Retinoid-related orphan receptors (RORs): Roles in cellular differentiation and development, Advances in Developmental Biology16 (2006), 313–355.
10.
ChangS.H. et al., Interleukin-17C promotes Th17 cell responses and autoimmune disease via interleukin-17 receptor E, Immunity35 (2011), 611–621.
11.
CastroG. et al., RORγt and RORα signature genes in human Th17 cells, PloS One12 (2017), e0181868.
12.
YangX.O. et al., T helper 17 lineage differentiation is programmed by orphan nuclear receptors RORα and RORγ, Immunity28 (2008), 29–39.
13.
EftekharianM.M. et al., RAR-related orphan receptor A (RORA): A new susceptibility gene for multiple sclerosis, Journal of the Neurological Sciences369 (2016), 259–262.
14.
GiguereV. et al., Isoform-specific amino-terminal domains dictate DNA-binding properties of ROR alpha, a novel family of orphan hormone nuclear receptors, Genes & Development8 (1994), 538–553.
15.
JettenA.M., Retinoid-related orphan receptors (RORs): Critical roles in development, immunity, circadian rhythm, and cellular metabolism, Nuclear Receptor Signaling7 (2009).
16.
AschrafiA.MeindlN.FirlaB.BrandesR.P. and SteinhilberD., Intracellular localization of RORα is isoform and cell line-dependent, Biochimica et Biophysica Acta (BBA)-Molecular Cell Research1763 (2006), 805–814.
17.
MazdehM. et al., HLA genes as modifiers of response to IFN-β-1a therapy in relapsing-remitting multiple sclerosis, Pharmacogenomics17 (2016), 489–498.
18.
TaheriM. et al., Determination of cytokine levels in multiple sclerosis patients and their relevance with patients’ response to Cinnovex, Cytokine96 (2017), 138–143.
19.
SayadA.Ghafouri-FardS.OmraniM.D.NorooziR. and TaheriM., Myxovirus resistance protein A (MxA) polymorphism is associated with IFNbeta response in Iranian multiple sclerosis patients, Neurological Sciences: Official Journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology38 (2017), 1093–1099.
20.
PolmanC.H. et al., Diagnostic criteria for multiple sclerosis: 2005 revisions to the “McDonald Criteria”, Annals of Neurology58 (2005), 840–846.
21.
McDonaldW.I. et al., Recommended diagnostic criteria for multiple sclerosis: Guidelines from the International Panel on the diagnosis of multiple sclerosis, Annals of Neurology50 (2001), 121–127.
22.
LangrishC.L. et al., IL-23 drives a pathogenic T cell population that induces autoimmune inflammation, Journal of Experimental Medicine201 (2005), 233–240.
23.
KomiyamaY. et al., IL-17 plays an important role in the development of experimental autoimmune encephalomyelitis, The Journal of Immunology177 (2006), 566–573.
24.
Brucklacher-WaldertV.StuernerK.KolsterM.WolthausenJ. and TolosaE., Phenotypical and functional characterization of T helper 17 cells in multiple sclerosis, Brain132 (2009), 3329–3341.
25.
MartinA.J. and MillerS.D., in: IL-17, IL-22 and Their Producing Cells: Role in Inflammation and Autoimmunity, Springer, 2013, 243–257.
26.
WangX.MaC.WuJ. and ZhuJ., Roles of T helper 17 cells and interleukin-17 in neuroautoimmune diseases with emphasis on multiple sclerosis and Guillain-Barré syndrome as well as their animal models, Journal of Neuroscience Research91 (2013), 871–881.
27.
ChoJ.S. et al., IL-17 is essential for host defense against cutaneous Staphylococcus aureus infection in mice, The Journal of Clinical Investigation120 (2010), 1762.
28.
HamadaS. et al., IL-17A produced by γδ T cells plays a critical role in innate immunity against Listeria monocytogenes infection in the liver, The Journal of Immunology181 (2008), 3456–3463.
29.
ParkH. et al., A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17, Nature Immunology6 (2005), 1133–1141.
30.
McGeachyM.J. and CuaD.J., Th17 cell differentiation: The long and winding road, Immunity28 (2008), 445–453.
31.
KozovskaM. et al., Interferon beta induces T-helper 2 immune deviation in MS, Neurology53 (1999), 1692–1692.
32.
ChenM. et al., Regulatory effects of IFN-β on production of osteopontin and IL-17 by CD4+ T Cells in MS, European Journal of Immunology39 (2009), 2525–2536.
33.
LeppertD.WaubantE.BürkM.R.OksenbergJ.R. and HauserS.L., Interferon beta-1b inhibits gelatinase secretion and in vitro migration of human T cells: A possible mechanism for treatment efficacy in multiple sclerosis, Annals of Neurology40 (1996), 846–852.
34.
StüveO. et al., Interferon β-1b decreases the migration of T lymphocytes in vitro: Effects on matrix metalloproteinase-9, Annals of Neurology40 (1996), 853–863.
35.
JinS. et al., Interferon-β is neuroprotective against the toxicity induced by activated microglia, Brain Research1179 (2007), 140–146.
36.
BiernackiK. et al., Interferon beta promotes nerve growth factor secretion early in the course of multiple sclerosis, Archives of Neurology62 (2005), 563–568.
37.
VandenbarkA.A. et al., Interferon-beta-1a treatment increases CD56 bright natural killer cells and CD4+ CD25+ Foxp3 expression in subjects with multiple sclerosis, Journal of Neuroimmunology215 (2009), 125–128.
38.
KauffmanM. et al., Whole genome analysis of the action of interferon-beta, Int J Clin Pharmacol Ther47 (2009), 328–357.
39.
TaoY. et al., The role of endogenous IFN-β in the regulation of Th17 responses in patients with relapsing-remitting multiple sclerosis, The Journal of Immunology192 (2014), 5610–5617.