Altered methylation and expression patterns of genes regulating placental nitric oxide pathway in patients with severe preeclampsia

Abstract

Pre-eclampsia is a common pregnancy disorder syndrome whose molecular mechanism is not clear. Nitric oxide (NO) is a key regulator of placentation. Reduction of NO has previously been associated with endothelial dysfunction in pre-eclamptic women. Therefore, we measured expression and methylation of some placental genes that were involved in NO pathway like named ARG II, PRMT1 and DDAH2 in pre-eclampsia and normal pregnancies in order to determine whether impairment of expression of these genes in the pre-eclamptic placenta could contribute to development of disease. ARG II, PRMT1 expressions as well as DDAH2 expression and methylation, in placentas collected from 59 patients with preeclampsia and 40 normotensive pregnancies were measured using real-time PCR and methylation specific PCR, respectively. The relationship among ARG II, PRMT1 and DDAH2 expressions was analyzed statistically. ARG II expression was increased, PRMT1 expression was not significantly changed. DDAH2 expression was decreased and qualitative methylation patterns were 32/59 and 21/40 in placentas from patients with pre-eclampsia compared with control group, respectively. The alterations in ARG II and DDAH2 expressions in pre-eclampsia patients maybe correlated with decreased eNOS expression. These findings indicate that ARG II and DDAH2 may be involved in pre-eclampsia pathogenesis and could be potential therapeutic targets for this disease.

Keywords

Preeclampsia ARG II PRMT1 DDAH2

1. Introduction

According to the World Health Organization (WHO) definition, pre-eclampsia (PE) is a pregnancy disorder syndrome which occurs after 20 weeks’ gestation and is characterized by high blood pressure (greater than or equal to 140/90) and often proteinuria (greater than or equal to 300 mg in a 24-hour urine specimen). In severe form there may be impaired liver function, a low blood platelet count, swelling, shortness of breath due to fluid in the lungs, kidney dysfunction or visual disturbances. PE is known to be a major cause of maternal deaths in developing countries (12–15%) and is also responsible for many short- and long-term complications in mothers, perinatal deaths and intrauterine growth restriction. Based on the severity of disease, early diagnosis or treatment is one of the ambitions of obstetricians and gynecologists [1, 2]. The pathology of PE is still open to debate; however, several genetic and environmental factors have been found to be associated with the etiology of this pregnancy-related syndrome. Ward et al. reported that the risk of incidence of PE is 20–40% in daughters of affected mothers, 11–13% in women with affected sisters and 22–47% in twins [3]. From this perspective, the role of genetic factors in PE, especially in genes which are related to endothelial disorders, coagulation system, oxidative stress, angiogenesis and the development of placenta is well-established in different investigations [3, 4]. Since the only way to treat the disease is the termination of pregnancy, placenta has the eminent role and function in the incidence of PE. A mounting body of evidence indicates that ischemia and placental hypoxia due to the dysfunction of thropoblasts cells for invasion and remodeling of maternal spiral vessels are the first steps in the pathogenesis of PE. Proper Nitric Oxide (NO) production is essential for placentation. Endothelial nitric oxide synthase (eNOS) is a key enzyme in the maintenance of vascular homeostasis and placentation [5, 6]. It has been demonstrated that there is a tight correlation between eNOS gene expression and vascular disorders, such as cardiovascular diseases and PE. In endothelial cells of placenta, eNOS3 converts L-Arginine to NO. Any alteration in gene expression or reduction in arginine substrate may result in decreased NO generation, which in turn leads to PE [7, 8]. Up-regulation in the expression level of arginase II, an enzyme competes with nitric oxide synthase (NOS) to hydrolyze arginine to ornithine and urea, has been shown to contribute to PE. Although the underlying mechanism associated with up-regulation of arginase is not clear, it is hypothesized that probably elevation in steroid hormones, such as testosterone could be responsible for up-regulation of this enzyme in PE [6, 7, 8, 9]. Another mechanism which is involved in pathogenesis of PE is raised production of Asymmetric dimethylargininase (ADMA). ADMA, which is synthesized by an enzyme called protein arginine methyltransferase 1 (PRMT-1), is an endogenous inhibitor of NOS that competes with L-arginine for binding to this enzyme. Upon post translational alteration, PRMT-1, methylates arginine residues in proteins. Simultaneous with protein hydrolysis, methyl ariginins like ADMA release in cytosol and acts as an inhibitors of NOS. Although some parts of methyl arginines is excreted by the kidney, a major amount of ADMA is metabolized to cytroline and di-methyle amin via dimethylargininase dimethylaminohydrolase 2 (DDAH-2) in endothelial cells [10, 11]. Decreased in the enzymatic activity of DDAH2 could be mediated through gene down-regulation and promoter hyper-methylation. Since the promoter of DDAH2 gene is GC rich, it seems that neo-hyper-methylation in this region could be a mechanism for down-regulation of expression level of this gene [12]. It is believed that in the presence of ADMA, the enzymatic activity of arginase II will increase, which in turn leads to the relative reduction in intracellular level of arginine [13]. It has been indicated that plasma concentration of ADMA not only has a critical role in the pathophysiology of PE; but also is valuable for both prevention and clinical evaluation of this disease. Based on the essential role of NO production pathway in pathogenesis of PE, and also the application of NO donors, NO blockers and arginine substrate in the therapeutic prospective for this disease [14], we aimed to identify expression levels of ARG II, PRMT1 and DDAH2 in pre-eclampsia compared with normal pregnancies.

2. Materials and methods

The study protocol was approved by the Research Ethics Committees of Shahid Beheshti University of Medical Sciences and written informed consent was obtained from all participants prior to inclusion in the study.

Table 1
Sequences of used primers

Gen name	Sequance		Length/bp	Annealing temperature
ARG II	F	GGTCCCGCTGCCATAAGAG	137	61 ${}^{\circ}$ C
	R	CGTGGATTCACTATCAGGTTGTTG
PRMT1	F	GGGCTACTGCCTCTACGAGTC	139	65 ${}^{\circ}$ C
	R	GTCTTTGTACTGCCGGTCCTCGATG
DDAH2	F	CTGCTAGAACTGCCACCTGA	134	61 ${}^{\circ}$ C
	R	CGGACTCCATCGACCTCTG
GAPDH	F	AGGGCTGCTTTTAACTCTGGT	206	64 ${}^{\circ}$ C
	R	CCCCACTTGATTTTGGAGGGA

2.1 Participants

The present study was performed using placenta tissues collected from 40 normal pregnant females and 59 severe PE patients at the end of the third trimester of pregnancy. Samples were collected from pregnant women who referred to the Department of Obstetrics and Gynaecology, at Mahdiyeh hospital, affiliated to Shahid Beheshti University of Medical Sciences, Tehran, Iran for clinical monitoring or delivery during March 2014 and July 2015. All pregnancies were singleton pregnancies. Normal pregnancy was defined as a currently normotensive female during pregnancy who delivered a healthy neonate at term. Severe PE was defined as a female patient without a history of hypertension presenting with systolic blood pressure $\geqslant$ 160 mmHg or diastolic blood pressure $\geqslant$ 110 mmHg on at least two occasions, combined with significant proteinuria following 20 weeks of gestation. The pregnant females who had infections, renal disease, cardiovascular disease, transient hypertension in pregnancy, gestational diabetes mellitus, a positive family history for pre-eclampsia, any evidence of spontaneous abortion, intrauterine fetal death, fetal chromosomal disorder or other pregnancy complications were excluded from the present study.

2.2 Tissue collection and processing

Fresh full-thickness blocks of 3–5 cm tissue were obtained from the middle region of the placenta, after delivery. The maternal deciduas and amnionic membranes were removed. Fetal membranes were trimmed off, and small pieces were randomly cut out from the feto placental part. The tissue pieces were rinsed in phosphate-buffered saline to wash off maternal and fetal blood and stored at $-$ 80 ${}^{\circ}$ C until assayed.

2.3 Extraction of total RNA and DNA, complementary DNA synthesis, and real-time quantitative polymerase chain and methylation analysis

2.3.1 RNA extraction

Total RNA was extracted from the placenta tissues with an RNeasy mini-kit (Qiagen N.V., Venlo, The Netherlands) in accordance with the manufacturer’s instructions. The quality of the RNA samples was determined by electrophoresis through agarose gel (2%). The RNA was quantified and evaluated for purity by Nanodrop (2000, Thermo Scientific, USA). To further assess the quality of the RNA, all samples were subjected to expression analysis of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), using conventional reverse transcriptase (RT) PCR.

2.3.2 cDNA synthesis and quantitative real-time reverse transcription (RT) PCR for expression analysis

Following total RNA extraction, RNA was analyzed by converting 5 $\mu$ l of RNA per sample to cDNA using an RNA reverse transcription kit with random hexamer and oligo dT primers (Thermo Scientific kit, K1622, USA), according to the manufacturer’s instructions. Briefly, reagents were prepared to give a final concentration of 1 $\mu$ l random hexamerprimer, 1 $\mu$ l oligo dT primer, 5 $\mu$ l template RNA, 5 $\mu$ l nuclease free water, 1 $\mu$ l RiboLock RNase Inhibitor (20 U/ML), 2 $\mu$ l dNTP (10 mM) and 1 $\mu$ l RevertAid M-MuLV RT (200 U/ML) in a final volume of 20 $\mu$ l. The RT reaction was performed by incubating the samples for 5 min at 25 ${}^{\circ}$ C, 1 h at 42 ${}^{\circ}$ C and 5 min at 70 ${}^{\circ}$ C. Real-time quantitative PCR was performed using Corbet Real-Time PCR System and SYBR_ qPCR Mix (Takara, Japan). After the gradient PCR and finding the appropriate temperature, for each primer standard curve was plotted till final analysis was done according to a Livak’s formula (2 ${}^{\wedge-\Delta ct})$ . Each 15-ml reaction volume contained 7.5 $\mu$ l of master mix (RR820B, Takara), 5 $\mu$ l nuclease free water, 1 $\mu$ l of primer forward plus reverse (Table 1) and 1.5 $\mu$ l of cDNA. The real-time program for all genes were three step and initiated at 95 ${}^{\circ}$ C for 2 min, followed by 40 cycles of 95 ${}^{\circ}$ C for 20 s, specific annealing temperatures (Table 1) for 15 s and 72 ${}^{\circ}$ C for 20 s.

Table 2
Sequences of methylated and unmethylated primers for DDAH2 promoter methylation

Primer	Sequence	Length/bp	Annealing temperature
MetF	5’-TAGGGAATTTTGGAGTATTTGTTTC-3’	355	61 ${}^{\circ}$ C
MetR	5’-AAATCTAACCGACCCTAACGAC-3’
Unmet F	5’-TAGGGAATTTTGGAGTATTTGTTTT-3’	357	61 ${}^{\circ}$ C
Unmet R	5’-CCAAATCTAACCAACCCTAACAA-3’

Table 3

Distribution of the selected variables between the severe PE cases and control subjects

	Preeclampsia ( $n=$ 59)	Control ( $n=$ 40)	$p$ -value
Age (years)	27.42 $\pm$ 6.7	23.78 $\pm$ 4.15	0.15
BMI at delivery (kg/m ${}^{2}$ )	25.90 $\pm$ 3.96	23.33 $\pm$ 2.53	$<$ 0.001
SBP (mmHg)	150.33 $\pm$ 17.66	108.75 $\pm$ 7.23	$<$ 0.001
DBP (mmHg)	94.85 $\pm$ 10.13	71.63 $\pm$ 5.11	$<$ 0.001
Urinary protein (g/24 h)	1.55 $\pm$ 0.77	Absent	$-$
Gestational age at delivery (weeks)	37.13 $\pm$ 2.95	38.75 $\pm$ 1.10	$<$ 0.001
Kind of delivery:
Normal	30%	87.5%
Cesarian	70%	12.5%

Data are presented as means $\pm$ SD. $p<$ 0.05. Abbreviations: BMI $=$ Body Mass Index; SBP $=$ systolic blood pressure; DBP $=$ diastolic blood pressure.

2.4 DNA extraction and Sodium bisulfite modification of extracted DNA

Placenta tissues were stored at $-$ 80 ${}^{\circ}$ C until DNA extraction. DNA was extracted using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol.

The extracted DNA was modified according to the EpiTect Bisulfite Kit (Qiagen, Hilden, Germany). Bisulfite treatment was used to ascertain the methylation status of individual cytosines in DNA. Ideally, bisulfite treatment deaminates unmethylated cytosines to uracils, and leaves 5-methylcytosines unchanged. This allows their differentiation by methylation specific polymerase chain reaction (MSP).

2.5 Methylation-specific PCR (MSP)

The bisulfite modified DNA was used as a template for MSP using primers specific for either the methylated or the modified unmethylated sequences. The sequences of PCR primers (two sets of primers) used to distinguish methylated and unmethylated DDAH2 gene, annealing temperatures, and the expected sizes of PCR products were described at Table 2. Specific primer sequences were extracted from Jia et al., 2012. They found that two CpG islands were located in the promoter of DDAH2 gene from $-$ 1000 bp to $+$ 500 bp of the transcription start site (TSS). PCR was carried out according to the EpiTect PCR Control DNA Set (Qiagen, Hilden, Germany). PCR reactions were carried out in a total volume of 25 $\mu$ l that contained 12 $\mu$ l of Taq PCR Master Mix (Qiagen, Hilden, Germany), 0.5 $\mu$ l of the forward primer (0.1–0.5 $\mu$ M), 0.5 $\mu$ l of the reverse primer (0.1–0.5 $\mu$ M), 10 $\mu$ l distilled water and 2 $\mu$ l of modified DNA template ( $<$ 1 $\mu$ g/reaction). PCR conditions were as follows: 95 ${}^{\circ}$ C for 10 min, 36 cycles of denaturation at 96 ${}^{\circ}$ C for 30 s, annealing at 61 ${}^{\circ}$ C for 20 s, extension at 72 ${}^{\circ}$ C for 20 s, and a final extension step at 72 ${}^{\circ}$ C for 10 min. For each PCR reaction, in order to check the specificity of the primers and for monitoring the bisulfite conversion efficiency, a methylated positive control DNA (bisulfite converted) was used (EpiTect PCR Control DNA, Qiagen, Germany). The amplified products were run on 2% agarose gel with a 100 bp DNA ladder.

2.6 Statistical analysis

The threshold cycle (CT) was defined as the fractional cycle number at which fluorescence passed the fixed threshold. Each sample was measured in duplicate, and the relative amount of target mRNA to mRNA reference (GAPDH) was calculated using the equation 2 ${}^{-\Delta CT}$ , where $\Delta\textit{CT}=$ ( $\textit{CT}^{\textit{target}}$ –CT ${}^{\textit{reference}})$ . Statistical analyses were performed using SPSS 21.0 for Windows (SPSS Inc., Chicago, USA) and Graph Pad Prism 5.0 (Graph Pad Software Inc., La Jolla, USA). Data are expressed as mean $\pm$ SD or as mean $\pm$ SEM where appropriate. Comparisons of the groups were examined by Mann-Whitney U test for nonparametric data. Qualitative data were described using numbers and percentages. A $p$ -value of $<$ 0.05 was considered statistically significant for all analyses.

3. Results

3.1 Patients

Table 3 displays the clinical characteristics of the participants. In this survey, no significant differences were identified between the normal pregnant and preeclampsia patients with respect to maternal age.

3.2 Placental expression of ARG II, PRMT1 and DDAH2

Increases in the expression of ARG II in placental tissue from patients with pre-eclampsia (mean $\pm$ SEM, 9.08 $\pm$ 0.24) was 2.4 fold and found to be significantly higher than in the normotensive control group (mean $\pm$ SEM, 9.80 $\pm$ 0.21; $P=$ 0.02; Fig. 1A).

Figure 1.

Schematic representation of the fold change in mRNA expression of mentioned genes between the preeclampsia and the control groups. (A): FC of ARG II, by examining 2 ${}^{-\Delta ct}$ for each patient separately, it was found that, in 67.8% of patients, the expression of ARG II was more than one, ${}^{*}P\leqslant$ 0.02. (B): FC of PRMT1, by examining 2 ${}^{-\Delta ct}$ for each patient separately, it was found that, in 57.6% of patients, the expression of PRMT1 was more than one. (C): FC of DDAH2 , by examining 2 ${}^{-\Delta ct}$ for each patient separately, it was found that, in 57.6% of patients, the expression of DDAH2 was less than one, ${}^{*}P\leqslant$ 0.04.

The expression of PRMT1 in placental tissue from patients with pre-eclampsia (mean $\pm$ SEM, 1.42 $\pm$ 0.16) was 1.3 fold which was not significantly different from normotensive control group (mean $\pm$ SEM, 1.83 $\pm$ 0.33; $P=$ 0.72; Fig. 1B).

In addition, expression of DDAH2 in placental tissue from patients with pre-eclampsia (mean $\pm$ SEM, 5.49 $\pm$ 0.33) was significantly lower compared with the normotensive control group (mean $\pm$ SEM, 4.52 $\pm$ 0.16; Fold change $=$ 0.84, $P=$ 0.04; Fig. 1C).

3.3 Frequency of hypermethylated DDAH2 gene in preeclampsia patients and normal healthy controls

According to the present research, we observed promoter hypermethylation of gene in both groups. Thirty-two out of 59 PE patients, (54.23%) as well as 21 out of 40 healthy subjects, (52.5%) displayed promoter hypermethylation in the DDAH2 gene (Table 4, Fig. 2).

Table 4
Association of methylation status of the DDAH2 gene in PE patients

	Methylated		Unmethylated		Total
	No.	%	No.	%	No.	%
Case	32	54.23	27	45.76	59	100
Control	21	52.50	19	47.50	40	100

Figure 2.

Electrophoresis of methylation-specific (MS)-PCR products for the methylated (M) and unmethylated (U) DDAH2 gene at 355 and 357 bp, respectively. Lane 1 is the molecular weight marker (100 bp DNA ladder), lane 2 is the methylated positive control (MPC), and lanes 3–8 show bands of unmethylated patient (U-P) , methylated patient (M-P) and lanes 9–12 show bands of unmethylated control (U-C) , methylated control (M-C) respectively.

4. Discussion

The absence of NO during pregnancy has a tight correlation with high blood pressure and the incidence of pre-eclampsia (PE). It is believed that NO donors and NO blockers may bring remarkable advantages for therapeutic approaches for regulation of different functions of female reproductive periods [15, 16, 17]. It is hypothesized that aberrant expression of genes associated with NO production and metabolism or even an inappropriate methylation pattern in endothelial and placental tissues could be considered as important characteristics of the disease.

As the prominent result of this study, we found that in patients’ group the expression level of ARG II was up-regulated. Moreover, DDAH2 gene expression level was down-regulated and the methylation pattern in the promoter of DDAH2 gene was changed in patients. According to the low sample size for methylation analysis, our primary analysis demonstrated that the expression level of PRMT1 is elevated in patients as compared with the control group; however, this result was not statistically significant when we examined the p-value.

In 2010, Sankaralingam et al. reported that the level of arginase, superoxide and proxy nitrate are higher in the pre-eclampsic women in comparison with normal counterparts [9]. In agreement with this result, Támas et al. also indicated that the plasma concentration levels of ADMA and L-ornitine are elevated in 53 pre-eclampsic women as compared with 15 normal pregnant women. Based on their observation, the L-Argenine-NO pathway is deregulated in PE, which in turn leads to up-regulation in arginase and vascular damage [13]. In addition, evaluating the chorionic villus collection from 11 pre-eclampsic and 13 healthy pregnant women, Noris et al. reported that the L-arginine level in patient samples was lower than the control group. Moreover, they found that both mRNA and protein expression level of arginase II was 4-time higher in the patients’ group. Taken all together, Noris et al. suggested that elevated ARG II expression level in the placenta may reduce the L-arginine level in trophoblast cells and endothelial villus, which subsequently leads to reactive oxygen species (ROS)-induced rapid NO destruction and ultimately impaired perfusion in placenta [18]. Furthermore, Prieto et al. indicated that under hypoxic condition, both ARG II expression level and enzymatic activity are increased in HUVEC. Although the different function of arginase is well-established, the pivotal effect of this enzyme on the regulation of vascular reactivity in placenta is still open to debate [19].

In 2006, Siroen et al., reported that the DDAH activity and ADMA plasma concentration level were not significantly different between 16 pre-eclampsic and 15 healthy women [20]. In agreement with their results, Kim et al. [21] and Maas [22] also demonstrated that there was not a remarkable difference between DDAH activity and ADMA plasma concentration in patients and healthy women. In 2011, measuring the ADMA concentration in umbilical cord blood collected from 21 pre-eclampsic and 28 normal pregnant women, Alacam et al. showed that there is a significant relationship between elevated ADMA level and the incidence of pre-eclampsia. This finding was in corroboration with the results obtained from another study conducted by Madea et al. in 2003. The discrepancy between the results obtained from research groups is due to the differences in the severity of pre-eclampsia and type of sample. In fact, those patients with severe pre-eclampsia or those who has the early onset of the disease may have the higher ADMA level than patients with late onset [20, 21, 22, 23]. Confirmatory to our results, Anderssohn et al. indicated for the first time that the mRNA expression level of both DDAH isoforms, especially DDAH2, as the major isoform in placenta tissue, were lower in pre-eclampic patients as compared to the control group. On the other hand, the expression level of PRMT1, an enzyme responsible for asymmetric L-argenine methylation in proteins, was the same between two groups. Overall, the resultant performance of DDAH2 and PRMT1 gene expressions was an increased production of ADMA and reduced its metabolism. They suggested that different pathomechanisms, such as down-regulation and impaired enzymatic activity of DDAH, increased ADMA level, reduction in L-Argenine level and down-regulation in eNOS expression could lead to perturbation of nitric oxide in the placenta, which later provide a situation for induction of pre-eclampsia [24].

Epigenetic alteration, such as metylation in the promotor region is one of the main mechanism through which the expression of DDAH2 may be suppressed. In 2006, Tomikawa et al. evaluated the epigenetic alteration in the upstream region of the murine DDAH2 gene. Based on their report, the expression of this gene is inhibited in a population of trophoblast-derived stem cells through methylation in regulatory regions. In undifferentiated stem cells, this DNA region is hyper-methylated. It has been reported that inhibiting either DNA methylation using 5-aza-dC or histone deacetylation using trichostatin results in up-regulation in expression level of DDAH-2 in undifferentiated cells. This finding led to the identification of DNA methylation and histone deacethylation in the promoter region of DDAH-2 and introduced these epigenetic alterations as a regulatory mechanism for gene expression in mice [25]. According to the study conducted by Jones et al. analysis of the 6 Kb area surrounding the transcription initiation site 3 (TIS3) of DDAH-2 revealed a GC rich (CpG island) in a distance of about 2 Kb from transcription start sites [26]. Moreover, Niu et al., indicated that methylation in the promoter region of DDAH2 could be considered as a contributing factor for the lack of proper function of circulating endothelial progenitor cells in coronary artery disease. They suggested that modulation in the promoter methylation could be a potent therapeutic strategy for dysfunction of endothelial cells [12].

5. Conclusion

Based on our findings, it is reasonable to suggest that the alteration in the epigenetic or expression level of genes related to NO production pathway could have a clinical benefit for pre-eclampsic patients. However, further comprehensive studies, especially with more samples are warranted to evaluate the importance of this pathway in the pathogenesis of PE. These studies may lead to reduce the disease complications and maternal and fetus mortality. Since this study was performed on nulliparous women, the results obtained from our investigation could not be applied to all pregnant women.

Footnotes

Acknowledgments

This study was supported financially and technically by Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Conflict of interest

The authors have no conflicts of interest.

References

World Health Organization, WHO recommendations for prevention and treatment of pre-eclampsia and eclampsia, 2011.

Grill

et al., Potential markers of preeclampsia – a review, Reproductive Biology and Endocrinology 7(70) (2009).

Dalmaz

Santos

Botton

Tedoldi

and Roisenberg

, Relationship between polymorphisms in thrombophilic genes and preeclampsia in a Brazilian population, Blood Cells, Molecules, and Diseases 37 (2006), 107–110.

Hill

L.D.

et al., Epistasis between COMT and MTHFR in maternal-fetal dyads increases risk for preeclampsia, PloS One 6 (2011), e16681.

Hladunewich

Karumanchi

S.A.

and Lafayette

, Pathophysiology of the clinical manifestations of preeclampsia, Clinical Journal of the American Society of Nephrology 2 (2007), 543–549.

Noris

Perico

and Remuzzi

, Mechanisms of disease: pre-eclampsia, Nature Reviews Nephrology 1 (2005), 98.

Johal

Lees

C.C.

Everett

T.R.

and Wilkinson

I.B.

, The nitric oxide pathway and possible therapeutic options in pre-eclampsia, British Journal of Clinical Pharmacology 78 (2014), 244–257.

Buhimschi

I.A.

Saade

G.R.

Chwalisz

and Garfield

R.E.

, The nitric oxide pathway in pre-eclampsia: pathophysiological implications, Human Reproduction Update 4 (1998), 25–42.

Sankaralingam

and Davidge

S.T.

, Arginase contributes to endothelial cell oxidative stress in response to plasma from women with preeclampsia, Cardiovascular Research 85 (2009), 194–203.

10.

Alpoim

P.N.

Godoi

L.C.

Freitas

L.G.

Gomes

K.B.

and Dusse

L.M.

, Assessment of L-arginine asymmetric 1 dimethyl (ADMA) in early-onset and late-onset (severe) preeclampsia, Nitric Oxide 33 (2013), 81–82.

11.

Vallance

and Leiper

, Cardiovascular biology of the asymmetric dimethylarginine: dimethylarginine dimethylaminohydrolase pathway, Arteriosclerosis, Thrombosis, and Vascular Biology 24 (2004), 1023–1030.

12.

Niu

P.-P.

et al., Hypermethylation of DDAH2 promoter contributes to the dysfunction of endothelial progenitor cells in coronary artery disease patients, Journal of Translational Medicine 12 (2014), 170.

13.

Tamás

et al., L-arginine metabolism in early-onset and late-onset pre-eclamptic pregnancies, Scandinavian Journal of Clinical and Laboratory Investigation 73 (2013), 436–443.

14.

Leiper

and Nandi

, The therapeutic potential of targeting endogenous inhibitors of nitric oxide synthesis, Nature reviews Drug Discovery 10 (2011), 277.

15.

Romero

, Clinical application of nitric oxide donors and blockers, Human Reproduction (Oxford, England) 13 (1998), 248–250.

16.

Alexander

J.M.

and Wilson

K.L.

, Hypertensive emergencies of pregnancy, Obstetrics and Gynecology Clinics of North America 40 (2013), 89–101.

17.

Bolte

A.C.

van Geijn

H.P.

and Dekker

G.A.

, Pharmacological treatment of severe hypertension in pregnancy and the role of serotonin2-receptor blockers, European Journal of Obstetrics and Gynecology and Reproductive Biology 95 (2001), 22–36.

18.

Noris

et al., L-arginine depletion in preeclampsia orients nitric oxide synthase toward oxidant species, Hypertension 43 (2004), 614–622.

19.

Prieto

et al., Hypoxia-reduced nitric oxide synthase activity is partially explained by higher arginase-2 activity and cellular redistribution in human umbilical vein endothelium, Placenta 32 (2011), 932–940.

20.

Siroen

M.P.

et al., No compensatory upregulation of placental dimethylarginine dimethylaminohydrolase activity in preeclampsia, Gynecologic and Obstetric Investigation 62 (2006), 7–13.

21.

Kim

et al., Reduced L-arginine level and decreased placental eNOS activity in preeclampsia, Placenta 27 (2006), 438–444.

22.

Maas

, Pharmacotherapies and their influence on asymmetric dimethylargine (ADMA), Vascular Medicine 10 (2005), S49–S57.

23.

Alacam

et al., The role of asymmetric dimethyl arginine and oxidant/antioxidant system in preeclampsia, Fetal and Pediatric Pathology 30 (2011), 387–393.

24.

Anderssohn

et al., Severely decreased activity of placental dimethylarginine dimethylaminohydrolase in pre-eclampsia, European Journal of Obstetrics and Gynecology and Reproductive Biology 161 (2012), 152–156.

25.

Tomikawa

Fukatsu

Tanaka

and Shiota

, DNA methylation-dependent epigenetic regulation of dimethylarginine dimethylaminohydrolase 2 gene in trophoblast cell lineage, Journal of Biological Chemistry 281 (2006), 12163–12169.

26.

Jones

Tran